ID: 1089479732

View in Genome Browser
Species Human (GRCh38)
Location 11:118794354-118794376
Sequence CCTCCGCCTCCCCAGGTTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089479732_1089479737 18 Left 1089479732 11:118794354-118794376 CCTTGAACCTGGGGAGGCGGAGG No data
Right 1089479737 11:118794395-118794417 GTGCCATTGCACTCCAGCCTGGG 0: 15928
1: 89734
2: 180782
3: 209477
4: 154158
1089479732_1089479736 17 Left 1089479732 11:118794354-118794376 CCTTGAACCTGGGGAGGCGGAGG No data
Right 1089479736 11:118794394-118794416 CGTGCCATTGCACTCCAGCCTGG 0: 8058
1: 56168
2: 160211
3: 215206
4: 189668

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089479732 Original CRISPR CCTCCGCCTCCCCAGGTTCA AGG (reversed) Intergenic
No off target data available for this crispr