ID: 1089480807

View in Genome Browser
Species Human (GRCh38)
Location 11:118803495-118803517
Sequence ATCCAGCTGTGTCACCTATT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089480800_1089480807 21 Left 1089480800 11:118803451-118803473 CCGTGACCAGGACCAGGACACCA No data
Right 1089480807 11:118803495-118803517 ATCCAGCTGTGTCACCTATTGGG No data
1089480801_1089480807 15 Left 1089480801 11:118803457-118803479 CCAGGACCAGGACACCATGCTGG No data
Right 1089480807 11:118803495-118803517 ATCCAGCTGTGTCACCTATTGGG No data
1089480805_1089480807 1 Left 1089480805 11:118803471-118803493 CCATGCTGGATGCTGAAGGTTCA No data
Right 1089480807 11:118803495-118803517 ATCCAGCTGTGTCACCTATTGGG No data
1089480803_1089480807 9 Left 1089480803 11:118803463-118803485 CCAGGACACCATGCTGGATGCTG No data
Right 1089480807 11:118803495-118803517 ATCCAGCTGTGTCACCTATTGGG No data
1089480799_1089480807 22 Left 1089480799 11:118803450-118803472 CCCGTGACCAGGACCAGGACACC No data
Right 1089480807 11:118803495-118803517 ATCCAGCTGTGTCACCTATTGGG No data
1089480798_1089480807 23 Left 1089480798 11:118803449-118803471 CCCCGTGACCAGGACCAGGACAC No data
Right 1089480807 11:118803495-118803517 ATCCAGCTGTGTCACCTATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089480807 Original CRISPR ATCCAGCTGTGTCACCTATT GGG Intergenic
No off target data available for this crispr