ID: 1089488126

View in Genome Browser
Species Human (GRCh38)
Location 11:118862961-118862983
Sequence ATCCCAGTTCTGCTACTTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089488121_1089488126 24 Left 1089488121 11:118862914-118862936 CCTAGAGGTGAAATATACAATGG No data
Right 1089488126 11:118862961-118862983 ATCCCAGTTCTGCTACTTATTGG No data
1089488125_1089488126 -5 Left 1089488125 11:118862943-118862965 CCAGACTGGCTGGTTCAGATCCC No data
Right 1089488126 11:118862961-118862983 ATCCCAGTTCTGCTACTTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089488126 Original CRISPR ATCCCAGTTCTGCTACTTAT TGG Intergenic
No off target data available for this crispr