ID: 1089489902

View in Genome Browser
Species Human (GRCh38)
Location 11:118876309-118876331
Sequence CTTGTTACCTCCAGGTTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089489902_1089489905 -3 Left 1089489902 11:118876309-118876331 CCTGGCAACCTGGAGGTAACAAG No data
Right 1089489905 11:118876329-118876351 AAGCCCTCCTGGTGACTCTGAGG No data
1089489902_1089489910 24 Left 1089489902 11:118876309-118876331 CCTGGCAACCTGGAGGTAACAAG No data
Right 1089489910 11:118876356-118876378 AAGTGTGAGGAGCACTCCCCTGG No data
1089489902_1089489909 11 Left 1089489902 11:118876309-118876331 CCTGGCAACCTGGAGGTAACAAG No data
Right 1089489909 11:118876343-118876365 ACTCTGAGGCATAAAGTGTGAGG No data
1089489902_1089489911 25 Left 1089489902 11:118876309-118876331 CCTGGCAACCTGGAGGTAACAAG No data
Right 1089489911 11:118876357-118876379 AGTGTGAGGAGCACTCCCCTGGG No data
1089489902_1089489912 26 Left 1089489902 11:118876309-118876331 CCTGGCAACCTGGAGGTAACAAG No data
Right 1089489912 11:118876358-118876380 GTGTGAGGAGCACTCCCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089489902 Original CRISPR CTTGTTACCTCCAGGTTGCC AGG (reversed) Intergenic