ID: 1089489903

View in Genome Browser
Species Human (GRCh38)
Location 11:118876317-118876339
Sequence CAGGAGGGCTTGTTACCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089489903_1089489912 18 Left 1089489903 11:118876317-118876339 CCTGGAGGTAACAAGCCCTCCTG No data
Right 1089489912 11:118876358-118876380 GTGTGAGGAGCACTCCCCTGGGG No data
1089489903_1089489913 30 Left 1089489903 11:118876317-118876339 CCTGGAGGTAACAAGCCCTCCTG No data
Right 1089489913 11:118876370-118876392 CTCCCCTGGGGATGCCTGTTTGG No data
1089489903_1089489910 16 Left 1089489903 11:118876317-118876339 CCTGGAGGTAACAAGCCCTCCTG No data
Right 1089489910 11:118876356-118876378 AAGTGTGAGGAGCACTCCCCTGG No data
1089489903_1089489911 17 Left 1089489903 11:118876317-118876339 CCTGGAGGTAACAAGCCCTCCTG No data
Right 1089489911 11:118876357-118876379 AGTGTGAGGAGCACTCCCCTGGG No data
1089489903_1089489909 3 Left 1089489903 11:118876317-118876339 CCTGGAGGTAACAAGCCCTCCTG No data
Right 1089489909 11:118876343-118876365 ACTCTGAGGCATAAAGTGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089489903 Original CRISPR CAGGAGGGCTTGTTACCTCC AGG (reversed) Intergenic