ID: 1089489906

View in Genome Browser
Species Human (GRCh38)
Location 11:118876332-118876354
Sequence ATGCCTCAGAGTCACCAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089489906_1089489918 29 Left 1089489906 11:118876332-118876354 CCCTCCTGGTGACTCTGAGGCAT No data
Right 1089489918 11:118876384-118876406 CCTGTTTGGCATTCTGTGTTTGG No data
1089489906_1089489913 15 Left 1089489906 11:118876332-118876354 CCCTCCTGGTGACTCTGAGGCAT No data
Right 1089489913 11:118876370-118876392 CTCCCCTGGGGATGCCTGTTTGG No data
1089489906_1089489910 1 Left 1089489906 11:118876332-118876354 CCCTCCTGGTGACTCTGAGGCAT No data
Right 1089489910 11:118876356-118876378 AAGTGTGAGGAGCACTCCCCTGG No data
1089489906_1089489911 2 Left 1089489906 11:118876332-118876354 CCCTCCTGGTGACTCTGAGGCAT No data
Right 1089489911 11:118876357-118876379 AGTGTGAGGAGCACTCCCCTGGG No data
1089489906_1089489912 3 Left 1089489906 11:118876332-118876354 CCCTCCTGGTGACTCTGAGGCAT No data
Right 1089489912 11:118876358-118876380 GTGTGAGGAGCACTCCCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089489906 Original CRISPR ATGCCTCAGAGTCACCAGGA GGG (reversed) Intergenic