ID: 1089489908

View in Genome Browser
Species Human (GRCh38)
Location 11:118876336-118876358
Sequence CTTTATGCCTCAGAGTCACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089489908_1089489912 -1 Left 1089489908 11:118876336-118876358 CCTGGTGACTCTGAGGCATAAAG No data
Right 1089489912 11:118876358-118876380 GTGTGAGGAGCACTCCCCTGGGG No data
1089489908_1089489918 25 Left 1089489908 11:118876336-118876358 CCTGGTGACTCTGAGGCATAAAG No data
Right 1089489918 11:118876384-118876406 CCTGTTTGGCATTCTGTGTTTGG No data
1089489908_1089489913 11 Left 1089489908 11:118876336-118876358 CCTGGTGACTCTGAGGCATAAAG No data
Right 1089489913 11:118876370-118876392 CTCCCCTGGGGATGCCTGTTTGG No data
1089489908_1089489910 -3 Left 1089489908 11:118876336-118876358 CCTGGTGACTCTGAGGCATAAAG No data
Right 1089489910 11:118876356-118876378 AAGTGTGAGGAGCACTCCCCTGG No data
1089489908_1089489911 -2 Left 1089489908 11:118876336-118876358 CCTGGTGACTCTGAGGCATAAAG No data
Right 1089489911 11:118876357-118876379 AGTGTGAGGAGCACTCCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089489908 Original CRISPR CTTTATGCCTCAGAGTCACC AGG (reversed) Intergenic