ID: 1089489909

View in Genome Browser
Species Human (GRCh38)
Location 11:118876343-118876365
Sequence ACTCTGAGGCATAAAGTGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089489903_1089489909 3 Left 1089489903 11:118876317-118876339 CCTGGAGGTAACAAGCCCTCCTG No data
Right 1089489909 11:118876343-118876365 ACTCTGAGGCATAAAGTGTGAGG No data
1089489902_1089489909 11 Left 1089489902 11:118876309-118876331 CCTGGCAACCTGGAGGTAACAAG No data
Right 1089489909 11:118876343-118876365 ACTCTGAGGCATAAAGTGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089489909 Original CRISPR ACTCTGAGGCATAAAGTGTG AGG Intergenic