ID: 1089489910

View in Genome Browser
Species Human (GRCh38)
Location 11:118876356-118876378
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089489902_1089489910 24 Left 1089489902 11:118876309-118876331 CCTGGCAACCTGGAGGTAACAAG No data
Right 1089489910 11:118876356-118876378 AAGTGTGAGGAGCACTCCCCTGG No data
1089489907_1089489910 0 Left 1089489907 11:118876333-118876355 CCTCCTGGTGACTCTGAGGCATA No data
Right 1089489910 11:118876356-118876378 AAGTGTGAGGAGCACTCCCCTGG No data
1089489908_1089489910 -3 Left 1089489908 11:118876336-118876358 CCTGGTGACTCTGAGGCATAAAG No data
Right 1089489910 11:118876356-118876378 AAGTGTGAGGAGCACTCCCCTGG No data
1089489903_1089489910 16 Left 1089489903 11:118876317-118876339 CCTGGAGGTAACAAGCCCTCCTG No data
Right 1089489910 11:118876356-118876378 AAGTGTGAGGAGCACTCCCCTGG No data
1089489906_1089489910 1 Left 1089489906 11:118876332-118876354 CCCTCCTGGTGACTCTGAGGCAT No data
Right 1089489910 11:118876356-118876378 AAGTGTGAGGAGCACTCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089489910 Original CRISPR AAGTGTGAGGAGCACTCCCC TGG Intergenic