ID: 1089489918

View in Genome Browser
Species Human (GRCh38)
Location 11:118876384-118876406
Sequence CCTGTTTGGCATTCTGTGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089489908_1089489918 25 Left 1089489908 11:118876336-118876358 CCTGGTGACTCTGAGGCATAAAG No data
Right 1089489918 11:118876384-118876406 CCTGTTTGGCATTCTGTGTTTGG No data
1089489906_1089489918 29 Left 1089489906 11:118876332-118876354 CCCTCCTGGTGACTCTGAGGCAT No data
Right 1089489918 11:118876384-118876406 CCTGTTTGGCATTCTGTGTTTGG No data
1089489907_1089489918 28 Left 1089489907 11:118876333-118876355 CCTCCTGGTGACTCTGAGGCATA No data
Right 1089489918 11:118876384-118876406 CCTGTTTGGCATTCTGTGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089489918 Original CRISPR CCTGTTTGGCATTCTGTGTT TGG Intergenic