ID: 1089490103

View in Genome Browser
Species Human (GRCh38)
Location 11:118877622-118877644
Sequence GCTCCCTCCACAAGACCACA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089490103_1089490106 -2 Left 1089490103 11:118877622-118877644 CCGTGTGGTCTTGTGGAGGGAGC No data
Right 1089490106 11:118877643-118877665 GCCCTGGATTTGGTGCCTACAGG No data
1089490103_1089490110 10 Left 1089490103 11:118877622-118877644 CCGTGTGGTCTTGTGGAGGGAGC No data
Right 1089490110 11:118877655-118877677 GTGCCTACAGGGCTGACTTCAGG No data
1089490103_1089490108 -1 Left 1089490103 11:118877622-118877644 CCGTGTGGTCTTGTGGAGGGAGC No data
Right 1089490108 11:118877644-118877666 CCCTGGATTTGGTGCCTACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089490103 Original CRISPR GCTCCCTCCACAAGACCACA CGG (reversed) Intergenic
No off target data available for this crispr