ID: 1089494033

View in Genome Browser
Species Human (GRCh38)
Location 11:118899547-118899569
Sequence CCCAGCTCGGGGAGGGTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 362
Summary {0: 1, 1: 0, 2: 4, 3: 32, 4: 325}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089494020_1089494033 16 Left 1089494020 11:118899508-118899530 CCTGTAGGGAATAGAAGACAGGG 0: 1
1: 0
2: 2
3: 15
4: 161
Right 1089494033 11:118899547-118899569 CCCAGCTCGGGGAGGGTGCAGGG 0: 1
1: 0
2: 4
3: 32
4: 325
1089494018_1089494033 17 Left 1089494018 11:118899507-118899529 CCCTGTAGGGAATAGAAGACAGG 0: 1
1: 0
2: 2
3: 12
4: 198
Right 1089494033 11:118899547-118899569 CCCAGCTCGGGGAGGGTGCAGGG 0: 1
1: 0
2: 4
3: 32
4: 325

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089494033 Original CRISPR CCCAGCTCGGGGAGGGTGCA GGG Intronic
900109001 1:997843-997865 CGGAGCTCAGGGAGGGGGCAGGG + Intergenic
900149295 1:1171206-1171228 CCCAGGGAGGGGAGGCTGCAGGG + Intergenic
900246526 1:1638671-1638693 CCCGGCACGGGGCAGGTGCAGGG + Intronic
900257753 1:1705813-1705835 CCCAGCACGGGGCAGGTGCAGGG + Intronic
900297493 1:1959341-1959363 CCCAGGTGGGGGTGGGTGGAGGG - Intronic
900457387 1:2783841-2783863 CCCAGCCCGGGGAGGGCAGAGGG + Intronic
900605942 1:3523571-3523593 CCCAGCTTGGGGAGCCTGGAGGG - Intronic
900639342 1:3681372-3681394 CACAGCTGGGGGAGGGGACAGGG - Intronic
901026693 1:6282163-6282185 CCCAGGCCGGGGAGGGTGGTGGG - Intronic
901681278 1:10914309-10914331 CCCAGCTCTGTGTGGATGCAAGG - Intergenic
901881981 1:12199372-12199394 CCCAGCCCAGGGAGGGTGTGGGG + Intronic
902090424 1:13898559-13898581 CCCAGCTCGTGGAGGGTGGAAGG + Intergenic
902110532 1:14074562-14074584 GACAGCTGTGGGAGGGTGCAGGG + Intergenic
902348360 1:15835558-15835580 CCCAGCACGGGGAGAGGGCAGGG - Intergenic
902348882 1:15838634-15838656 CCCAGGAGGGGGAGGTTGCAGGG + Intergenic
903174908 1:21575020-21575042 CCCACCTCCGGGTGAGTGCAGGG - Intronic
903207917 1:21796639-21796661 CCCAGGACGTGGAGGTTGCAGGG + Intergenic
903328221 1:22583425-22583447 CTCAGCTCTGGGACGGTGCTGGG + Intronic
903604154 1:24562773-24562795 CCCAGCTGGGGGTGGGTGTGGGG - Intronic
903648932 1:24911460-24911482 CGCAGCTCGGGGTGGGGGAAAGG - Intronic
904114298 1:28150240-28150262 CCCAGCTCAGCAAGGGTCCAGGG + Exonic
904366497 1:30014177-30014199 TTCAGCTCGGGGAGAGAGCAGGG - Intergenic
904459381 1:30666524-30666546 CCCAGCTCGGAGAAGGTGGGGGG + Intergenic
905263935 1:36738394-36738416 CCCAGCTCTGGGGATGTGCATGG - Intergenic
905656933 1:39691477-39691499 CCCATCCCGGGCAGGTTGCACGG + Exonic
906144439 1:43551493-43551515 GCCAGCTCAGGGAGGCTGTAGGG - Intronic
907323308 1:53619212-53619234 CCCAGCTCAGGGTGGGTGGATGG - Intronic
907441389 1:54480686-54480708 CCCAGCTGGGGAAGGGAGGAGGG - Intergenic
907461639 1:54608904-54608926 CCAAGCTAGGGGAGGGTCCTGGG - Intronic
910140177 1:84018461-84018483 CCCACCTGGTGGAGGGGGCAGGG + Intergenic
914226132 1:145721015-145721037 CCCAGCGCGGGCAGGGGGGAGGG - Intronic
915064552 1:153214058-153214080 CCCAGCAGGTGGAGGTTGCAGGG - Intergenic
915219338 1:154361744-154361766 CCCAGCTACTGGAGGGTGCAGGG + Intergenic
915302833 1:154961482-154961504 CCCAGCACCGGGAGGAAGCAGGG - Exonic
915762642 1:158330422-158330444 CCCAGCAAGAGGAGGGTGCGGGG + Intronic
916299745 1:163260498-163260520 CTCAGCAGGGGGAGGGTGCGAGG + Intronic
917733234 1:177897397-177897419 CCCAGCTGGGGAAGGGAGCATGG + Intergenic
917854354 1:179089044-179089066 CCTAGCTTGGGGAGTGTGGAGGG + Intronic
918296780 1:183164589-183164611 CCAAGGTGGGGGCGGGTGCAAGG + Intergenic
920350638 1:205335796-205335818 CCCAGCCCTGGGAGGGGGAAGGG + Intergenic
921898752 1:220428421-220428443 CCCAGATGGAGGAGGCTGCATGG - Intergenic
922866216 1:228863535-228863557 CTCTGCCTGGGGAGGGTGCAAGG + Intergenic
923278032 1:232415504-232415526 CCCACCTCGTGGATGCTGCACGG - Exonic
1063386752 10:5620672-5620694 CTCAGCTCAGGGCTGGTGCAGGG - Intergenic
1064052315 10:12069183-12069205 CCCAGGTCGGGGATGGGGCCCGG + Exonic
1065255790 10:23866608-23866630 CCAAGCAGGGGTAGGGTGCACGG - Intronic
1066093931 10:32055589-32055611 CCCAGGTGGGGGAGTGTCCAGGG + Intronic
1069803105 10:71094617-71094639 CCCAGCTAGGTGAGGCTGAATGG - Intergenic
1070460122 10:76658067-76658089 CCTAGATGGGGGAGGGTGGAAGG + Intergenic
1070751863 10:78968645-78968667 CCCAGCTCTGGGATGGGGCAGGG - Intergenic
1072548403 10:96458001-96458023 CCCAGCTCTGGGACGGTGCCTGG + Intronic
1072716685 10:97757017-97757039 CTCAGCTCTGGAAGGGTTCAGGG + Intronic
1073456064 10:103637451-103637473 TCCAGGTGGGGAAGGGTGCATGG + Intronic
1074158860 10:110820862-110820884 CCCTGCTGGGAGAGGGTGCTTGG + Intronic
1074818557 10:117163052-117163074 CCCACCTCCCGGAGGGGGCACGG - Intergenic
1074853211 10:117455230-117455252 CCCAGCTTGAGGAAGGTGCAGGG + Intergenic
1075832739 10:125425143-125425165 CAGAACTCGAGGAGGGTGCATGG - Intergenic
1075873590 10:125788824-125788846 CCCAGCCCAGGGAGGCTGCATGG + Exonic
1076203277 10:128574808-128574830 CCCACCTCGGGGAGGCGGGACGG + Intergenic
1077024831 11:434486-434508 CGCAGCACTGGGAGTGTGCAGGG - Intronic
1077027356 11:446920-446942 CCCGCCTGGGGAAGGGTGCACGG - Intergenic
1077112790 11:869297-869319 TCCAGCACGGCAAGGGTGCAGGG - Exonic
1078498282 11:11842138-11842160 CCCTGCCGGGGGAGGGTGGAGGG - Exonic
1079027655 11:16961531-16961553 CACAGCCAGGGGTGGGTGCAGGG - Intronic
1080361359 11:31517690-31517712 CCCAGGAGGGGGAGGTTGCAGGG - Intronic
1080386319 11:31813072-31813094 CCCAGCCCGGGGAGGGGAGAGGG - Intronic
1081933125 11:46886296-46886318 CCCAGCGTGGGGAGGTTGAAGGG - Intronic
1081991750 11:47341637-47341659 ACAAGCTGGGGGAGGGTGCTGGG + Intronic
1082785600 11:57314598-57314620 CCCAGTTAGGTGAGGGTGAAGGG + Intronic
1083253444 11:61482564-61482586 GCCATCTGTGGGAGGGTGCAGGG + Intronic
1083726249 11:64630149-64630171 CCCCTATGGGGGAGGGTGCAGGG - Intronic
1084541072 11:69787587-69787609 AGCAGCCCAGGGAGGGTGCAGGG - Intergenic
1084906725 11:72354180-72354202 CCCAGCTAAGAGAGGTTGCAAGG - Intronic
1085409451 11:76282572-76282594 CCCATCCCGGGGCAGGTGCAGGG + Intergenic
1089351872 11:117825895-117825917 CCCTGCTTGGGGAGGATTCATGG - Intronic
1089378694 11:118012678-118012700 CCCAGATTGGGGATGGGGCAGGG + Intergenic
1089494033 11:118899547-118899569 CCCAGCTCGGGGAGGGTGCAGGG + Intronic
1089626273 11:119753057-119753079 CCCAGCTGGGAGAGCCTGCATGG - Intergenic
1089653781 11:119932645-119932667 GCCAGGTCGGGAAGGGGGCAGGG + Intergenic
1089774709 11:120828164-120828186 CCCAGTGCAGGCAGGGTGCATGG - Intronic
1090214992 11:124954080-124954102 CCCAGCTCCGGGAGGGGACGCGG + Intergenic
1091059992 11:132452305-132452327 CCAAGCTGGGGGAGGATGAAAGG + Intronic
1091230446 11:133984617-133984639 CCCAGCCAGGGGAAGGAGCACGG - Intergenic
1091339413 11:134798683-134798705 GCCAGCTCCTGGAGGCTGCACGG + Intergenic
1091791341 12:3273858-3273880 CTGAGATCGGGGAGGGAGCAAGG - Intronic
1092920994 12:13231877-13231899 CCCAGATCAATGAGGGTGCAAGG - Intergenic
1095875993 12:47080123-47080145 CGCAGAGCGGGGAGGGGGCAGGG + Intronic
1096407414 12:51354094-51354116 GGCAGCTGGGGGAGGGTTCAGGG - Exonic
1096413829 12:51395637-51395659 CTTAGCTAGGGGAGTGTGCAAGG + Intronic
1096990863 12:55801691-55801713 CCCAGGAGGGGGAGGCTGCAGGG - Intronic
1099173762 12:79397101-79397123 CCCAGCACTGGGAGAGTGAAAGG + Intronic
1101593010 12:106139531-106139553 CGGAGCTGGGGGAGGGGGCAGGG + Exonic
1101785900 12:107883291-107883313 CCCTGCTCTGGGAGAGTGGAAGG - Intergenic
1102015890 12:109647755-109647777 CCCAGCTCTGGGAGGCAGCCTGG + Intergenic
1102222708 12:111205207-111205229 GCCAGCTCTGGGAGGGGGCTGGG - Intronic
1102652124 12:114449437-114449459 ACCAGCTAGTGGCGGGTGCAGGG - Intergenic
1103443766 12:120980869-120980891 CCCAGCTGGGAGAAGGGGCACGG + Intronic
1103598464 12:122038734-122038756 CACAGCCAGGGGAAGGTGCAGGG - Intronic
1104356826 12:128094327-128094349 CCCAGGAAGGGGAGGTTGCAGGG - Intergenic
1104426788 12:128684506-128684528 CCCAGCTTGGGGAGGAGGAAGGG - Intronic
1104856521 12:131904823-131904845 CCCAGGTCAGGGAGTGGGCATGG + Intronic
1105364274 13:19750354-19750376 CCCAGGTGGTGGAGGCTGCAGGG + Intronic
1105935864 13:25097898-25097920 CCCAGCAAGAGTAGGGTGCATGG - Exonic
1107217463 13:37937815-37937837 CCCAGCAGGTGGAGGTTGCAGGG + Intergenic
1108900141 13:55392490-55392512 CAGAGATGGGGGAGGGTGCAAGG - Intergenic
1112140314 13:96634107-96634129 CCCAGCTCAGGGAGCCAGCATGG - Intronic
1113604855 13:111597905-111597927 CCCAGAATGTGGAGGGTGCAGGG - Intronic
1114235204 14:20817413-20817435 CCCAGCTTGTGGAGGGGGCTGGG - Intergenic
1114270607 14:21098189-21098211 CCCGGCTCGGAGCAGGTGCAGGG - Intronic
1114613679 14:24057457-24057479 CACAGCTGGGGAAGGGAGCAAGG - Intronic
1114737867 14:25061619-25061641 CCCAGCTTGGGGAGTGGGAAGGG + Intergenic
1115027205 14:28759252-28759274 CTCAGCTGGGGGAGGGCGCGCGG + Intergenic
1117079921 14:52141360-52141382 ACCAGCTCTGGGAAGGTGTAAGG - Intergenic
1118592947 14:67414460-67414482 AACAGCTGGGGGAGGGGGCAGGG + Intergenic
1118881426 14:69829632-69829654 CCCCGCTCGGGTAGGGTGGGAGG + Intergenic
1119668043 14:76498829-76498851 CACAGATGGGGGAGGGGGCAAGG - Intronic
1121008362 14:90504853-90504875 CCCAGCGTGGGGACTGTGCATGG - Intergenic
1121197936 14:92091373-92091395 CCCAGGTGGCGGAGGTTGCAGGG + Intronic
1121820523 14:96962181-96962203 CCCAGCCCTGGGAGGGTGTTAGG - Intergenic
1122443322 14:101749818-101749840 CCCACCTCTGGGGGGGGGCAGGG - Intergenic
1122784475 14:104157510-104157532 CCCAGCTCGGGGTGTGTGGGCGG - Intronic
1122996535 14:105268333-105268355 CCCAGCCCAGGGAGGCTGCGTGG - Intronic
1123039766 14:105485748-105485770 CCCAGCTTGGGGAGAGGGCAGGG - Intergenic
1124003303 15:25777256-25777278 CCCACCTTTGAGAGGGTGCATGG - Intronic
1125687653 15:41572939-41572961 CCCAGCTGGGGCAGGATGGATGG - Intronic
1127611466 15:60641483-60641505 CCCAGGACGCGGAGGTTGCAGGG - Intronic
1129148549 15:73671779-73671801 CACAGCACGGGGAGGGTGAAAGG - Intergenic
1132307066 15:100823828-100823850 CCCAGGAAGGGGAGGGGGCAAGG + Intergenic
1132458864 16:39473-39495 CCCAGCTAAGGGAGGGTGAATGG - Intergenic
1132618691 16:854448-854470 CCCAGCTTGGGCTGGGCGCAGGG + Exonic
1132728284 16:1348233-1348255 CCCAGGTGGGCGGGGGTGCAAGG + Exonic
1132752650 16:1465880-1465902 CCCAGCTCAGGGCAGGGGCAGGG + Intronic
1132761575 16:1511017-1511039 ACCTGCTCGGGGACGGTGCGTGG + Exonic
1133222147 16:4323383-4323405 CCCAGCTTTGGGGGGGTGCTTGG - Intronic
1133770357 16:8863999-8864021 CACAGCTGGGGGAGGGAGGAAGG + Intronic
1134816555 16:17210658-17210680 CCCAGCACTGGGAGGCTGAAGGG - Intronic
1135591353 16:23707051-23707073 ACCAGCTCAGGGATGGTGAATGG + Exonic
1135893840 16:26380518-26380540 CCCAGGTCAAGGAAGGTGCAGGG + Intergenic
1136230506 16:28882925-28882947 CCAAGCTTGGGGTGGGTGGAAGG - Intronic
1136314985 16:29449229-29449251 CCCAGCTCGGTGAGAGGGCTGGG + Intronic
1136429562 16:30188568-30188590 CCCAGCTCGGTGAGAGGGCTGGG + Exonic
1136911387 16:34147173-34147195 CCCAGCCAGGGGAGGGTGGCGGG - Intergenic
1136989280 16:35142303-35142325 CCCGGCTTGGGCTGGGTGCAGGG + Intergenic
1137820602 16:51441035-51441057 CGCAGCTCGGGGTGGGGGTAGGG + Intergenic
1137863011 16:51865695-51865717 CCGAGCTCGGGGTGGGGTCAAGG + Intergenic
1137960821 16:52880249-52880271 TGCATCTGGGGGAGGGTGCATGG + Intergenic
1138274810 16:55726267-55726289 CCCAGCTTGGCCAGGGTGAATGG - Intergenic
1138288497 16:55828200-55828222 CCCAGCTTGGCCAGGGTGAATGG + Intronic
1141431392 16:83971995-83972017 CCCAGCCCGGGGAGGGGGAGAGG + Intronic
1142635336 17:1253746-1253768 CCCAGCTCAGGGAAGGGGCGTGG - Intergenic
1143020906 17:3916804-3916826 CCCTGGTGGGGGAGGGTGGAGGG - Intergenic
1144626601 17:16847163-16847185 CCCAGCTCGGGGTGTGTGTGGGG - Intergenic
1144879831 17:18425548-18425570 CCCAGCTCGGGGTGTGTGTGGGG + Intergenic
1145152403 17:20518836-20518858 CCCAGCTCGGGGTGTGTGTGGGG - Intergenic
1146480193 17:33198795-33198817 CCCAGCTAGGGTAAGATGCATGG + Intronic
1147166220 17:38594853-38594875 CCCGGCTGGAGGAGGGTGTATGG - Intronic
1147580742 17:41625850-41625872 CCCAGCTCGGGGTGTGTGTGGGG - Intergenic
1147586239 17:41655316-41655338 CCCAGCTGTGGGAGGGCTCAGGG - Intergenic
1147651256 17:42063179-42063201 CCCAGCCCGAGGATGGTGGAAGG + Intronic
1148074399 17:44927155-44927177 CCCAGCTCGGGCATGGGGGAGGG + Intronic
1148600879 17:48893269-48893291 CTCAGCTGGGGCACGGTGCAAGG + Intronic
1149655660 17:58308516-58308538 CCCAGGGCGGGGAGTGAGCACGG + Intronic
1149996428 17:61408333-61408355 GCCAGCTCGGGCAGGGGGCTAGG - Exonic
1150139537 17:62716535-62716557 CCCAGCTCTGGGATGGGGCCAGG - Intronic
1150209939 17:63436381-63436403 CACAGCTGGGGGAGGTTGGAGGG - Intronic
1150483439 17:65528102-65528124 CCCAGAATGGGGAGGGTGCCTGG + Intergenic
1151552819 17:74831811-74831833 CCCACCTCGTGGAGGCTGCGTGG - Intronic
1151674797 17:75591895-75591917 CCCAGCTAGGGGCAGGTCCAGGG - Intergenic
1151744575 17:76005044-76005066 CCCTTCTCGGGGAGGGTCCCAGG - Intronic
1152005152 17:77675934-77675956 ACCAGCTCAAGGAGGTTGCAGGG - Intergenic
1152323465 17:79622349-79622371 GAGAGCCCGGGGAGGGTGCAGGG - Intergenic
1152595659 17:81236468-81236490 CCCAGCGGAGGGAGGGGGCAGGG + Intronic
1152618075 17:81346819-81346841 CCCAGCCCGGGCAGGGTTCGTGG + Intergenic
1152768376 17:82152978-82153000 CCCAGCTGAGGACGGGTGCAGGG + Intronic
1152854316 17:82655528-82655550 CCCAGCTCGCTGATGGTGAAGGG - Exonic
1153774044 18:8437338-8437360 CCCTGCTGGGAGAGGGTGGAGGG - Intergenic
1155153904 18:23142802-23142824 CCCACCTGGGGAGGGGTGCAGGG + Intronic
1155551624 18:26971749-26971771 CCCAGCTCGGGGGGCGGGCAGGG + Intronic
1155876956 18:31101006-31101028 CCCAGCTCTGGGAAGGGGTAGGG + Intronic
1157609662 18:48948743-48948765 CCGAGGACGGGGAGGGGGCATGG - Intronic
1157718851 18:49907975-49907997 CCCTGCTTGGGGAGGCTCCATGG + Intronic
1158930974 18:62325126-62325148 CCCCGCTCGGGGAGGGGCCCCGG - Intergenic
1160716198 19:577909-577931 CCCAGCTCTGGGACGGCGCCCGG + Exonic
1160837254 19:1130714-1130736 CCCAGTTGGTGGAGGTTGCAGGG + Intronic
1160877324 19:1302750-1302772 CCCAGCGCGGGGTGGACGCACGG + Intergenic
1161153380 19:2720908-2720930 CCCACCCCGGGGAGGGGGCGCGG + Intronic
1161166776 19:2791928-2791950 CCTGGCTGGGGGAGGGTGCCAGG - Intronic
1161264561 19:3358477-3358499 CGCAGCTGGGGGAGGTTGCAGGG - Intergenic
1161694439 19:5758150-5758172 CCCAGCCCGGGGAGGGTAGCCGG + Intronic
1162524226 19:11197880-11197902 CCCAGCTCGGGGAGGGCGCGCGG + Intergenic
1162731596 19:12721902-12721924 CCGAACTGGGGGAGGCTGCAAGG - Intronic
1163673837 19:18645358-18645380 CCCATGTCGGAGAGGCTGCAAGG - Intronic
1163688345 19:18725032-18725054 CCCAGCTCCAGGCGGGTCCAAGG - Intronic
1164527366 19:29022128-29022150 CCCAGCACAGGGAAGGTGCGGGG - Intergenic
1165157246 19:33796217-33796239 CCGGGCTCGGGGAGGGGGCGGGG - Intronic
1165549736 19:36573668-36573690 CCCGGGCCGGGGAGGGTGAAGGG + Intronic
1166329369 19:42069623-42069645 CCCGGCTAGGGGAGGGGGCGGGG - Intronic
1166679953 19:44759878-44759900 ACCAGCTCTGGGAGGGGACATGG - Exonic
1166855853 19:45782368-45782390 CCCGGCCCGGGGAGGGGCCATGG - Intronic
1167276538 19:48543528-48543550 CCCAGCCCGAGGGTGGTGCATGG - Intergenic
1167713282 19:51125208-51125230 CCCAGCTCGGGCAGTGTGGGAGG + Exonic
1167966994 19:53156038-53156060 CCCAGCTCGGGGGGGGGGGGGGG + Intronic
1168179276 19:54649827-54649849 CCCAGCTGGGCCAGAGTGCATGG - Intronic
925614488 2:5732535-5732557 TCCAGCCCTTGGAGGGTGCACGG + Intergenic
928194963 2:29209050-29209072 CCCAGGTCGGGCAGGATGCAGGG - Intronic
928278104 2:29920705-29920727 CCCATCTCGGGGAGAGCGAAGGG - Exonic
929153954 2:38772985-38773007 CCCAGGAGGGGTAGGGTGCAAGG - Intronic
929536830 2:42789029-42789051 TCCAGCCAGGGGAGAGTGCAGGG - Intronic
934215647 2:90029022-90029044 CCCAGCTCAGGATGGGAGCAGGG + Intergenic
934576632 2:95405848-95405870 CCCAGAGCGGGGAGGGTGCAGGG - Intronic
934794797 2:97091395-97091417 CCCAGAGCGGGGAGGGTGCAGGG + Intronic
934853604 2:97716050-97716072 CCCAGGCTGGGGAGGGGGCAGGG + Intronic
935653175 2:105399182-105399204 CGCAGCCCGGGGCGGGGGCACGG - Intronic
936024477 2:109020978-109021000 CCCAGCTTCAGGAGGGTGCCTGG + Intergenic
936251662 2:110872658-110872680 CCCAGCTCCAGGAGGCTGCAGGG + Intronic
937251354 2:120525908-120525930 CCCTGCTCTGGCAGGGTCCAGGG - Intergenic
938108587 2:128549768-128549790 CCCAGGGTGGGGTGGGTGCAAGG - Intergenic
941916711 2:170818076-170818098 GCCAGCGGGGGGAGGGCGCACGG - Intronic
942303727 2:174586496-174586518 CCCAGGTGGGTGAGGGGGCAGGG + Intronic
942566073 2:177265251-177265273 CCCAGCCCGGGAAGGGAGCAAGG - Intronic
946334656 2:219028888-219028910 ACCAGCTCAGGGAGGGATCATGG + Intronic
946366906 2:219254058-219254080 CGCAGCTTGGGGAGGGTACCAGG - Intronic
946389876 2:219408899-219408921 TCCAGCTGGGGGAAGGTGGATGG + Intergenic
947840918 2:233207516-233207538 CCCACCTCGAGGAGGGCACAGGG - Exonic
948874925 2:240821063-240821085 CCCAGCCCTGGGACGGTGGAGGG - Intergenic
948927804 2:241110650-241110672 TGAAGCTTGGGGAGGGTGCAGGG - Intronic
1168981094 20:2004326-2004348 ACCTGCTGGGGGAGGGTGCATGG + Intergenic
1169430438 20:5531521-5531543 CTCAGCACAGGGAGGGTGCCAGG + Intergenic
1169937050 20:10894905-10894927 CCCAACGAGGGGAGGGAGCATGG + Intergenic
1170768186 20:19309847-19309869 CCCAGCTCTCCCAGGGTGCAAGG - Intronic
1171458488 20:25285216-25285238 CCCGGCTCCGAGATGGTGCACGG + Intronic
1171769788 20:29313682-29313704 GCCAGCCAGGGGAGGGTGGAGGG + Intergenic
1172100541 20:32482421-32482443 CGCAGCTCCGGGTGGGAGCAGGG + Intronic
1172587025 20:36092409-36092431 CCCAGCGCCGGGAGGGTTCGCGG + Intronic
1173001601 20:39109615-39109637 CCCAGCTTGGGGAGCCTCCAGGG + Intergenic
1173001624 20:39109664-39109686 CCCAGCTGGGGGAGGCTCCAGGG + Intergenic
1173001680 20:39109810-39109832 CCCAGCTGGGGGAGCCTCCAGGG + Intergenic
1173453087 20:43182464-43182486 CCCAGGTGGTGGAGGTTGCAGGG - Intronic
1174449099 20:50608988-50609010 CCCAGGTCAGGGAGAGTGGAAGG - Intronic
1174587917 20:51623138-51623160 CCCAGCTAGGGGAGAGGGCCCGG - Intronic
1175267235 20:57710101-57710123 CCCGGCTCGGGGAGGGGGTGCGG - Intronic
1175532720 20:59685140-59685162 CCCAGCAGGAGGTGGGTGCAGGG - Intronic
1175909880 20:62400137-62400159 CCCAGCTGGAGGTGGGGGCAGGG + Intronic
1176431606 21:6579570-6579592 CCCAGCACGGGGAGAATTCATGG - Intergenic
1178666300 21:34549941-34549963 CACATCTCGGGGAAGGAGCAAGG - Intronic
1179251674 21:39675794-39675816 CCCAGCCAGGAGAGGGTGTAAGG + Intergenic
1179660761 21:42873350-42873372 GGCAGTTCTGGGAGGGTGCAGGG - Intronic
1179707000 21:43187032-43187054 CCCAGCACGGGGAGAATTCATGG - Intergenic
1180190480 21:46160493-46160515 CCCCGCTCCGGGATGGTGCAAGG + Intergenic
1181609912 22:24005434-24005456 CCCAGATCGGAGAGGGCACAGGG - Intergenic
1182442131 22:30370789-30370811 CCCAGCTGGAGGAGGCTGAAGGG + Exonic
1183414861 22:37676246-37676268 CCCAGCTTGGGGGTGGTGGAAGG - Intronic
1183675691 22:39297686-39297708 CCCAGGAAGGGGAGGGGGCAGGG - Intergenic
1183976835 22:41517292-41517314 CCCAGCTCAGGGTGGCTGCTGGG - Intronic
1184088796 22:42281852-42281874 CCCAGCTCTGGGCAGGTGCCAGG + Intronic
1184091342 22:42294534-42294556 CCCAGCTCCGGGAGAGGGCAGGG + Intronic
1184290924 22:43497789-43497811 CCCACCTGGGGGAGGGAGGATGG + Intronic
1184377395 22:44123319-44123341 CGCTGATCGGGGAGGGTCCAGGG + Intronic
1184835580 22:47019122-47019144 TCCAGCACAGGGAGGGAGCACGG + Intronic
1185012074 22:48319832-48319854 CACAGCCCGGGGAGGCTCCAAGG - Intergenic
1185190502 22:49433253-49433275 CCCAGCAGGGAGAGGGTGGATGG - Intronic
1185190518 22:49433334-49433356 CCCAGCAGGGAGAGGGTGGATGG - Intronic
1185190549 22:49433456-49433478 CCCAGCAGGGAGAGGGTGGATGG - Intronic
1185213819 22:49587282-49587304 CCCACCTCGGGAAGGGTGGCCGG - Intronic
950126266 3:10511597-10511619 CCCAGCTTGGGAAGGGTAAAAGG + Intronic
950291982 3:11792055-11792077 CACAGCTAGAGGAGGATGCATGG + Intronic
953381803 3:42477805-42477827 TCCAGCTCTGGGAGGCTGCATGG - Intergenic
954304906 3:49720489-49720511 CCTAGGTAGGGGAGGGTGCAAGG - Exonic
954415682 3:50392203-50392225 CCATGCCAGGGGAGGGTGCAGGG - Intronic
954709434 3:52498030-52498052 GTCAGATCAGGGAGGGTGCAGGG - Intronic
960580710 3:119276249-119276271 GCCAGCTCAGGGAGGCTACAGGG + Intergenic
961670259 3:128523611-128523633 CCCAGCTGGGGGTGCATGCAGGG + Intergenic
964353115 3:155822506-155822528 CCCAGCAGGCAGAGGGTGCAGGG + Exonic
964721202 3:159768720-159768742 CCCAGCTCTGAGATGGAGCAAGG - Intronic
966743363 3:183253987-183254009 CCCAGCTCGGGGCCGCGGCACGG - Intronic
967209136 3:187150978-187151000 CCCAGCTCTGGGCTGATGCAGGG - Intronic
968384590 4:124883-124905 CACAGCCCGGGGAAAGTGCAGGG - Exonic
968393599 4:213030-213052 CACAGCCCGGGGAAGGTGCGGGG - Intergenic
968419708 4:473738-473760 CACAGCCCGGGGAAGGTGCAGGG + Intronic
968648597 4:1751621-1751643 CCCAGCGCGGTGTGTGTGCAAGG - Intergenic
968913268 4:3486288-3486310 CCCAGGTCGGGGCGGGTGCTGGG + Intronic
970228323 4:13882495-13882517 ACCAGCTCAGAGAGGCTGCAGGG + Intergenic
970248109 4:14084856-14084878 CCCAGAAAGGGGAGGGGGCATGG + Intergenic
970596660 4:17606412-17606434 CCCAGGACGGGGAGGTTGCAGGG - Intronic
972279450 4:37588135-37588157 CCCAGCTTGGGGAGGGGTCAGGG + Intronic
975857186 4:78636992-78637014 CCCAGCAGGTGGAGGCTGCAGGG + Intergenic
976270331 4:83224008-83224030 GCCAGCTAGGGGAGGATGCCTGG + Intergenic
977412516 4:96686072-96686094 CCCAGGTGGTGGAGGTTGCAGGG + Intergenic
980214989 4:129841010-129841032 CCCAGCTCAGGATGGGTGCTAGG - Intergenic
981751410 4:148095696-148095718 ACCAGCCCTGGGAGGCTGCATGG - Intronic
981824908 4:148928950-148928972 CCCAGCTCTGGGCTGGTGCTGGG - Intergenic
985618955 5:943296-943318 CCTGGCTCTGGGAAGGTGCAGGG - Intergenic
985830742 5:2227612-2227634 CCTAGCTCTGGGTGGCTGCAGGG - Intergenic
986608548 5:9545926-9545948 CCCTGCACGGGGAAGGTGGAGGG + Exonic
988977545 5:36529882-36529904 TCCAGCTGGGGGAGGCTGCAGGG - Intergenic
989554502 5:42777384-42777406 CCCAGGAGGGGGAGGTTGCAGGG + Intronic
995357665 5:111257997-111258019 CCTAGCACGGGGAGGGTGTCGGG + Intronic
997367666 5:133336217-133336239 TCCAGCTCGGGGAGGAGGCAAGG + Intronic
999734020 5:154499157-154499179 CACAGCTGGGGCAGGGTGCTGGG - Intergenic
1001154811 5:169263701-169263723 AGCAGCTGGGGGAGGCTGCAGGG - Intronic
1001234491 5:170018227-170018249 CCCATCTGGGGGAGGCTGCGTGG + Intronic
1001333970 5:170782848-170782870 CCCAGCTCCCTCAGGGTGCAAGG + Exonic
1001742485 5:174065359-174065381 CCGGGCTCTAGGAGGGTGCAGGG + Intronic
1002123437 5:177023083-177023105 CCCAGCGCGCTGAGGGTGAAGGG + Intronic
1004123772 6:12852236-12852258 CCCAGCTCTGGGACGTTGCTTGG - Intronic
1004202140 6:13558761-13558783 CCCACCTCTGGGAGGGTTCTGGG - Intergenic
1004739833 6:18448064-18448086 GCCAGCTTGGAGAGGGTTCAGGG + Intronic
1006395065 6:33781872-33781894 CCGAGAGCAGGGAGGGTGCAGGG + Intronic
1006605592 6:35254615-35254637 CCCAGGAAGGGGAGGTTGCAGGG + Intergenic
1008027402 6:46653344-46653366 CCGCGCTGGGGGAGGGTGCGCGG + Intronic
1011994836 6:93572704-93572726 CCCAGCTCGGGCTGAGTGCCAGG - Intergenic
1012972175 6:105743187-105743209 CCCAGTTCAGAGATGGTGCATGG - Intergenic
1013146577 6:107400207-107400229 CCAAGGTCTGGGAGTGTGCATGG - Intronic
1013317758 6:108958201-108958223 CCAAGATCAGGGAGGCTGCATGG - Intronic
1013443011 6:110190725-110190747 CCGAGCTAGGGGAGGGTCCTGGG + Intronic
1013828153 6:114240198-114240220 CCCAGGTCAGGAAGCGTGCAGGG - Intronic
1014574822 6:123057198-123057220 CCTAGCTCAGGGAGGATACAAGG + Intronic
1016923616 6:149318319-149318341 CCCGGGTGGGGGAGGGCGCAAGG + Intronic
1019164366 6:170088339-170088361 CCCAGCTCCCAGATGGTGCACGG + Intergenic
1019283991 7:215222-215244 TCCAGCTGGGGGGGGGAGCAGGG + Intronic
1019357164 7:586569-586591 CCCAGCCCGAGGAGGGTTCCAGG + Intronic
1019436855 7:1026786-1026808 CCCTCCACGGGGAGCGTGCAAGG - Intronic
1020660286 7:10973782-10973804 TCCTGCTCGGGAAGGGTGCGCGG + Intergenic
1021889648 7:25175095-25175117 CCCAGGTCTGAGGGGGTGCAAGG - Intronic
1025628446 7:63244825-63244847 CCCAGGTGGCGGAGGTTGCAAGG - Intergenic
1032096207 7:128939501-128939523 CCCAGCTCAGGGAGAGGACAAGG - Intronic
1032179675 7:129664047-129664069 CCCAGGGCAGGGAGGTTGCAGGG + Intronic
1034279056 7:149838839-149838861 GGCAGCTCGGGGAGGATGCGCGG - Intronic
1039573603 8:38605935-38605957 CTCAGCTCAGGGAGGGGCCAAGG - Intergenic
1039598078 8:38809005-38809027 GCCAGCTCGGGGCAGGTGCCAGG - Intronic
1039915705 8:41858933-41858955 CTCAGCTCAGGAAGGCTGCAAGG + Intronic
1042144633 8:65715451-65715473 CCCAGGTGGCGGAGGTTGCAAGG - Intronic
1045215670 8:100145967-100145989 CCCGCCTCGGGACGGGTGCAGGG - Intergenic
1049016527 8:139924017-139924039 CCGAGCACGGGGAGGGGGCATGG + Intronic
1049254046 8:141604616-141604638 CCCTGCTTGGGGAGGGCTCATGG + Intergenic
1049343373 8:142125740-142125762 CCCAGCTGGAGGAGGGTAGATGG - Intergenic
1049661428 8:143821280-143821302 CACAGCTGGGGCAGGGAGCACGG + Intronic
1049975449 9:857229-857251 CCCAGGACGTGGAGGTTGCAGGG + Intronic
1053416728 9:37951629-37951651 CTGAGCTCAGGGAGGGTGGATGG - Intronic
1056788966 9:89613141-89613163 CCCAGCTCTGGTAGGGCCCAGGG - Intergenic
1058740742 9:107939804-107939826 CTCAGCTGGGGGAGAGTGCACGG - Intergenic
1059641144 9:116218259-116218281 TCCAGCTTAGGGAAGGTGCAGGG - Intronic
1059986308 9:119823772-119823794 CTCTGCTAGGGCAGGGTGCAAGG + Intergenic
1060006876 9:120008166-120008188 CCCAGCTCCGGGTGGGAGCTGGG - Intergenic
1060250636 9:121984128-121984150 CAGAGCTCAGGGAGGGTACAGGG + Intronic
1060281550 9:122218966-122218988 CCCAACTCTGGGAAGGTGGAAGG - Intronic
1060544893 9:124453868-124453890 GCCAGCTCGGGGTGGGGGTAAGG - Intronic
1060722316 9:125987295-125987317 CCCAGCCTGGGCAGGGGGCAGGG - Intergenic
1061089571 9:128419412-128419434 CCCAGCGGTGGGAGGGTGAAGGG + Intronic
1061206010 9:129163830-129163852 CCCAGATCGGGGTAGGTGAAAGG + Intergenic
1061215331 9:129218460-129218482 CCCAGCACGGGGACGGCACAGGG - Intergenic
1061859023 9:133458680-133458702 GAAACCTCGGGGAGGGTGCAGGG - Intronic
1061998952 9:134206482-134206504 CCCAGCTGGGGGAGCGTCCCAGG - Intergenic
1062081553 9:134626692-134626714 CACATCACTGGGAGGGTGCAGGG + Intergenic
1062363537 9:136198476-136198498 CCCAGGGCGGGGAGGGTGCTGGG + Intronic
1062686533 9:137816542-137816564 CCCAGCTGGGGAAGGGCGCTGGG - Intronic
1185784121 X:2875403-2875425 CCCAGTTCAGAGAGGGTGGAGGG + Intronic
1186012350 X:5148622-5148644 CCCAGGACAGGGAGGTTGCAGGG + Intergenic
1186670630 X:11764231-11764253 CACAGGCCGGGGAGGGTGGAAGG + Intronic
1197625715 X:128800184-128800206 CCCAGCTAGGACATGGTGCAGGG + Intergenic
1200256970 X:154587766-154587788 CCCAGGAGGTGGAGGGTGCAGGG + Intergenic
1200260799 X:154616636-154616658 CCCAGGAGGTGGAGGGTGCAGGG - Intergenic