ID: 1089494676

View in Genome Browser
Species Human (GRCh38)
Location 11:118902165-118902187
Sequence CTCCTCCTGCAGCTTGCGCC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 201}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089494675_1089494676 -5 Left 1089494675 11:118902147-118902169 CCGTTTCTCTTCGTAGTACTCCT 0: 1
1: 0
2: 2
3: 10
4: 186
Right 1089494676 11:118902165-118902187 CTCCTCCTGCAGCTTGCGCCAGG 0: 1
1: 0
2: 1
3: 15
4: 201
1089494669_1089494676 25 Left 1089494669 11:118902117-118902139 CCCATGCAGCCCAATCTGTTCCT 0: 1
1: 0
2: 0
3: 18
4: 209
Right 1089494676 11:118902165-118902187 CTCCTCCTGCAGCTTGCGCCAGG 0: 1
1: 0
2: 1
3: 15
4: 201
1089494671_1089494676 16 Left 1089494671 11:118902126-118902148 CCCAATCTGTTCCTCTTTCCGCC 0: 1
1: 0
2: 1
3: 18
4: 230
Right 1089494676 11:118902165-118902187 CTCCTCCTGCAGCTTGCGCCAGG 0: 1
1: 0
2: 1
3: 15
4: 201
1089494674_1089494676 -2 Left 1089494674 11:118902144-118902166 CCGCCGTTTCTCTTCGTAGTACT 0: 1
1: 0
2: 0
3: 3
4: 61
Right 1089494676 11:118902165-118902187 CTCCTCCTGCAGCTTGCGCCAGG 0: 1
1: 0
2: 1
3: 15
4: 201
1089494673_1089494676 5 Left 1089494673 11:118902137-118902159 CCTCTTTCCGCCGTTTCTCTTCG 0: 1
1: 0
2: 0
3: 5
4: 148
Right 1089494676 11:118902165-118902187 CTCCTCCTGCAGCTTGCGCCAGG 0: 1
1: 0
2: 1
3: 15
4: 201
1089494670_1089494676 24 Left 1089494670 11:118902118-118902140 CCATGCAGCCCAATCTGTTCCTC 0: 1
1: 0
2: 3
3: 21
4: 231
Right 1089494676 11:118902165-118902187 CTCCTCCTGCAGCTTGCGCCAGG 0: 1
1: 0
2: 1
3: 15
4: 201
1089494672_1089494676 15 Left 1089494672 11:118902127-118902149 CCAATCTGTTCCTCTTTCCGCCG 0: 1
1: 0
2: 0
3: 6
4: 132
Right 1089494676 11:118902165-118902187 CTCCTCCTGCAGCTTGCGCCAGG 0: 1
1: 0
2: 1
3: 15
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089494676 Original CRISPR CTCCTCCTGCAGCTTGCGCC AGG Exonic
900290303 1:1920921-1920943 CTCCTCCTGCGGCCGGGGCCTGG + Intergenic
900402324 1:2477647-2477669 CTCCTGCTGTAGCTTGTCCCAGG - Intronic
902044267 1:13513520-13513542 CTTCTGCTGCTGCTCGCGCCCGG - Exonic
902658931 1:17887925-17887947 TCCCCCCTGCAGCTGGCGCCTGG + Intergenic
903062891 1:20682665-20682687 CTTCTCCAGCAGCTTGCTCTTGG + Exonic
903323558 1:22556511-22556533 CTCCTCCTTCAGCTTGGCTCAGG - Intergenic
903575058 1:24334561-24334583 CCCCTCCTGCAGCTTTGGCCAGG - Intronic
903779852 1:25814226-25814248 CGCCTCCTGCTGGTTGCTCCCGG - Intronic
904422612 1:30403931-30403953 CTCCTGCTGGAGCTGGCCCCAGG - Intergenic
905441863 1:38000955-38000977 CTTCTCCTTCAGCTTGAGCCAGG - Intronic
907497423 1:54854115-54854137 CTGCTCGTACAGCTTGCGCAGGG + Exonic
907807440 1:57835759-57835781 CTCCTCCTGAAGCCTGCAGCAGG + Intronic
908059487 1:60331889-60331911 CTCCTGCTGCTGCTTGCTGCTGG - Intergenic
915315919 1:155029246-155029268 CTCCCCCTGCAGCTGGTGCCGGG + Exonic
915936216 1:160091710-160091732 CTCCTCCTCCAGGTGGGGCCTGG + Intronic
916053092 1:161049492-161049514 CTGCTCCTGCTGCTTCTGCCTGG + Exonic
917809783 1:178647028-178647050 CTCCTACTGCTGCTTCTGCCTGG - Intergenic
918279234 1:182987035-182987057 CTCCTCCTCCTTCTTGGGCCTGG + Intergenic
919731793 1:200917339-200917361 TGCCTCCTGCAGCTTCCCCCTGG + Intergenic
919982007 1:202647571-202647593 CTCCTCATTCAGCTAGGGCCTGG - Intronic
920522043 1:206635297-206635319 CTCCGTCTACAGCTCGCGCCAGG + Intergenic
922183750 1:223256499-223256521 CTCCTCCTGCAGATGACTCCAGG + Intronic
1067066552 10:43107115-43107137 CACCTCCTGCAGATTTCTCCTGG + Intronic
1072574111 10:96684535-96684557 CTCCCCCTGCAGCATGGTCCAGG - Intronic
1073461579 10:103668664-103668686 CTCCTGCTGCCGCTTGCTCTCGG - Intronic
1073956495 10:108877425-108877447 CTCTTCCTGCCCCTTGTGCCTGG - Intergenic
1075091300 10:119445478-119445500 CTCCTGCTGCAGCCTGGACCAGG + Intronic
1075583916 10:123643610-123643632 CTCCACCAGCCGCTTTCGCCAGG - Intergenic
1079993089 11:27266977-27266999 CTCCTCCTCCAGCTTCTCCCTGG + Intergenic
1081747908 11:45485905-45485927 CACCTCCAGCAGCCTGGGCCTGG + Intergenic
1083950639 11:65953713-65953735 CAGCTCCTCCAGCTTGCGCTGGG - Exonic
1084547054 11:69819718-69819740 CTGCTCCTGCAGGAAGCGCCGGG - Intergenic
1084650763 11:70487967-70487989 CCCCTGCTGCAGCCTGTGCCTGG - Intronic
1084923743 11:72495017-72495039 CTCCTCCTTTAGCTTTCTCCAGG + Intergenic
1089494676 11:118902165-118902187 CTCCTCCTGCAGCTTGCGCCAGG + Exonic
1090804843 11:130196475-130196497 CTCCCCCTGCAGCATGGGCCCGG - Intronic
1091873123 12:3911751-3911773 CTCCTCCTTCACCTTCTGCCAGG + Intergenic
1092887824 12:12940780-12940802 CTCCTCCTGCATCTTGCTGGGGG + Exonic
1096924681 12:55130557-55130579 CTCCACCTGCAGCTCTCACCTGG + Exonic
1098496196 12:71138184-71138206 CTGCTCCTGCAGGTGGCGACAGG - Exonic
1100823935 12:98457199-98457221 CTCCTCCTCCTACTCGCGCCGGG + Intergenic
1100934599 12:99648586-99648608 CTCCACCTGAAGCTTGCCACGGG + Exonic
1101549394 12:105747953-105747975 GTCCTCATGCAGCCTGTGCCAGG - Intergenic
1101553482 12:105785200-105785222 CTCCTCCAGTAGCTTGCTGCCGG + Intergenic
1101695612 12:107122825-107122847 CACCTCCAGCAGCTTGCAGCCGG - Intergenic
1103713486 12:122929752-122929774 CGCTTCCTGCATCTTGCCCCTGG - Exonic
1104134695 12:125926109-125926131 CTCCTCCTGCTGCTCCCTCCTGG + Intergenic
1105217126 13:18294490-18294512 CTTCTCCTGCAGCGTCCGCATGG - Intergenic
1106225577 13:27783912-27783934 CTCCTTCTACATCTTGCTCCAGG - Intergenic
1106759831 13:32857761-32857783 ATCCTGCTGCAGCTTGCTCTTGG + Intergenic
1112343441 13:98571220-98571242 CTCACCCTGCATCTTGCACCAGG + Intronic
1112798064 13:103078906-103078928 CTCCTCCAGAAACTTGAGCCTGG - Intergenic
1113812092 13:113149174-113149196 CACCTCCAGCATCTTGAGCCTGG - Exonic
1114566826 14:23639265-23639287 CTCCCCCTGCAGCTTGGCCATGG - Exonic
1117222603 14:53620759-53620781 CTCCCCCAGCAGCTTGCCCATGG - Intergenic
1122390045 14:101373880-101373902 CTCCTGCTGCCGCCTCCGCCAGG - Intergenic
1122862564 14:104589111-104589133 CTCCTGCTGCTGCTAGGGCCTGG + Exonic
1122952899 14:105055666-105055688 CTCCTGTTGCAGCGTGTGCCAGG + Exonic
1124623834 15:31297024-31297046 TTGCTCCTCCAGCTTGAGCCTGG - Intergenic
1124696571 15:31869341-31869363 CTCCTCCTCCAGGGTGTGCCCGG - Intronic
1127433413 15:58933710-58933732 CTGCTGCTGCAGGTTGCGCTAGG - Intronic
1127917427 15:63466764-63466786 CTTCTCTTGCAGCTTCCCCCGGG + Intergenic
1129458851 15:75689910-75689932 CTCCTCCTCCAGCCTGCAGCCGG + Exonic
1129724957 15:77896982-77897004 CTCCTCCTCCAGCCTGCAGCCGG - Intergenic
1129828282 15:78650114-78650136 CTCAGCCTGCAGCTGGGGCCTGG - Intronic
1130112571 15:80977784-80977806 TTCCTCCTGCATCTTGAACCTGG - Exonic
1132051497 15:98611247-98611269 CTCTTGCTGGAGCTTGTGCCTGG - Intergenic
1132504029 16:297853-297875 CTCCACCTGCTCCTTGGGCCGGG + Exonic
1132782795 16:1637377-1637399 CTCCTCCTCCCGCCTGGGCCCGG + Intronic
1133191379 16:4136013-4136035 CTTCTCTTGCACCTTGTGCCCGG - Intergenic
1133420145 16:5638964-5638986 CTCCTCCTGCAGGTTGTCACAGG + Intergenic
1135541081 16:23330889-23330911 CATCTCCTGCAGCTAGCTCCAGG - Intronic
1136028135 16:27483115-27483137 CTCTTCCTGCAGAGTGTGCCTGG - Exonic
1137028584 16:35501573-35501595 CTGCTCCTGCAGCCTGCACAGGG - Intergenic
1138458314 16:57133624-57133646 CTCCTCCTGCAGCTGAGGACCGG + Intronic
1142052345 16:87966988-87967010 CTCCTCCTCCCGCTGGTGCCAGG - Intronic
1142204254 16:88775216-88775238 CTCCTGCTCCAGCCTGTGCCAGG - Intronic
1142759807 17:2035712-2035734 TCCCTCCTGCAGCCTGAGCCTGG + Intronic
1142990134 17:3724595-3724617 CTCCTCCTGTCGCTTCCTCCTGG - Exonic
1143599759 17:7936798-7936820 CACCTCCTGCTGCTTGCTTCTGG - Exonic
1144536857 17:16098089-16098111 TTCCTCCTGCCGCTTGCCACTGG - Intronic
1144556530 17:16287203-16287225 CTCCTCCTGCTGTCTGCCCCAGG + Intronic
1144928078 17:18830766-18830788 CGACTCCTGTAGCTTGTGCCTGG - Intergenic
1144960882 17:19043248-19043270 CTGCCCCTGCAGCCTGGGCCAGG + Intronic
1144974278 17:19131276-19131298 CTGCCCCTGCAGCCTGGGCCAGG - Intronic
1146704704 17:34992565-34992587 CACATCCTGCAGGTTGCGCGAGG - Exonic
1147110290 17:38256857-38256879 CTCGCCCCGCAGCTTGCCCCGGG + Intergenic
1148419220 17:47531574-47531596 CTCGCCCCGCAGCTTGCCCCGGG - Intronic
1148529582 17:48376955-48376977 CTCCCTCTGCATCTTGGGCCTGG - Intronic
1148795425 17:50194616-50194638 CTCCTCCTGCAGGGTGGACCTGG - Exonic
1148856385 17:50581306-50581328 CTCCTCATGCAGCCAGCTCCAGG - Intronic
1149914884 17:60600017-60600039 CTCCTCCCGCCGCTGGCGCTGGG - Intergenic
1151242827 17:72771508-72771530 CTCCTCCTGCAAGGTGAGCCTGG - Intronic
1151252704 17:72849678-72849700 CTCCTCCAGCTGCTGCCGCCGGG + Exonic
1152132975 17:78488396-78488418 CTCCTCCTCCTGCTTCCTCCAGG + Intronic
1152551463 17:81032487-81032509 CTCCACCTGGAGCTGGCGTCAGG + Intergenic
1152721830 17:81927305-81927327 CTCCTCCTGCCCCTGGCGCCCGG - Intronic
1154267348 18:12890772-12890794 CTCCCCCAGCACCTTGCTCCTGG + Intronic
1154328481 18:13409678-13409700 CTTCTCCTCCAGCTTGCGAATGG - Intronic
1157486637 18:48092156-48092178 CTCCTCCTGTAATTTCCGCCAGG - Intronic
1157717060 18:49895034-49895056 CTCCTCCTGCAGCCTGAGGCTGG + Exonic
1159671825 18:71229753-71229775 CTCCTCCTTCAGATTAGGCCAGG + Intergenic
1160630908 18:80246449-80246471 CCCCTCCCGCTGCCTGCGCCCGG - Intronic
1160740063 19:681484-681506 CTCCTCGTGCCACATGCGCCAGG + Exonic
1161364217 19:3868873-3868895 CTTCTCCCGCCGCGTGCGCCCGG - Intronic
1163690828 19:18737287-18737309 CTCCTGATACAGCCTGCGCCGGG - Intronic
1164599266 19:29549827-29549849 CTCCTCCTTCAGCTGGGGCATGG + Intronic
1164608826 19:29618579-29618601 CTCCTCCTCCCGCTGGGGCCAGG + Intergenic
1165479120 19:36051551-36051573 CTCTTCCTGCATCCTGCTCCTGG - Intronic
1167449244 19:49557205-49557227 CTCCTTCTGCTCCTCGCGCCGGG + Exonic
1167709190 19:51099486-51099508 GTCCACCTGCAGCCTGCACCTGG - Intronic
926050930 2:9744336-9744358 CTCCTACAGCAGCCTGCCCCAGG - Intergenic
927678776 2:25126119-25126141 ATTCTCCTGCGGCTTGCGCATGG + Intronic
928086183 2:28347838-28347860 CTCCTCCCGAAGCCTGCCCCAGG + Intergenic
931225181 2:60323278-60323300 ATCATCCTGCAGCTAGTGCCCGG + Intergenic
932285178 2:70525604-70525626 CTCCTCCTGCCCCTTGCTTCTGG - Intronic
932347244 2:71003763-71003785 CTCCTGGTGCAGCTTCCCCCAGG + Intergenic
932475483 2:72003302-72003324 CTCCTCCTGGAGCTGGTGGCTGG - Intergenic
934297198 2:91752192-91752214 CTTCTCCTGCAGCGTCCGCATGG + Intergenic
934557472 2:95294968-95294990 CTCCCACTGCAGCTAGCACCTGG - Intergenic
938178957 2:129162634-129162656 CTCCTCCTGCATCCTGGGGCTGG - Intergenic
940905106 2:159162035-159162057 CTCCTCCTGCTGCTGCAGCCTGG - Intronic
947041167 2:225922327-225922349 GTCCTCCTGCATCTAGCTCCTGG + Intergenic
1169119349 20:3085657-3085679 CTCCTCCTGCACCTTCCCCCAGG - Intergenic
1169274189 20:4221900-4221922 CTCCACCAGCGGCCTGCGCCAGG - Exonic
1169345127 20:4823236-4823258 CGCGCCCTGCACCTTGCGCCGGG + Intronic
1171272162 20:23825759-23825781 CTCCTCCTGCAGCTGTCAACTGG - Intronic
1171283659 20:23921165-23921187 CTCCTCCTGCAGCTGTCAGCTGG - Intergenic
1173498735 20:43537123-43537145 CTCCTCCTGCTGCATGCTGCTGG + Intronic
1175493595 20:59396113-59396135 CTCCTCCTGCAGCTGCTGCTGGG - Intergenic
1178487416 21:33027738-33027760 CTGCCCCTGCAGCATGTGCCAGG + Exonic
1178518729 21:33269326-33269348 CTCCTGCTGCTGTTTGCGCCTGG - Intronic
1178888976 21:36505371-36505393 CTCCTCCAGCAGCTTGGGGTGGG - Intronic
1179614479 21:42572975-42572997 CTCCTCCTGCAGGTTCCGCAGGG - Intronic
1181471080 22:23140319-23140341 CTCCTCCTTCAGCTTGGGCAGGG + Exonic
1182308480 22:29388180-29388202 CACCTCCTGGGGCTTCCGCCCGG - Intronic
1183187458 22:36300208-36300230 CTCCAGCTGCAGCTTCTGCCGGG + Exonic
1183428022 22:37750089-37750111 CCCCTCCCGCAGCTTCCGACAGG - Intronic
1184117191 22:42429045-42429067 CTCCTCCTCCCACTTGAGCCGGG - Intronic
1184901322 22:47448283-47448305 CTCCTCCTGCACCTGGGGCTCGG + Intergenic
1185042721 22:48513686-48513708 CTCCTCCTGCAGACTGCCCAAGG - Intronic
951954557 3:28240596-28240618 CCCCTGCTGCTGCTTCCGCCTGG - Intergenic
953544936 3:43857516-43857538 CACCTCCTGCTGCCTGCTCCTGG + Intergenic
954848364 3:53579026-53579048 CTCCGCCTGCTGCTCGGGCCTGG - Intronic
956424730 3:69122123-69122145 TTCCTCTTCCAGCATGCGCCTGG + Exonic
959622220 3:108410830-108410852 CTCCAGCTGCAGCTGGTGCCTGG + Exonic
960696955 3:120405798-120405820 CTCCTCCTGCAGCTAGTGCCTGG - Intronic
966894034 3:184428785-184428807 CTCTTCCCCCAGCTTGTGCCTGG - Intronic
968742949 4:2340545-2340567 GCCCACCTGCAGCTTGGGCCTGG - Intronic
968971935 4:3800381-3800403 CTCCTCCTGCCCCCTGCACCTGG - Intergenic
969703308 4:8779437-8779459 CTTCTCCTGCACCTCGGGCCAGG + Intergenic
970602690 4:17652867-17652889 CTCCTCCTGCAGCTCTTGCCTGG + Exonic
975713856 4:77187135-77187157 CTCCTGCTGTAGCTGGCCCCAGG + Intronic
976765238 4:88592282-88592304 CACCTCGGGCAGCCTGCGCCTGG + Intronic
978077629 4:104552837-104552859 CTCCTCCTTGAGCTTGGGCTAGG - Intergenic
983157736 4:164371968-164371990 CTCCTCCTGCAGGCTGTGCCAGG + Intronic
985493457 5:192173-192195 CACCACCTCCAGCTTGCGCAGGG - Exonic
985646088 5:1085422-1085444 CGCCACCTGCAGCCTCCGCCTGG + Exonic
986867019 5:12001265-12001287 CTCCTCCTGCAGGCTGGGACAGG - Intergenic
1000889257 5:166784489-166784511 CTCCACCTGCAGCCTGGTCCCGG - Intergenic
1001206197 5:169765480-169765502 CTCCTCTTGGAGCTTTCTCCGGG - Intronic
1001288395 5:170439682-170439704 CTGCTCCTGCAGCTCGACCCAGG - Intronic
1001323788 5:170704662-170704684 CTCCTCCTCCTGCTTTCTCCAGG + Intronic
1002345563 5:178545740-178545762 CTGTGCCTGCAGCTTGTGCCAGG - Intronic
1002666692 5:180830761-180830783 CTCCTTCAGCAGCTTGCCACAGG + Intergenic
1003392317 6:5724593-5724615 CGCATCCTGCAGCCTGAGCCTGG + Intronic
1006154252 6:32005773-32005795 CACCTCCTGCCTCTTGCCCCGGG + Intergenic
1006614686 6:35318377-35318399 CTCCTCCTGCAGCAGCCGCTCGG - Exonic
1007166209 6:39830708-39830730 CCCCTCCTGCTGCCTGGGCCTGG - Intronic
1007172834 6:39876667-39876689 CTCCTCCACCAGCTGGGGCCAGG + Intronic
1007947293 6:45837948-45837970 CTCCTCCTGCAGGGAGCTCCTGG - Intergenic
1013184587 6:107746660-107746682 CTCCTCATGCAACCTGCCCCAGG + Intronic
1013198241 6:107864941-107864963 CTCTTCCTGCAGCCAGCTCCTGG - Intergenic
1013233315 6:108175743-108175765 CTCCTCCTGGAGCTGCCACCCGG - Intronic
1013594321 6:111647033-111647055 CTCCTCCTGGGCCTTGTGCCTGG - Intergenic
1017811993 6:157990181-157990203 CACCTCCTGCGGCCTGGGCCTGG - Intronic
1018521468 6:164655609-164655631 CTCCTCCAGGAGCTTGCTACAGG - Intergenic
1019343594 7:519546-519568 CTCCTCTTGCAGCCGCCGCCCGG + Intronic
1019634688 7:2069296-2069318 CTCCTCCTGCAGCTGCTGCCTGG + Exonic
1019665434 7:2249850-2249872 CTCCTCCTGCAGCTCCCTGCGGG - Exonic
1019723845 7:2589732-2589754 CTCTTCCAGTAGCTTGTGCCCGG + Intronic
1022877864 7:34553271-34553293 CTCCTCCTGCTGCTGGCACATGG + Intergenic
1024540800 7:50473757-50473779 CTCCTCTTGCCGCTTGTGGCAGG - Intronic
1024666467 7:51551746-51551768 TGCCTTCTGCAGCTTGTGCCAGG + Intergenic
1024934447 7:54698514-54698536 CACCTTCTGCAGCGTGCCCCGGG + Intergenic
1025724800 7:64046567-64046589 CTCCTGCTTCACCTTGCACCAGG + Intronic
1026482409 7:70790243-70790265 CTCCTCGTCCAGCGTGCACCCGG + Exonic
1027219946 7:76207501-76207523 CTCCTCCAGCAGCATGTTCCTGG - Intronic
1029481930 7:100818585-100818607 CTCACCCAGCAGCTTGAGCCTGG - Exonic
1032240409 7:130154851-130154873 CTCCTGCTCCAGCCTCCGCCAGG + Intergenic
1033672987 7:143511163-143511185 CTCCACCTGCGCCTTGCACCTGG - Intergenic
1035041211 7:155928875-155928897 CTCTTCCTCCAGCTCTCGCCTGG + Intergenic
1035713531 8:1737012-1737034 CTCCCCCTTCACCTTCCGCCAGG - Intergenic
1040537145 8:48320322-48320344 GTACTCCAGCAGCTTGCGCCAGG - Intergenic
1042110408 8:65375742-65375764 CTCTTCCTCCAGCCTCCGCCAGG + Intergenic
1044695741 8:94920718-94920740 CTCCACCCCCAGCTTGCTCCTGG + Intronic
1049416448 8:142497689-142497711 CCCCTGCAGCAGCTTGGGCCTGG + Intronic
1050191795 9:3034163-3034185 CTCTTCCTGCTGCTTGCTGCCGG - Intergenic
1050303407 9:4282545-4282567 CTCTTCCTGGATCTTGAGCCTGG + Intronic
1051741296 9:20254853-20254875 CTCCTCCTTCACATTCCGCCAGG - Intergenic
1057251571 9:93507592-93507614 CACCTCCTGCATCTGGCCCCAGG - Intronic
1057435959 9:95040692-95040714 CACCTCCAGGAGCTTGGGCCAGG - Intronic
1057592806 9:96388309-96388331 CTGCTCCTGCAGCCGGCGCTGGG + Exonic
1058713974 9:107706875-107706897 CCATTCCTGCAGCTTGAGCCAGG - Intergenic
1059440908 9:114306332-114306354 CTCCTCCTGCACTTTGTCCCTGG + Intronic
1060601711 9:124882449-124882471 CTCCCCCTGCTGCCTGTGCCCGG - Intronic
1062015232 9:134287945-134287967 CTCCTCCTGCAGCCGGGCCCAGG + Intergenic
1062088011 9:134658532-134658554 CCCTTCCTGCAGCTAGGGCCTGG + Intronic
1062096095 9:134704494-134704516 CTCACTCTGCAGCTGGCGCCTGG + Intronic
1062197268 9:135281302-135281324 CTCCTCCTGCAGGCTGAGGCTGG - Intergenic
1062396263 9:136354021-136354043 CTCCTCCTGCAGCCTGGCTCAGG - Intronic
1186144970 X:6615687-6615709 CTCCTCCTGTCTCTTGCTCCTGG - Intergenic
1190008113 X:46759136-46759158 CTCCTCCTCCTACTCGCGCCGGG + Intronic
1190265240 X:48824106-48824128 ATCCCCCTGCAGTTTGCTCCCGG - Intronic
1193149004 X:78105312-78105334 ATCCTCCTGCACCTTGCTCCTGG - Intronic
1194946714 X:100077271-100077293 CTCTTCCTGGATCTTGAGCCTGG - Intergenic
1199601864 X:149545785-149545807 CTCCACCAGCAGCTCCCGCCAGG - Exonic
1199767161 X:150949627-150949649 CTCATCCTCCAGCCTGCTCCTGG + Intergenic