ID: 1089494676

View in Genome Browser
Species Human (GRCh38)
Location 11:118902165-118902187
Sequence CTCCTCCTGCAGCTTGCGCC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 201}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089494673_1089494676 5 Left 1089494673 11:118902137-118902159 CCTCTTTCCGCCGTTTCTCTTCG 0: 1
1: 0
2: 0
3: 5
4: 148
Right 1089494676 11:118902165-118902187 CTCCTCCTGCAGCTTGCGCCAGG 0: 1
1: 0
2: 1
3: 15
4: 201
1089494670_1089494676 24 Left 1089494670 11:118902118-118902140 CCATGCAGCCCAATCTGTTCCTC 0: 1
1: 0
2: 3
3: 21
4: 231
Right 1089494676 11:118902165-118902187 CTCCTCCTGCAGCTTGCGCCAGG 0: 1
1: 0
2: 1
3: 15
4: 201
1089494672_1089494676 15 Left 1089494672 11:118902127-118902149 CCAATCTGTTCCTCTTTCCGCCG 0: 1
1: 0
2: 0
3: 6
4: 132
Right 1089494676 11:118902165-118902187 CTCCTCCTGCAGCTTGCGCCAGG 0: 1
1: 0
2: 1
3: 15
4: 201
1089494675_1089494676 -5 Left 1089494675 11:118902147-118902169 CCGTTTCTCTTCGTAGTACTCCT 0: 1
1: 0
2: 2
3: 10
4: 186
Right 1089494676 11:118902165-118902187 CTCCTCCTGCAGCTTGCGCCAGG 0: 1
1: 0
2: 1
3: 15
4: 201
1089494671_1089494676 16 Left 1089494671 11:118902126-118902148 CCCAATCTGTTCCTCTTTCCGCC 0: 1
1: 0
2: 1
3: 18
4: 230
Right 1089494676 11:118902165-118902187 CTCCTCCTGCAGCTTGCGCCAGG 0: 1
1: 0
2: 1
3: 15
4: 201
1089494674_1089494676 -2 Left 1089494674 11:118902144-118902166 CCGCCGTTTCTCTTCGTAGTACT 0: 1
1: 0
2: 0
3: 3
4: 61
Right 1089494676 11:118902165-118902187 CTCCTCCTGCAGCTTGCGCCAGG 0: 1
1: 0
2: 1
3: 15
4: 201
1089494669_1089494676 25 Left 1089494669 11:118902117-118902139 CCCATGCAGCCCAATCTGTTCCT 0: 1
1: 0
2: 0
3: 18
4: 209
Right 1089494676 11:118902165-118902187 CTCCTCCTGCAGCTTGCGCCAGG 0: 1
1: 0
2: 1
3: 15
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089494676 Original CRISPR CTCCTCCTGCAGCTTGCGCC AGG Exonic