ID: 1089496357

View in Genome Browser
Species Human (GRCh38)
Location 11:118910356-118910378
Sequence GGTACCCCACCCTGGGTGAG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 702
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 675}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089496357_1089496380 25 Left 1089496357 11:118910356-118910378 CCCCTCACCCAGGGTGGGGTACC 0: 1
1: 0
2: 2
3: 24
4: 675
Right 1089496380 11:118910404-118910426 CCAGCCGTGGAGGGGGCCCGGGG 0: 1
1: 0
2: 1
3: 23
4: 279
1089496357_1089496382 29 Left 1089496357 11:118910356-118910378 CCCCTCACCCAGGGTGGGGTACC 0: 1
1: 0
2: 2
3: 24
4: 675
Right 1089496382 11:118910408-118910430 CCGTGGAGGGGGCCCGGGGTTGG 0: 1
1: 0
2: 1
3: 34
4: 387
1089496357_1089496376 18 Left 1089496357 11:118910356-118910378 CCCCTCACCCAGGGTGGGGTACC 0: 1
1: 0
2: 2
3: 24
4: 675
Right 1089496376 11:118910397-118910419 GAGCGCTCCAGCCGTGGAGGGGG 0: 1
1: 0
2: 0
3: 12
4: 238
1089496357_1089496374 16 Left 1089496357 11:118910356-118910378 CCCCTCACCCAGGGTGGGGTACC 0: 1
1: 0
2: 2
3: 24
4: 675
Right 1089496374 11:118910395-118910417 CAGAGCGCTCCAGCCGTGGAGGG 0: 1
1: 0
2: 0
3: 4
4: 110
1089496357_1089496383 30 Left 1089496357 11:118910356-118910378 CCCCTCACCCAGGGTGGGGTACC 0: 1
1: 0
2: 2
3: 24
4: 675
Right 1089496383 11:118910409-118910431 CGTGGAGGGGGCCCGGGGTTGGG 0: 1
1: 0
2: 1
3: 24
4: 288
1089496357_1089496373 15 Left 1089496357 11:118910356-118910378 CCCCTCACCCAGGGTGGGGTACC 0: 1
1: 0
2: 2
3: 24
4: 675
Right 1089496373 11:118910394-118910416 CCAGAGCGCTCCAGCCGTGGAGG 0: 1
1: 0
2: 0
3: 18
4: 361
1089496357_1089496369 12 Left 1089496357 11:118910356-118910378 CCCCTCACCCAGGGTGGGGTACC 0: 1
1: 0
2: 2
3: 24
4: 675
Right 1089496369 11:118910391-118910413 CCCCCAGAGCGCTCCAGCCGTGG 0: 1
1: 0
2: 1
3: 24
4: 607
1089496357_1089496375 17 Left 1089496357 11:118910356-118910378 CCCCTCACCCAGGGTGGGGTACC 0: 1
1: 0
2: 2
3: 24
4: 675
Right 1089496375 11:118910396-118910418 AGAGCGCTCCAGCCGTGGAGGGG 0: 1
1: 0
2: 1
3: 5
4: 81
1089496357_1089496378 24 Left 1089496357 11:118910356-118910378 CCCCTCACCCAGGGTGGGGTACC 0: 1
1: 0
2: 2
3: 24
4: 675
Right 1089496378 11:118910403-118910425 TCCAGCCGTGGAGGGGGCCCGGG 0: 1
1: 0
2: 2
3: 40
4: 319
1089496357_1089496377 23 Left 1089496357 11:118910356-118910378 CCCCTCACCCAGGGTGGGGTACC 0: 1
1: 0
2: 2
3: 24
4: 675
Right 1089496377 11:118910402-118910424 CTCCAGCCGTGGAGGGGGCCCGG 0: 1
1: 0
2: 2
3: 37
4: 285

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089496357 Original CRISPR GGTACCCCACCCTGGGTGAG GGG (reversed) Exonic