ID: 1089496367

View in Genome Browser
Species Human (GRCh38)
Location 11:118910388-118910410
Sequence CGGCTGGAGCGCTCTGGGGG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 200}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089496367_1089496384 -1 Left 1089496367 11:118910388-118910410 CCACCCCCAGAGCGCTCCAGCCG 0: 1
1: 0
2: 1
3: 15
4: 200
Right 1089496384 11:118910410-118910432 GTGGAGGGGGCCCGGGGTTGGGG 0: 1
1: 0
2: 1
3: 80
4: 708
1089496367_1089496380 -7 Left 1089496367 11:118910388-118910410 CCACCCCCAGAGCGCTCCAGCCG 0: 1
1: 0
2: 1
3: 15
4: 200
Right 1089496380 11:118910404-118910426 CCAGCCGTGGAGGGGGCCCGGGG 0: 1
1: 0
2: 1
3: 23
4: 279
1089496367_1089496390 28 Left 1089496367 11:118910388-118910410 CCACCCCCAGAGCGCTCCAGCCG 0: 1
1: 0
2: 1
3: 15
4: 200
Right 1089496390 11:118910439-118910461 CCCGCCCCGTCCCCAGCTCGAGG 0: 1
1: 0
2: 2
3: 59
4: 420
1089496367_1089496382 -3 Left 1089496367 11:118910388-118910410 CCACCCCCAGAGCGCTCCAGCCG 0: 1
1: 0
2: 1
3: 15
4: 200
Right 1089496382 11:118910408-118910430 CCGTGGAGGGGGCCCGGGGTTGG 0: 1
1: 0
2: 1
3: 34
4: 387
1089496367_1089496383 -2 Left 1089496367 11:118910388-118910410 CCACCCCCAGAGCGCTCCAGCCG 0: 1
1: 0
2: 1
3: 15
4: 200
Right 1089496383 11:118910409-118910431 CGTGGAGGGGGCCCGGGGTTGGG 0: 1
1: 0
2: 1
3: 24
4: 288
1089496367_1089496377 -9 Left 1089496367 11:118910388-118910410 CCACCCCCAGAGCGCTCCAGCCG 0: 1
1: 0
2: 1
3: 15
4: 200
Right 1089496377 11:118910402-118910424 CTCCAGCCGTGGAGGGGGCCCGG 0: 1
1: 0
2: 2
3: 37
4: 285
1089496367_1089496378 -8 Left 1089496367 11:118910388-118910410 CCACCCCCAGAGCGCTCCAGCCG 0: 1
1: 0
2: 1
3: 15
4: 200
Right 1089496378 11:118910403-118910425 TCCAGCCGTGGAGGGGGCCCGGG 0: 1
1: 0
2: 2
3: 40
4: 319

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089496367 Original CRISPR CGGCTGGAGCGCTCTGGGGG TGG (reversed) Exonic