ID: 1089496368

View in Genome Browser
Species Human (GRCh38)
Location 11:118910391-118910413
Sequence CCACGGCTGGAGCGCTCTGG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 312
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 294}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089496368_1089496390 25 Left 1089496368 11:118910391-118910413 CCCCCAGAGCGCTCCAGCCGTGG 0: 1
1: 0
2: 0
3: 17
4: 294
Right 1089496390 11:118910439-118910461 CCCGCCCCGTCCCCAGCTCGAGG 0: 1
1: 0
2: 2
3: 59
4: 420
1089496368_1089496380 -10 Left 1089496368 11:118910391-118910413 CCCCCAGAGCGCTCCAGCCGTGG 0: 1
1: 0
2: 0
3: 17
4: 294
Right 1089496380 11:118910404-118910426 CCAGCCGTGGAGGGGGCCCGGGG 0: 1
1: 0
2: 1
3: 23
4: 279
1089496368_1089496382 -6 Left 1089496368 11:118910391-118910413 CCCCCAGAGCGCTCCAGCCGTGG 0: 1
1: 0
2: 0
3: 17
4: 294
Right 1089496382 11:118910408-118910430 CCGTGGAGGGGGCCCGGGGTTGG 0: 1
1: 0
2: 1
3: 34
4: 387
1089496368_1089496383 -5 Left 1089496368 11:118910391-118910413 CCCCCAGAGCGCTCCAGCCGTGG 0: 1
1: 0
2: 0
3: 17
4: 294
Right 1089496383 11:118910409-118910431 CGTGGAGGGGGCCCGGGGTTGGG 0: 1
1: 0
2: 1
3: 24
4: 288
1089496368_1089496384 -4 Left 1089496368 11:118910391-118910413 CCCCCAGAGCGCTCCAGCCGTGG 0: 1
1: 0
2: 0
3: 17
4: 294
Right 1089496384 11:118910410-118910432 GTGGAGGGGGCCCGGGGTTGGGG 0: 1
1: 0
2: 1
3: 80
4: 708

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089496368 Original CRISPR CCACGGCTGGAGCGCTCTGG GGG (reversed) Exonic