ID: 1089496370

View in Genome Browser
Species Human (GRCh38)
Location 11:118910392-118910414
Sequence TCCACGGCTGGAGCGCTCTG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 117}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089496370_1089496382 -7 Left 1089496370 11:118910392-118910414 CCCCAGAGCGCTCCAGCCGTGGA 0: 1
1: 0
2: 0
3: 8
4: 117
Right 1089496382 11:118910408-118910430 CCGTGGAGGGGGCCCGGGGTTGG 0: 1
1: 0
2: 1
3: 34
4: 387
1089496370_1089496383 -6 Left 1089496370 11:118910392-118910414 CCCCAGAGCGCTCCAGCCGTGGA 0: 1
1: 0
2: 0
3: 8
4: 117
Right 1089496383 11:118910409-118910431 CGTGGAGGGGGCCCGGGGTTGGG 0: 1
1: 0
2: 1
3: 24
4: 288
1089496370_1089496384 -5 Left 1089496370 11:118910392-118910414 CCCCAGAGCGCTCCAGCCGTGGA 0: 1
1: 0
2: 0
3: 8
4: 117
Right 1089496384 11:118910410-118910432 GTGGAGGGGGCCCGGGGTTGGGG 0: 1
1: 0
2: 1
3: 80
4: 708
1089496370_1089496390 24 Left 1089496370 11:118910392-118910414 CCCCAGAGCGCTCCAGCCGTGGA 0: 1
1: 0
2: 0
3: 8
4: 117
Right 1089496390 11:118910439-118910461 CCCGCCCCGTCCCCAGCTCGAGG 0: 1
1: 0
2: 2
3: 59
4: 420

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089496370 Original CRISPR TCCACGGCTGGAGCGCTCTG GGG (reversed) Exonic