ID: 1089496376

View in Genome Browser
Species Human (GRCh38)
Location 11:118910397-118910419
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 238}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089496364_1089496376 -5 Left 1089496364 11:118910379-118910401 CCTCGTGCCCCACCCCCAGAGCG 0: 1
1: 0
2: 2
3: 39
4: 362
Right 1089496376 11:118910397-118910419 GAGCGCTCCAGCCGTGGAGGGGG 0: 1
1: 0
2: 0
3: 12
4: 238
1089496350_1089496376 28 Left 1089496350 11:118910346-118910368 CCCAGACGCGCCCCTCACCCAGG 0: 1
1: 0
2: 0
3: 12
4: 150
Right 1089496376 11:118910397-118910419 GAGCGCTCCAGCCGTGGAGGGGG 0: 1
1: 0
2: 0
3: 12
4: 238
1089496357_1089496376 18 Left 1089496357 11:118910356-118910378 CCCCTCACCCAGGGTGGGGTACC 0: 1
1: 0
2: 2
3: 24
4: 675
Right 1089496376 11:118910397-118910419 GAGCGCTCCAGCCGTGGAGGGGG 0: 1
1: 0
2: 0
3: 12
4: 238
1089496362_1089496376 -3 Left 1089496362 11:118910377-118910399 CCCCTCGTGCCCCACCCCCAGAG 0: 1
1: 0
2: 3
3: 58
4: 604
Right 1089496376 11:118910397-118910419 GAGCGCTCCAGCCGTGGAGGGGG 0: 1
1: 0
2: 0
3: 12
4: 238
1089496352_1089496376 27 Left 1089496352 11:118910347-118910369 CCAGACGCGCCCCTCACCCAGGG 0: 1
1: 0
2: 0
3: 11
4: 161
Right 1089496376 11:118910397-118910419 GAGCGCTCCAGCCGTGGAGGGGG 0: 1
1: 0
2: 0
3: 12
4: 238
1089496358_1089496376 17 Left 1089496358 11:118910357-118910379 CCCTCACCCAGGGTGGGGTACCC 0: 1
1: 0
2: 2
3: 30
4: 513
Right 1089496376 11:118910397-118910419 GAGCGCTCCAGCCGTGGAGGGGG 0: 1
1: 0
2: 0
3: 12
4: 238
1089496361_1089496376 10 Left 1089496361 11:118910364-118910386 CCAGGGTGGGGTACCCCTCGTGC 0: 1
1: 0
2: 0
3: 6
4: 95
Right 1089496376 11:118910397-118910419 GAGCGCTCCAGCCGTGGAGGGGG 0: 1
1: 0
2: 0
3: 12
4: 238
1089496360_1089496376 11 Left 1089496360 11:118910363-118910385 CCCAGGGTGGGGTACCCCTCGTG 0: 1
1: 0
2: 0
3: 6
4: 71
Right 1089496376 11:118910397-118910419 GAGCGCTCCAGCCGTGGAGGGGG 0: 1
1: 0
2: 0
3: 12
4: 238
1089496363_1089496376 -4 Left 1089496363 11:118910378-118910400 CCCTCGTGCCCCACCCCCAGAGC 0: 1
1: 0
2: 3
3: 25
4: 391
Right 1089496376 11:118910397-118910419 GAGCGCTCCAGCCGTGGAGGGGG 0: 1
1: 0
2: 0
3: 12
4: 238
1089496359_1089496376 16 Left 1089496359 11:118910358-118910380 CCTCACCCAGGGTGGGGTACCCC 0: 1
1: 0
2: 2
3: 13
4: 163
Right 1089496376 11:118910397-118910419 GAGCGCTCCAGCCGTGGAGGGGG 0: 1
1: 0
2: 0
3: 12
4: 238

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type