ID: 1089496383

View in Genome Browser
Species Human (GRCh38)
Location 11:118910409-118910431
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 314
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 288}

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089496360_1089496383 23 Left 1089496360 11:118910363-118910385 CCCAGGGTGGGGTACCCCTCGTG 0: 1
1: 0
2: 0
3: 6
4: 71
Right 1089496383 11:118910409-118910431 CGTGGAGGGGGCCCGGGGTTGGG 0: 1
1: 0
2: 1
3: 24
4: 288
1089496364_1089496383 7 Left 1089496364 11:118910379-118910401 CCTCGTGCCCCACCCCCAGAGCG 0: 1
1: 0
2: 2
3: 39
4: 362
Right 1089496383 11:118910409-118910431 CGTGGAGGGGGCCCGGGGTTGGG 0: 1
1: 0
2: 1
3: 24
4: 288
1089496371_1089496383 -7 Left 1089496371 11:118910393-118910415 CCCAGAGCGCTCCAGCCGTGGAG 0: 1
1: 0
2: 0
3: 3
4: 136
Right 1089496383 11:118910409-118910431 CGTGGAGGGGGCCCGGGGTTGGG 0: 1
1: 0
2: 1
3: 24
4: 288
1089496363_1089496383 8 Left 1089496363 11:118910378-118910400 CCCTCGTGCCCCACCCCCAGAGC 0: 1
1: 0
2: 3
3: 25
4: 391
Right 1089496383 11:118910409-118910431 CGTGGAGGGGGCCCGGGGTTGGG 0: 1
1: 0
2: 1
3: 24
4: 288
1089496370_1089496383 -6 Left 1089496370 11:118910392-118910414 CCCCAGAGCGCTCCAGCCGTGGA 0: 1
1: 0
2: 0
3: 8
4: 117
Right 1089496383 11:118910409-118910431 CGTGGAGGGGGCCCGGGGTTGGG 0: 1
1: 0
2: 1
3: 24
4: 288
1089496367_1089496383 -2 Left 1089496367 11:118910388-118910410 CCACCCCCAGAGCGCTCCAGCCG 0: 1
1: 0
2: 1
3: 15
4: 200
Right 1089496383 11:118910409-118910431 CGTGGAGGGGGCCCGGGGTTGGG 0: 1
1: 0
2: 1
3: 24
4: 288
1089496372_1089496383 -8 Left 1089496372 11:118910394-118910416 CCAGAGCGCTCCAGCCGTGGAGG 0: 1
1: 0
2: 0
3: 6
4: 138
Right 1089496383 11:118910409-118910431 CGTGGAGGGGGCCCGGGGTTGGG 0: 1
1: 0
2: 1
3: 24
4: 288
1089496366_1089496383 -1 Left 1089496366 11:118910387-118910409 CCCACCCCCAGAGCGCTCCAGCC 0: 1
1: 0
2: 2
3: 30
4: 321
Right 1089496383 11:118910409-118910431 CGTGGAGGGGGCCCGGGGTTGGG 0: 1
1: 0
2: 1
3: 24
4: 288
1089496361_1089496383 22 Left 1089496361 11:118910364-118910386 CCAGGGTGGGGTACCCCTCGTGC 0: 1
1: 0
2: 0
3: 6
4: 95
Right 1089496383 11:118910409-118910431 CGTGGAGGGGGCCCGGGGTTGGG 0: 1
1: 0
2: 1
3: 24
4: 288
1089496362_1089496383 9 Left 1089496362 11:118910377-118910399 CCCCTCGTGCCCCACCCCCAGAG 0: 1
1: 0
2: 3
3: 58
4: 604
Right 1089496383 11:118910409-118910431 CGTGGAGGGGGCCCGGGGTTGGG 0: 1
1: 0
2: 1
3: 24
4: 288
1089496368_1089496383 -5 Left 1089496368 11:118910391-118910413 CCCCCAGAGCGCTCCAGCCGTGG 0: 1
1: 0
2: 0
3: 17
4: 294
Right 1089496383 11:118910409-118910431 CGTGGAGGGGGCCCGGGGTTGGG 0: 1
1: 0
2: 1
3: 24
4: 288
1089496359_1089496383 28 Left 1089496359 11:118910358-118910380 CCTCACCCAGGGTGGGGTACCCC 0: 1
1: 0
2: 2
3: 13
4: 163
Right 1089496383 11:118910409-118910431 CGTGGAGGGGGCCCGGGGTTGGG 0: 1
1: 0
2: 1
3: 24
4: 288
1089496357_1089496383 30 Left 1089496357 11:118910356-118910378 CCCCTCACCCAGGGTGGGGTACC 0: 1
1: 0
2: 2
3: 24
4: 675
Right 1089496383 11:118910409-118910431 CGTGGAGGGGGCCCGGGGTTGGG 0: 1
1: 0
2: 1
3: 24
4: 288
1089496365_1089496383 0 Left 1089496365 11:118910386-118910408 CCCCACCCCCAGAGCGCTCCAGC 0: 1
1: 0
2: 1
3: 41
4: 410
Right 1089496383 11:118910409-118910431 CGTGGAGGGGGCCCGGGGTTGGG 0: 1
1: 0
2: 1
3: 24
4: 288
1089496358_1089496383 29 Left 1089496358 11:118910357-118910379 CCCTCACCCAGGGTGGGGTACCC 0: 1
1: 0
2: 2
3: 30
4: 513
Right 1089496383 11:118910409-118910431 CGTGGAGGGGGCCCGGGGTTGGG 0: 1
1: 0
2: 1
3: 24
4: 288

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type