ID: 1089496390

View in Genome Browser
Species Human (GRCh38)
Location 11:118910439-118910461
Sequence CCCGCCCCGTCCCCAGCTCG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 482
Summary {0: 1, 1: 0, 2: 2, 3: 59, 4: 420}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089496366_1089496390 29 Left 1089496366 11:118910387-118910409 CCCACCCCCAGAGCGCTCCAGCC 0: 1
1: 0
2: 2
3: 30
4: 321
Right 1089496390 11:118910439-118910461 CCCGCCCCGTCCCCAGCTCGAGG 0: 1
1: 0
2: 2
3: 59
4: 420
1089496370_1089496390 24 Left 1089496370 11:118910392-118910414 CCCCAGAGCGCTCCAGCCGTGGA 0: 1
1: 0
2: 0
3: 8
4: 117
Right 1089496390 11:118910439-118910461 CCCGCCCCGTCCCCAGCTCGAGG 0: 1
1: 0
2: 2
3: 59
4: 420
1089496367_1089496390 28 Left 1089496367 11:118910388-118910410 CCACCCCCAGAGCGCTCCAGCCG 0: 1
1: 0
2: 1
3: 15
4: 200
Right 1089496390 11:118910439-118910461 CCCGCCCCGTCCCCAGCTCGAGG 0: 1
1: 0
2: 2
3: 59
4: 420
1089496386_1089496390 -5 Left 1089496386 11:118910421-118910443 CCGGGGTTGGGGCCACGCCCCGC 0: 1
1: 0
2: 2
3: 21
4: 169
Right 1089496390 11:118910439-118910461 CCCGCCCCGTCCCCAGCTCGAGG 0: 1
1: 0
2: 2
3: 59
4: 420
1089496381_1089496390 8 Left 1089496381 11:118910408-118910430 CCGTGGAGGGGGCCCGGGGTTGG 0: 1
1: 0
2: 2
3: 18
4: 300
Right 1089496390 11:118910439-118910461 CCCGCCCCGTCCCCAGCTCGAGG 0: 1
1: 0
2: 2
3: 59
4: 420
1089496372_1089496390 22 Left 1089496372 11:118910394-118910416 CCAGAGCGCTCCAGCCGTGGAGG 0: 1
1: 0
2: 0
3: 6
4: 138
Right 1089496390 11:118910439-118910461 CCCGCCCCGTCCCCAGCTCGAGG 0: 1
1: 0
2: 2
3: 59
4: 420
1089496379_1089496390 12 Left 1089496379 11:118910404-118910426 CCAGCCGTGGAGGGGGCCCGGGG 0: 1
1: 0
2: 4
3: 46
4: 323
Right 1089496390 11:118910439-118910461 CCCGCCCCGTCCCCAGCTCGAGG 0: 1
1: 0
2: 2
3: 59
4: 420
1089496365_1089496390 30 Left 1089496365 11:118910386-118910408 CCCCACCCCCAGAGCGCTCCAGC 0: 1
1: 0
2: 1
3: 41
4: 410
Right 1089496390 11:118910439-118910461 CCCGCCCCGTCCCCAGCTCGAGG 0: 1
1: 0
2: 2
3: 59
4: 420
1089496385_1089496390 -4 Left 1089496385 11:118910420-118910442 CCCGGGGTTGGGGCCACGCCCCG 0: 1
1: 0
2: 1
3: 18
4: 165
Right 1089496390 11:118910439-118910461 CCCGCCCCGTCCCCAGCTCGAGG 0: 1
1: 0
2: 2
3: 59
4: 420
1089496368_1089496390 25 Left 1089496368 11:118910391-118910413 CCCCCAGAGCGCTCCAGCCGTGG 0: 1
1: 0
2: 0
3: 17
4: 294
Right 1089496390 11:118910439-118910461 CCCGCCCCGTCCCCAGCTCGAGG 0: 1
1: 0
2: 2
3: 59
4: 420
1089496371_1089496390 23 Left 1089496371 11:118910393-118910415 CCCAGAGCGCTCCAGCCGTGGAG 0: 1
1: 0
2: 0
3: 3
4: 136
Right 1089496390 11:118910439-118910461 CCCGCCCCGTCCCCAGCTCGAGG 0: 1
1: 0
2: 2
3: 59
4: 420

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089496390 Original CRISPR CCCGCCCCGTCCCCAGCTCG AGG Exonic