ID: 1089496663

View in Genome Browser
Species Human (GRCh38)
Location 11:118911495-118911517
Sequence ATGGAGAAGCTGGGGGTGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 732
Summary {0: 1, 1: 0, 2: 6, 3: 99, 4: 626}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089496663_1089496673 -1 Left 1089496663 11:118911495-118911517 CCCGCCACCCCCAGCTTCTCCAT 0: 1
1: 0
2: 6
3: 99
4: 626
Right 1089496673 11:118911517-118911539 TCACAACCAGGGAAGAGCAGAGG 0: 1
1: 0
2: 1
3: 33
4: 295
1089496663_1089496677 27 Left 1089496663 11:118911495-118911517 CCCGCCACCCCCAGCTTCTCCAT 0: 1
1: 0
2: 6
3: 99
4: 626
Right 1089496677 11:118911545-118911567 GCTGGAGTCACTGAGATACCAGG 0: 1
1: 0
2: 1
3: 29
4: 334
1089496663_1089496678 28 Left 1089496663 11:118911495-118911517 CCCGCCACCCCCAGCTTCTCCAT 0: 1
1: 0
2: 6
3: 99
4: 626
Right 1089496678 11:118911546-118911568 CTGGAGTCACTGAGATACCAGGG 0: 1
1: 0
2: 2
3: 8
4: 202
1089496663_1089496675 5 Left 1089496663 11:118911495-118911517 CCCGCCACCCCCAGCTTCTCCAT 0: 1
1: 0
2: 6
3: 99
4: 626
Right 1089496675 11:118911523-118911545 CCAGGGAAGAGCAGAGGCAGAGG 0: 1
1: 0
2: 9
3: 115
4: 1052
1089496663_1089496676 9 Left 1089496663 11:118911495-118911517 CCCGCCACCCCCAGCTTCTCCAT 0: 1
1: 0
2: 6
3: 99
4: 626
Right 1089496676 11:118911527-118911549 GGAAGAGCAGAGGCAGAGGCTGG 0: 1
1: 1
2: 20
3: 170
4: 1579

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089496663 Original CRISPR ATGGAGAAGCTGGGGGTGGC GGG (reversed) Intronic
900522170 1:3111069-3111091 ATGGGGAAGCTGGAGGTGGGAGG + Intronic
900523009 1:3115260-3115282 ATGGGACAGCTGGGGCTGGCTGG - Intronic
900530802 1:3152174-3152196 ATGGTGAAGGTGGGGAAGGCAGG + Intronic
900978169 1:6030248-6030270 ACAGAGAAGCTGGGGTTGCCTGG + Intronic
901008390 1:6183103-6183125 CTTGAGAAGCTGGTGGTGCCAGG - Intronic
901089539 1:6632250-6632272 AGGGAGAAGCTGGCTGTGGAGGG + Intronic
901094276 1:6665842-6665864 ATGGGGGAGGTGGGGGTGCCTGG - Intronic
901493311 1:9607588-9607610 ATGGCCAAGCTGGGGCTGGTGGG - Exonic
902341254 1:15784920-15784942 AGGGAAAAGCTGGGGGAGGTTGG + Intronic
902466992 1:16624499-16624521 ATGAACAAGCTGGGGGATGCTGG - Intergenic
902507606 1:16948277-16948299 ATGAACAAGCTGGGGGACGCTGG + Intronic
902597932 1:17521829-17521851 ATGGTGAAGCTGAGGTTGGAAGG + Intergenic
902609347 1:17588156-17588178 CTGGAGCAGCTGGGGGTGGAGGG + Intronic
902953824 1:19910716-19910738 GTGGAGCAGCTGGAGCTGGCTGG + Exonic
902955591 1:19922559-19922581 ATGGAGGAGCTGGGGGATCCTGG - Intronic
903682278 1:25104970-25104992 ATGGAGAGGCTGGCAGGGGCTGG - Intergenic
903794433 1:25918245-25918267 GCTGGGAAGCTGGGGGTGGCTGG + Intergenic
904022823 1:27480892-27480914 AGGGAGGAGCTGGGAGTAGCTGG - Intronic
904090286 1:27940316-27940338 AAGGACACGCTGGGGCTGGCTGG + Intronic
904454869 1:30641508-30641530 AAGGAGAGGCTGGCGGGGGCGGG - Intergenic
904756513 1:32771357-32771379 GTGGGGAAGGTGGGGGTGACTGG - Exonic
905034876 1:34911497-34911519 ATGGTGAAGCTGGGGGCCGACGG + Intronic
905999158 1:42408909-42408931 ATGGAAAAGCTGATGTTGGCCGG + Intronic
906291795 1:44624150-44624172 AAGGGGAGGCTGGGGGTGCCAGG + Intronic
906701467 1:47861273-47861295 ATGGTGGTGGTGGGGGTGGCGGG + Intronic
906712930 1:47945035-47945057 CTGGGGAAGTTGGGGGTGGGTGG + Intronic
907278245 1:53328523-53328545 AGGGAGAAGCTGGGGGCGCAGGG + Intergenic
907311977 1:53543988-53544010 ATGGAGAACCAAGGGGTGGCGGG + Intronic
907547456 1:55274699-55274721 ATGGAGAAGAGGGAGGTAGCAGG - Intergenic
907548265 1:55282015-55282037 ATGGAGGTTCTTGGGGTGGCTGG - Intergenic
907704085 1:56818172-56818194 ATGGTCGAGGTGGGGGTGGCGGG + Intronic
907919722 1:58901254-58901276 CTGGAGAAGGTGGGGGTTGGGGG + Intergenic
908318838 1:62961624-62961646 ATGGGGAGGAGGGGGGTGGCTGG - Intergenic
908405152 1:63807264-63807286 ATGGGCAAGGTGGGGGTGGCTGG + Intronic
908912055 1:69083294-69083316 ATGGAGAAGATGGGGGAGGGAGG - Intergenic
910772520 1:90844342-90844364 TTTAAGAAGCTGGGGCTGGCCGG - Intergenic
912186046 1:107276980-107277002 AAGAGGAAGCTGGGGGAGGCTGG + Intronic
912628109 1:111222958-111222980 ACTGAGAAGCTGGGGGAGGTAGG + Intronic
912866983 1:113266590-113266612 CAGGAGAAGCTGGGCGTGGGGGG - Intergenic
913129761 1:115828794-115828816 TGGGAGAAGGTGGGGGAGGCGGG - Intergenic
913283797 1:117209657-117209679 CAGGAGAAGCAGTGGGTGGCAGG - Intronic
913369682 1:118084097-118084119 AAGGAGAAGTGGAGGGTGGCAGG + Intronic
913439165 1:118879008-118879030 GTGGAGGTGCTGGGGGTGGGTGG + Intergenic
915009880 1:152675680-152675702 AAGGACAAGCTGGGTGTTGCAGG - Intronic
915107981 1:153546137-153546159 AAGGAGATGCAGGGGGTGGTGGG + Intronic
915791850 1:158680828-158680850 ATGGAGATACTGGGGGAGACTGG + Intronic
915953432 1:160205263-160205285 ATGGAGAGGCAGGAGGGGGCGGG - Intergenic
915955492 1:160217083-160217105 ATGGGGTTGCTGGGGGTGGGGGG + Exonic
916005430 1:160655084-160655106 ATGGAGAAGAGGTGGGTGGATGG - Intergenic
916826139 1:168443729-168443751 ATTAAGAAGGTGGGGGTGGGTGG + Intergenic
917796837 1:178538770-178538792 AGGGGGAAGCTGGGAATGGCTGG - Intronic
918464554 1:184808060-184808082 ATGCAGGAGGTGGGTGTGGCAGG - Exonic
920326181 1:205166200-205166222 ATGGAGAAGAACTGGGTGGCTGG + Intronic
920495076 1:206448747-206448769 TTTGAGATGGTGGGGGTGGCGGG - Intronic
920717665 1:208355993-208356015 AGGGAGCAGCTTGGGGTGGGAGG + Intergenic
921129715 1:212209300-212209322 ATGGAGGAGGTGGAGGTGCCAGG - Intergenic
922209611 1:223477512-223477534 ATGTAGAGGCCTGGGGTGGCAGG - Intergenic
922304160 1:224329856-224329878 AGGGAGAAGCCGGGGATGGTGGG - Intronic
922474600 1:225898587-225898609 TTGGTGAAGCCGGGAGTGGCTGG - Intronic
922785957 1:228282332-228282354 CTGCAGCAGCTGGGGGAGGCAGG - Intronic
922902619 1:229148404-229148426 AGGGAGCAGCTGGAGGTGGGAGG - Intergenic
923037092 1:230291970-230291992 GTGGTGAAGCGGGGAGTGGCAGG + Intergenic
923093189 1:230754872-230754894 ATGGAGAAGCTGGGTGGGTAGGG + Intronic
923365379 1:233255316-233255338 ATTAGGAAGCTGGAGGTGGCTGG - Intronic
923420977 1:233814632-233814654 AGAGGGAAGCTGGAGGTGGCTGG + Intergenic
924112170 1:240711116-240711138 ATGGAGGCGCTCAGGGTGGCAGG - Intergenic
1062837616 10:646305-646327 GTGGAGAGCCTGGGGGAGGCTGG - Intronic
1062982480 10:1736996-1737018 GTGGAGAAGCCGGGGGTGAAGGG + Intronic
1063428005 10:5964835-5964857 ATGGGAAAGCTGAGCGTGGCGGG - Intronic
1063616399 10:7604047-7604069 AGGGAGAACCTGGAGGTGCCTGG - Intronic
1065655954 10:27950045-27950067 ATGGAGAAGCTGTGTGGGGTAGG - Intronic
1066984798 10:42455258-42455280 ATGGAGAAGGAGGTGGAGGCAGG - Intergenic
1067003359 10:42638344-42638366 ACGGAGAAGCCGGGGACGGCGGG - Intronic
1067079373 10:43204656-43204678 ATGGGGAAGGGTGGGGTGGCGGG + Intronic
1067201117 10:44172859-44172881 ATGAAGAAGCAGGGGCTGGCGGG - Intergenic
1067251598 10:44591362-44591384 AAGGAGAAGCAAGGGGTGGCTGG - Intergenic
1067370495 10:45677909-45677931 ATGGAGAAGGAGGTGGAGGCAGG + Intergenic
1067389285 10:45848247-45848269 ATGGAGAAGGAGGTGGAGGCAGG - Intronic
1067416785 10:46108711-46108733 ATGGAGAAGGAGGTGGAGGCAGG + Intergenic
1067444971 10:46336302-46336324 ATGGAGAAGGAGGTGGAGGCAGG + Intergenic
1067502184 10:46815594-46815616 ATGGAGAAGGAGGTGGAGGCAGG + Intergenic
1067556612 10:47277601-47277623 AGGGAGAGGCAGGAGGTGGCAGG - Intergenic
1067592401 10:47524426-47524448 ATGGAGAAGGAGGTGGAGGCAGG - Intronic
1067639517 10:48032499-48032521 ATGGAGAAGGAGGTGGAGGCAGG - Intergenic
1067723919 10:48751832-48751854 ATGCAGCTGCTGTGGGTGGCAGG + Intronic
1067748682 10:48956042-48956064 ATGAAGGTGCTGGGGGTGGAGGG - Intronic
1067854577 10:49781072-49781094 AGGGAGCAGCTGGGGGTGTTGGG - Intergenic
1067873978 10:49987806-49987828 ATGGAGAAGGAGGTGGAGGCAGG + Intronic
1068309613 10:55261468-55261490 ATAGTGAATCTGGGGGTAGCAGG - Intronic
1069659014 10:70111356-70111378 AGGGACAGCCTGGGGGTGGCAGG - Intronic
1069837117 10:71316571-71316593 ATGGGGAGGCTGGGGTGGGCAGG - Intergenic
1069961042 10:72079671-72079693 ATGGAGAAGCTGGGAGAGATTGG - Intronic
1070136502 10:73698649-73698671 ATGGAGAAGGAGGTGGAGGCAGG - Intergenic
1070288859 10:75102022-75102044 GTGGACAAGTTGGGAGTGGCAGG - Intronic
1071384306 10:85104225-85104247 ATGGAGCAGCAGGGAGGGGCTGG - Intergenic
1072718512 10:97766998-97767020 ATGGGCAAGCTGGGGAAGGCAGG + Exonic
1073358113 10:102873181-102873203 ATTGAGAAGTTGGGAGAGGCTGG + Exonic
1073466583 10:103697805-103697827 AGGGAGAGGCTGGTGGGGGCAGG + Intronic
1073690613 10:105804777-105804799 AAGGAGAAAATGGGGGTGGATGG - Intergenic
1074101904 10:110360309-110360331 ATGGAGAGGCTGGGAGGGGCAGG - Intergenic
1074189102 10:111120729-111120751 CTGGAGAAGCTGGGAGTTGCAGG - Intergenic
1074204420 10:111270199-111270221 ATCTAGAAGCAGGCGGTGGCAGG - Intergenic
1074402266 10:113151903-113151925 AGGGAGAAGCGGGGGGCGGGTGG + Intronic
1074866828 10:117549063-117549085 ACGGGGGGGCTGGGGGTGGCGGG + Exonic
1075712869 10:124540177-124540199 GTGGAGATGCTGTGGGTGGGTGG + Intronic
1075857097 10:125638752-125638774 AGGGAGCAGGTTGGGGTGGCAGG - Intronic
1076330109 10:129657834-129657856 ATGGAGATGCTGGGAATGGGAGG + Intronic
1076529349 10:131134135-131134157 CTGGGTAGGCTGGGGGTGGCAGG + Intronic
1076850327 10:133089251-133089273 GTGGAGGGGCTTGGGGTGGCAGG - Intronic
1077166035 11:1139282-1139304 AGGGGGTAGCTGGGGGAGGCGGG + Intergenic
1077482855 11:2824688-2824710 AGGAAGCAGCTGGGGGTGGCGGG + Intronic
1077606214 11:3614637-3614659 AGGGAGAAGCTGGGTGAGGTGGG - Intergenic
1078019143 11:7640862-7640884 ATGGAGAAGGAGGGGGTGAGTGG - Intronic
1078069692 11:8100432-8100454 CTGGAGAAGGTGGGGGGGACGGG - Intronic
1078426991 11:11260046-11260068 ATGGGAAAGATGGGGGTGGAAGG - Intergenic
1078928142 11:15892531-15892553 AGGAACAGGCTGGGGGTGGCAGG - Intergenic
1079330232 11:19527034-19527056 ATAGAGATGGTGGGGGTGGGAGG - Intronic
1079339235 11:19598247-19598269 AAAGAGAACCTGGGGGTGCCAGG + Intronic
1079359672 11:19759891-19759913 GTGGAAATGCTGGGGGTGGGGGG + Intronic
1080956527 11:37103173-37103195 ATGGAAAAGCTAGAGGGGGCTGG + Intergenic
1081603501 11:44511953-44511975 ACTTAGAAGCTGGGGGTGACAGG - Intergenic
1081647889 11:44802574-44802596 ATGGAGCAGATGGGAGTGGGGGG + Intronic
1081651279 11:44825704-44825726 ATGTTGAAGCGGGGGTTGGCTGG + Intronic
1081677638 11:44980284-44980306 CTGGAGAAGCTGTAGTTGGCAGG - Intergenic
1081852814 11:46285463-46285485 CAGGAGAAGCTGGGAGAGGCAGG + Intronic
1082853085 11:57782751-57782773 ATGGAGAAGTTGGGCCTAGCAGG + Intronic
1083713057 11:64560443-64560465 CTGGTGGAGCTGGGGGTGGATGG - Intronic
1084415144 11:69027745-69027767 ATCTAGAAGCTGGAGGTGGTAGG + Intergenic
1084566652 11:69932504-69932526 GTAGAGAAGCTGGGGCTGGGAGG - Intergenic
1084850563 11:71936355-71936377 AAGGGTGAGCTGGGGGTGGCAGG - Intronic
1084941306 11:72614824-72614846 GGGGAGAGGCTGGGGGTGGAAGG + Intronic
1084956325 11:72693549-72693571 ATGGAGAGGCTGGGGCAGGATGG - Intronic
1085303634 11:75473081-75473103 GCGGAGAAGCTCAGGGTGGCTGG + Intronic
1085329585 11:75636773-75636795 ATGGATAAGCTGGGGCAAGCAGG - Intronic
1085427202 11:76415196-76415218 ATGCAGGAGATGGGGCTGGCTGG + Intergenic
1089170243 11:116506602-116506624 AGGGAGAGGGTGGGGGTGGATGG + Intergenic
1089365992 11:117921487-117921509 ATGGGGCAGCTGGGGCTGGATGG - Intronic
1089496663 11:118911495-118911517 ATGGAGAAGCTGGGGGTGGCGGG - Intronic
1089632974 11:119794822-119794844 ATGGAGATGCTGAGGAGGGCAGG + Intergenic
1089777929 11:120851906-120851928 ATGGTGGAGCTGGGGGTGCCTGG + Intronic
1090060790 11:123462553-123462575 TTGGAGAAGGGGTGGGTGGCAGG - Intergenic
1090397599 11:126429450-126429472 ATGGAGATGCTGTGGGTGTTTGG + Intronic
1090414099 11:126528850-126528872 ATGGAGAGGGAGGGGGTGGGTGG + Intronic
1090602462 11:128387298-128387320 CTGGAGAAGCAGTGGGTGACAGG - Intergenic
1091220138 11:133925842-133925864 ATGGGAAAGCTGTGGTTGGCAGG + Exonic
1091282569 11:134390360-134390382 ATGGGGAGGCTGGGCCTGGCTGG + Exonic
1091394314 12:144191-144213 ATGGAGAAGCAGAAAGTGGCAGG + Intronic
1091697156 12:2635517-2635539 ATGGAGGAGCTGGGGGTGGTGGG - Intronic
1091728402 12:2861892-2861914 ATGTAGAGGCTGGGCGTGGTGGG + Intronic
1091746691 12:2997382-2997404 GTGGAGCACCTGGGGGTGCCTGG + Intronic
1091838404 12:3602025-3602047 AGGGCGAAGTTGGGGGTGGGAGG - Intergenic
1091936690 12:4440451-4440473 ATGGAGAAGGATGGGGTGGAAGG + Intronic
1091985989 12:4910496-4910518 ATGCAGAAGCGGGGGTTGGGGGG + Intronic
1092100990 12:5883614-5883636 ATGGAGAAGCAGGGTGTGGAGGG + Intronic
1094809951 12:34126953-34126975 CTAGAGTGGCTGGGGGTGGCAGG - Intergenic
1095960822 12:47833281-47833303 AGCTAGAAGGTGGGGGTGGCAGG + Intergenic
1097176951 12:57148838-57148860 ATGGGGAAGAAGGAGGTGGCTGG + Intronic
1097903418 12:64896069-64896091 ATGAAAAAGCTGAGGGGGGCAGG - Intergenic
1098291210 12:68958427-68958449 ACAGAAAAGCTGGGGGTGGAGGG - Intronic
1098987903 12:77031939-77031961 ATGGAGAAGTTGAAGGTGGATGG - Intronic
1099613985 12:84912331-84912353 AGGGAGAAGCTGGGCTGGGCGGG - Intronic
1099768471 12:87021260-87021282 ATGGGGATAGTGGGGGTGGCAGG - Intergenic
1100446563 12:94666001-94666023 ATGGAGAAGCAGGGAAAGGCTGG - Intergenic
1100888446 12:99098764-99098786 ATGGCAGAGCTGGGGGTGGGGGG - Intronic
1102037930 12:109782839-109782861 GTGGGGAAGGTGGGGGTGGAGGG - Intergenic
1102556385 12:113729472-113729494 ATGGTGAAGGTGAGGGTGGATGG + Intergenic
1102926339 12:116829133-116829155 ATGGGGCAGCTGAGGGTGGGTGG + Intronic
1103743583 12:123107462-123107484 TTCCAGAAGGTGGGGGTGGCAGG - Intronic
1104830354 12:131746806-131746828 ATGGAGAAGCTCATGCTGGCCGG + Intronic
1104947851 12:132424820-132424842 GTGGAGGAGCTGGTCGTGGCAGG - Intergenic
1105260626 13:18776674-18776696 ATGGAGAAGCATGGGGTTGGAGG - Intergenic
1105889533 13:24672607-24672629 ATGGAGGAGCAGGGCCTGGCTGG - Intergenic
1105927702 13:25022033-25022055 ATGGGGAAGATGGGGCTGGATGG - Intergenic
1106540636 13:30687048-30687070 ATGGAGAAGATGGTGCTAGCAGG + Intergenic
1106570185 13:30920159-30920181 CTGGAGAAGCTGGGGAGAGCTGG + Intronic
1106845284 13:33731701-33731723 ATGGAGTTGCTGGGGATGGGAGG - Intergenic
1107749259 13:43546644-43546666 AAGCAGAAGCTGGGGGTGTGAGG - Intronic
1107834530 13:44402909-44402931 CTAGATAAGCTGGGGGTGTCAGG + Intergenic
1107853411 13:44591975-44591997 GAGGGGAAGCTGAGGGTGGCTGG + Intergenic
1108190392 13:47932462-47932484 ATGGAGCAGCTTTGGGTGGAGGG - Intergenic
1108468272 13:50740997-50741019 ATGGGGAAGCAGGTGGTGGTAGG - Intronic
1108678876 13:52762447-52762469 ATGGTGAAGTTGGGGGAGGAAGG + Intergenic
1109115073 13:58371715-58371737 AGTGAGAAGCTGGAGGTGGCTGG + Intergenic
1109142023 13:58725296-58725318 ATGGAGAAGGAGCTGGTGGCAGG + Intergenic
1109249317 13:59999795-59999817 GAGGAGGAGCTGGGGGAGGCTGG - Intronic
1111016340 13:82387058-82387080 ATGAACAAAGTGGGGGTGGCAGG - Intergenic
1111927393 13:94478160-94478182 CTCGAGGAGCTGGGGGTGGGGGG - Intronic
1111941383 13:94611773-94611795 CTGGGGATCCTGGGGGTGGCCGG - Intronic
1112486406 13:99824264-99824286 AAGGATTAGCTGGGGGTGGGTGG - Intronic
1113142908 13:107174754-107174776 AGGGAGAAGCAGGATGTGGCTGG + Intronic
1113871168 13:113560740-113560762 AGGCAGAAGCTGGGAGGGGCTGG + Intergenic
1114401985 14:22418515-22418537 ATGGAAGAGCTGAGGGTGGAAGG - Intergenic
1114402505 14:22422806-22422828 ATGGAGCACCTGAGGGTGGCAGG - Intergenic
1114548523 14:23520280-23520302 ACGGAGAAGCTGGGCTGGGCTGG + Intergenic
1114552659 14:23542304-23542326 AGGAAGAAGATGGGGGTGGTAGG + Intronic
1115896222 14:38090731-38090753 ATGGAACAGCTGGGGCTGGCTGG - Intergenic
1117826167 14:59705936-59705958 AAGGAAAAGCTGGGGGTGAACGG - Intronic
1117851276 14:59972564-59972586 ATGCAGAAGTTTGGGGTGGTGGG - Intronic
1117859264 14:60073171-60073193 AAAGAAAAGCAGGGGGTGGCTGG + Intergenic
1118006772 14:61570342-61570364 AGGGGGAAGTCGGGGGTGGCTGG - Intronic
1118594182 14:67423359-67423381 ATGAAGAAGCTGGCTGTGGAGGG - Intergenic
1119944503 14:78678433-78678455 CTGGAGTAGCTGGGTGTGGTGGG - Intronic
1121115902 14:91342556-91342578 AAGGAGAAGCCCGGGGTGGGTGG - Intronic
1121246292 14:92463189-92463211 CTGAAGAAGATGGGGGTGGATGG - Intronic
1121608201 14:95256780-95256802 ATGGGGAAACTGGGGATGGCAGG + Intronic
1121631685 14:95425670-95425692 ATGGGGAAGATGGAGGAGGCTGG + Intronic
1121958904 14:98240579-98240601 AGGGAGCAGCTGGGGAAGGCTGG + Intergenic
1121995804 14:98602083-98602105 ATGGAAATGCTGGGGGAGGAGGG - Intergenic
1122239214 14:100350918-100350940 TTAGCTAAGCTGGGGGTGGCAGG + Intronic
1122345471 14:101056074-101056096 TTGGTGAACCTGGGGTTGGCCGG + Intergenic
1122618864 14:103041695-103041717 TTGGAGGAGCTCAGGGTGGCTGG + Intronic
1122688731 14:103521817-103521839 ATCGAGAAGCTCGCGGTGGAAGG - Exonic
1122721272 14:103723914-103723936 AGGGACACGCTGAGGGTGGCGGG + Intronic
1122878253 14:104678642-104678664 AGAGAGCAGCTGGGGGTGCCGGG - Intergenic
1123123262 14:105927824-105927846 ATGGAGAGACTGGAGGAGGCAGG - Intronic
1124067914 15:26363364-26363386 ATGGAGAGATTGGAGGTGGCGGG + Intergenic
1125201841 15:37107072-37107094 ACGGGGGAGGTGGGGGTGGCGGG + Intergenic
1125338439 15:38651365-38651387 AATAAGTAGCTGGGGGTGGCGGG + Intergenic
1126849212 15:52787386-52787408 AATGAGAAGCTGGGGGTGGCAGG - Intronic
1127346926 15:58110324-58110346 ATGGAGAAGGTGAGGGTAGAAGG + Intronic
1127425767 15:58854487-58854509 ATGGAGAGGCTTGTGCTGGCTGG - Exonic
1127613315 15:60658032-60658054 AAGGAAAAGCGGGGAGTGGCGGG + Intronic
1128020700 15:64387855-64387877 CTGGGGAAGATGGCGGTGGCTGG + Exonic
1128294865 15:66509746-66509768 ACAGACAAGCTGGGGGTGGGGGG + Intronic
1128315138 15:66655180-66655202 AGGGCAAAGCTGGGGGTGGTGGG + Intronic
1128676235 15:69610999-69611021 ATGAAGAGCCTGGGGGAGGCAGG + Intergenic
1128834755 15:70800203-70800225 CTGGAGCAGCTGTGGGTGGCAGG + Intergenic
1129332531 15:74835103-74835125 ATTGAGAAGATGGGAGGGGCTGG - Intergenic
1129665294 15:77576226-77576248 AGGGAGGAGCAGGGGGAGGCTGG + Intergenic
1129688663 15:77700852-77700874 AGGGAGAGGCTGCGGGTAGCAGG - Intronic
1129708291 15:77807029-77807051 TCTGAGAAGCTGGGTGTGGCTGG - Intronic
1130362013 15:83197940-83197962 CAGGAGAACCTGGGGGCGGCGGG + Intronic
1130600996 15:85273097-85273119 TTGGAGAAGGCGGGGGTGGGGGG + Intergenic
1131407289 15:92175809-92175831 ATGGAGAGAGTGGGGGTGGGAGG - Intergenic
1132292801 15:100714895-100714917 ATGGGGATGCTGGGGGTGGCAGG + Intergenic
1132384648 15:101391313-101391335 GAGGAGAAACTAGGGGTGGCTGG + Intronic
1132386386 15:101403647-101403669 TCTGAGAAGCTGGGGGTGACAGG - Intronic
1132663878 16:1073030-1073052 ATGGAGCTGCTGGGAGTGGATGG - Intergenic
1132664741 16:1076247-1076269 AGGGAGAGGGAGGGGGTGGCAGG - Intergenic
1132687442 16:1168272-1168294 AGGGAGGAGATGGGGGTTGCTGG - Intronic
1132718000 16:1301597-1301619 GTGGAGCAGCTGGGAGGGGCAGG - Intergenic
1132718888 16:1306331-1306353 ATGGAGCAGGTGGGGGTGAGGGG - Intergenic
1132864424 16:2086470-2086492 CTGGAGCAGGTGGGGGTGCCAGG - Intronic
1133130074 16:3671514-3671536 CAGAAGAAGGTGGGGGTGGCTGG - Intronic
1133187904 16:4113863-4113885 ATGGAGCAGCTGGGAGTGGCCGG - Exonic
1133346966 16:5077671-5077693 TTGGGGAAGCTGGGGGAGGAGGG + Intronic
1133429365 16:5723296-5723318 TTGGAGAAGCTTGGGATGGATGG + Intergenic
1134491852 16:14701594-14701616 ATGGAGAGGCTGGGTGTGTGTGG + Intergenic
1134497233 16:14740712-14740734 ATGGAGAGGCTGGGTGTGTGTGG + Intronic
1134692021 16:16197416-16197438 AAGGAGGAGATGGGGGTGGAAGG + Intronic
1135591299 16:23706765-23706787 ATGTAGAGGCGGGGGGTGGAGGG + Exonic
1135979372 16:27135403-27135425 AAGGAAAAGCAGGGGGTGGTGGG - Intergenic
1136096467 16:27960621-27960643 ATGGAGAAGCTGAGTGTGGTGGG + Intronic
1136099161 16:27980584-27980606 ATGAAGAAACTGAGGCTGGCTGG + Intronic
1136999701 16:35217630-35217652 ATGGAGACGGTGGGGTTGCCAGG - Intergenic
1137003254 16:35250376-35250398 ATGGAGAGGGTGGGGTTGCCAGG + Intergenic
1137028144 16:35498811-35498833 TTGGCGAGGCTGGGGCTGGCTGG - Intergenic
1137257114 16:46785124-46785146 AGGGAGAAGCTGGGAGTTGGGGG - Intronic
1137605741 16:49785863-49785885 CAGGAGAAGTTGGGGTTGGCAGG + Intronic
1137610684 16:49815250-49815272 GTGGAGCAGCTGGGGGTATCAGG - Intronic
1137757294 16:50912898-50912920 ATGGATGAGCTGGGGTTGGAGGG - Intergenic
1137916506 16:52436313-52436335 ATGGAGGTGGTGGGGGTGGGGGG + Intergenic
1138195147 16:55046425-55046447 ATGGAGAAGCTGGAAGTCTCTGG - Intergenic
1138415832 16:56870777-56870799 GTGGAGAAGCGGGGGTTGCCAGG + Intronic
1139056458 16:63191171-63191193 ATGCAAATGCTGGGGTTGGCTGG + Intergenic
1139754332 16:69131482-69131504 GTGGAGAAGATGGGGGTGGGTGG - Intronic
1140037355 16:71381573-71381595 GTGGAGAAGTGGGGGGAGGCAGG + Intronic
1140115677 16:72039413-72039435 TTGGAGAAGCTGCGGCTGGAGGG + Intergenic
1142132860 16:88438763-88438785 CTGGGGAAGCTGGGCTTGGCTGG - Exonic
1142210488 16:88806201-88806223 CGGGAGAAGCTGTGAGTGGCAGG - Intronic
1142251173 16:88992760-88992782 AAGGAGTACCTCGGGGTGGCTGG - Intergenic
1142286352 16:89173096-89173118 ATGGGGGAGTCGGGGGTGGCAGG - Intronic
1142642924 17:1295197-1295219 GTGGAGGAGGTGGCGGTGGCAGG - Intronic
1142741149 17:1932661-1932683 ATGGACAGGCTGGGGGGGGTGGG + Intergenic
1143150157 17:4802555-4802577 ATGGAGAAGCAGGAGGTGGTTGG + Intergenic
1143165035 17:4893385-4893407 AGGGAGAAGCTGGGCCTGGGTGG - Intronic
1143610616 17:8015718-8015740 GTGGAGATGCTGGGGGTCGGCGG - Intronic
1143861897 17:9897279-9897301 CAGGAGAAGGTCGGGGTGGCTGG - Exonic
1144673402 17:17145814-17145836 AAGGAGATGCTGGGCTTGGCAGG - Intronic
1144686879 17:17231968-17231990 AGGGAGACCCTGGGTGTGGCTGG + Intronic
1144708170 17:17383759-17383781 CTGGAGGAGCTCAGGGTGGCCGG - Intergenic
1144810042 17:17993187-17993209 ATGAAGAAGCTGAGGAGGGCTGG + Intronic
1146001141 17:29131224-29131246 ATGGAGTAGGTGGGGATTGCAGG - Intronic
1146058540 17:29593039-29593061 CTCGTGAAACTGGGGGTGGCAGG - Intronic
1146305346 17:31725915-31725937 ATAGAGAAGTTGGGCGTGGGTGG + Intergenic
1146376298 17:32296960-32296982 CTAGAGAAGCTGAGGCTGGCAGG - Intronic
1147155491 17:38542607-38542629 GTGGAGAGGCTGCGGGGGGCTGG + Intronic
1147332125 17:39705415-39705437 AAACAGGAGCTGGGGGTGGCAGG - Intronic
1147363470 17:39945485-39945507 AGGAAGAAGCTGGTGGTGGACGG - Intergenic
1147381751 17:40060385-40060407 AAAAAGAAGATGGGGGTGGCCGG + Intronic
1148108258 17:45130824-45130846 GGGGAGAGGCTGGGGGTGGGAGG - Intronic
1148334842 17:46834308-46834330 CTGGAGAAGCAGGTGGTGCCTGG + Intronic
1148342492 17:46881652-46881674 ATTGAGCAGCTGGAGGTGGAGGG - Intronic
1148533753 17:48420664-48420686 CTGGAGAATCAGGGGGTGCCAGG - Intronic
1148763443 17:50021727-50021749 ATGAAGAGGATGGGGGTGGAGGG - Intergenic
1148853412 17:50565694-50565716 AGGGAGAGGAGGGGGGTGGCTGG - Intronic
1148908444 17:50926616-50926638 TTTGAGGAGCTGGGGATGGCTGG - Intergenic
1149601394 17:57895399-57895421 CTGGAGAGGCTGGGGGTGCCTGG + Intronic
1150291850 17:63986967-63986989 ATGGGGTAGGTGGGGGTGCCTGG + Intergenic
1150437590 17:65166006-65166028 CTGGAGCAACTGGGGCTGGCTGG + Intronic
1150639860 17:66942307-66942329 TTGAAGAGGCTGGGGGTGGGGGG - Intergenic
1150710740 17:67529041-67529063 CTGCAGACGCTGGGGGTGGCGGG - Intronic
1151137150 17:71957722-71957744 GGAGAGAAGCTGGGGGTGGGGGG - Intergenic
1151323583 17:73365777-73365799 GTGGAGAAGGTGGGGGTGTCTGG + Intronic
1151364145 17:73606292-73606314 CTGGGGAAGCTGGGTGGGGCAGG + Intronic
1151399288 17:73845159-73845181 ATGGAGAAGCTGTGTGATGCTGG - Intergenic
1151549539 17:74814209-74814231 TTGGAGATGCTGGTGATGGCGGG + Intronic
1151817008 17:76476312-76476334 AAGAAGAAGCTGGGGCTGGGAGG - Intronic
1151947795 17:77329025-77329047 CTGGGGAAGGTGGGAGTGGCTGG + Intronic
1152031248 17:77844902-77844924 TTGGAGAAGCATGGGGAGGCAGG - Intergenic
1152279391 17:79376373-79376395 AGAGGGAAGGTGGGGGTGGCAGG + Intronic
1152537635 17:80959876-80959898 AGGGAGAGGCAGGGGCTGGCAGG - Intronic
1152814007 17:82397017-82397039 AGGGAGCAGCTGAGGGAGGCAGG + Intronic
1152937995 17:83151905-83151927 ATGCAGGAACTGCGGGTGGCAGG + Intergenic
1153527944 18:6015353-6015375 TTGCAGAAGGTGGGGGTGGATGG + Intronic
1153618321 18:6953883-6953905 GAGGACAAGCTGGGGCTGGCTGG + Intronic
1154172308 18:12060886-12060908 ATGGAGAGGTTGGGGGGTGCAGG + Intergenic
1154375084 18:13802471-13802493 ATGGAGAAGCTGAGGTTTGGTGG - Intergenic
1155056137 18:22185412-22185434 ACTGAGAAGCTGGGAGTGGCTGG + Intronic
1156073088 18:33237276-33237298 ATGGAAGTGCTGGGGGTGGAGGG - Intronic
1156273225 18:35556703-35556725 TTGGAGGAGTTGGGGGTGACTGG - Intergenic
1156491860 18:37501094-37501116 TGAGAGAAGGTGGGGGTGGCCGG + Intronic
1157430265 18:47619136-47619158 AGGGAGAAGCTGAGGGCTGCAGG - Intergenic
1157523386 18:48360816-48360838 ATGCAGCAGCTGGTGGTGGTGGG + Intronic
1157584642 18:48793247-48793269 AGGGAGAAGCAGGGAGGGGCAGG + Intronic
1157671113 18:49529518-49529540 TTGAAGAAGCTGGTGGTGGGGGG - Intergenic
1158009008 18:52706993-52707015 AGGTAGAAGCTGGGGTTGGAGGG + Intronic
1158890590 18:61868356-61868378 CAGGATCAGCTGGGGGTGGCTGG - Intronic
1159097594 18:63921919-63921941 AAGGAGGGGTTGGGGGTGGCAGG - Intronic
1159106010 18:64002687-64002709 TTGGAGAAGCCGGGGAGGGCGGG + Intronic
1159376424 18:67599014-67599036 ATTAAAAAGCTGGGGGTGGCCGG - Intergenic
1160160101 18:76464573-76464595 ATGGCCAGGCTGGGGGTGCCAGG - Intronic
1160160136 18:76464699-76464721 ATGGCCAGGCTGGGGGTGCCAGG - Intronic
1160397924 18:78585400-78585422 ATGGACAAACTGGGGTTTGCAGG - Intergenic
1160515679 18:79478125-79478147 AGGGAGCACCTGGGGGTGGGCGG - Intronic
1160749934 19:729035-729057 ATGGACATGCTGGGCGTGGGTGG + Intronic
1160760857 19:783498-783520 ACCCAGAAGCTCGGGGTGGCAGG + Intergenic
1161128527 19:2574128-2574150 CGGGAGATGGTGGGGGTGGCTGG - Intronic
1161381047 19:3965033-3965055 AGGGAGTAAGTGGGGGTGGCTGG + Intronic
1161399848 19:4062372-4062394 TCGGAGCAGCTGGGGGAGGCTGG + Intronic
1161429988 19:4225988-4226010 AGGGAGAGGCTGGGGGTAGGGGG - Intergenic
1161502239 19:4622780-4622802 CTGGAGAAGGTGGGAGAGGCTGG + Intergenic
1161606409 19:5217119-5217141 AAGGAGAAGCTGGGGGAGCAGGG + Intronic
1161768920 19:6221038-6221060 ATGGAGGTGGTGGGGCTGGCTGG - Intronic
1161852224 19:6743590-6743612 GTGGAGAAGGTGTGTGTGGCGGG + Exonic
1162043120 19:7982264-7982286 ATGGATAAGCTGCGGGAGACGGG - Intronic
1162327176 19:10006239-10006261 AGAGAGAAGCCGGGGGTGTCAGG + Intronic
1163202315 19:15777968-15777990 GTGGAGAAGGTGGGGATGCCAGG + Intergenic
1163428011 19:17249803-17249825 AGGGAGATGCTGGGTTTGGCTGG - Exonic
1163547682 19:17949329-17949351 AAGGAGAAGGTGCGGGTGTCTGG - Intergenic
1163715434 19:18870012-18870034 GTGGAGGAGCTGGGGGTCGCCGG - Exonic
1164526828 19:29019036-29019058 ATGGAGTTCCTGGGGGTGCCTGG + Intergenic
1165256675 19:34580459-34580481 GTGGAGGAGCTGGGGCAGGCAGG + Intergenic
1165265909 19:34663930-34663952 GTGGAGGAGCTGGGGCAGGCAGG - Intronic
1165273544 19:34730947-34730969 GTGGAGGAGCTGGGGCAGGCAGG - Intergenic
1165284148 19:34825349-34825371 AGGGAGAAACTGGGGAAGGCTGG - Intergenic
1165850903 19:38849851-38849873 ATGGTGAAGATGGCGGCGGCGGG - Exonic
1166114000 19:40641580-40641602 ATGGAGAATCTGGGAGGCGCAGG + Intergenic
1166384956 19:42375815-42375837 GTGGTGGGGCTGGGGGTGGCTGG - Exonic
1166559277 19:43720960-43720982 ATGGAGGGGTAGGGGGTGGCAGG + Intergenic
1166631354 19:44410457-44410479 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1167019176 19:46861312-46861334 ATGGAGGAGCTGGAGGGGGAGGG + Intergenic
1167714098 19:51129932-51129954 GGGCAGAAGCTGGGGGAGGCTGG - Intronic
1168148995 19:54435050-54435072 AAGGCGGAGCTGGCGGTGGCTGG + Intronic
1168321317 19:55511723-55511745 CTGGAGAAGCTGGCAGGGGCTGG + Intronic
1168423006 19:56217529-56217551 CTGGAGGAGCTCAGGGTGGCCGG - Intergenic
1168480146 19:56713291-56713313 ATGGAGAAGGTGTGGGTTCCTGG + Intergenic
1202648894 1_KI270706v1_random:163157-163179 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1202649372 1_KI270706v1_random:166431-166453 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
925050195 2:807418-807440 ATGGAGACAGTGGGGGTGGTGGG + Intergenic
925119823 2:1409625-1409647 ATGGAAAAGCTGGGGATACCAGG - Intronic
925292345 2:2756154-2756176 AGGCAGAAGCTGAGGGTGGCAGG - Intergenic
925332803 2:3071824-3071846 ATGGGGAAAGTGGGGGCGGCTGG - Intergenic
925611270 2:5705452-5705474 GTGGAGAAGCTGGGGGTACCAGG + Intergenic
925714607 2:6772695-6772717 TTGGGGAAGATGGGGGAGGCGGG - Intergenic
925894416 2:8460322-8460344 ATGGAGCAGCGGGGGGTGGAGGG - Intergenic
926018450 2:9474546-9474568 ATGGAGCAGCCGGGCGGGGCGGG - Exonic
927156730 2:20225133-20225155 CTGGCGGAGCTGGGGGTGGGGGG - Intronic
928117634 2:28558594-28558616 ATGGTGTAGCTGTGGATGGCTGG + Intronic
929623649 2:43384008-43384030 ATAGAGAAGCTGGGGTAGGGGGG - Intronic
929925199 2:46201816-46201838 CTGAAGAAGGTGGGGGTGGAGGG + Intergenic
930491848 2:52083688-52083710 CTGAAGAAGGTGGGGGTGGGAGG - Intergenic
930845653 2:55900712-55900734 ATGGGGAAACTGGATGTGGCTGG + Intronic
931740132 2:65234724-65234746 TAAGAGAAGCTGGAGGTGGCAGG - Intronic
932417907 2:71584739-71584761 GGGGAGAAGCTGGGAGAGGCTGG + Intronic
933757668 2:85652836-85652858 ATGGATAAACTGGGGGTAGGAGG - Intergenic
933948566 2:87308938-87308960 GGGGACAGGCTGGGGGTGGCGGG + Intergenic
934563948 2:95328158-95328180 CTGGGGAAGCTGGTGGGGGCTGG - Intronic
935698527 2:105790477-105790499 ATGGGGCAGGCGGGGGTGGCCGG - Intronic
936121655 2:109751415-109751437 ATGGCAATGCTGGAGGTGGCAGG - Intergenic
936223042 2:110620059-110620081 ATGGCAATGCTGGAGGTGGCAGG + Intergenic
936331633 2:111552657-111552679 GGGGACAGGCTGGGGGTGGCGGG - Intergenic
938537092 2:132256291-132256313 AGGGAGCAGCTTGGGGTGGTGGG + Intronic
938540798 2:132282138-132282160 AGGGAGAAGCTGGGTGAGACAGG + Intergenic
938541628 2:132288041-132288063 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
940145644 2:150542440-150542462 ATGGGGACGGTGGGGGGGGCGGG + Intergenic
940463288 2:153995811-153995833 AGGGAGAAGGTGGGAGTGGTAGG - Intronic
940905012 2:159161082-159161104 ATGGAGCAGCTGAGGATGGCTGG - Intronic
941064239 2:160882956-160882978 AAGGAGCAGCTGGGGGTAGAGGG + Intergenic
942446272 2:176080753-176080775 GTGTAGAAGCTGGGGTCGGCTGG + Exonic
942536569 2:176970502-176970524 AAGGAGACCATGGGGGTGGCAGG - Intergenic
946352126 2:219162047-219162069 GTGGAGAGGCTGGGGGATGCAGG + Exonic
946835071 2:223764316-223764338 AAGAAGAATCTAGGGGTGGCAGG + Intronic
946860425 2:223996064-223996086 ACGGAGGAGCTGGGGCTGACAGG + Intronic
947492016 2:230603330-230603352 AGGGATTAGGTGGGGGTGGCTGG + Intergenic
947795391 2:232890994-232891016 AGGGAGGAGCTGGTGGGGGCAGG - Intronic
948183474 2:236001135-236001157 ATGGAGACTCTGGCGGTGGCTGG + Intronic
948253578 2:236550300-236550322 TGGGAGATGTTGGGGGTGGCAGG + Intergenic
948641001 2:239375885-239375907 CTGGAGAAGAGGGGGGTGCCTGG + Intronic
948872714 2:240811792-240811814 GCCGAGAAGCTGGTGGTGGCAGG + Intronic
948906643 2:240982830-240982852 CTGGAGACACTGGGGGTGGGAGG - Intronic
948958732 2:241315680-241315702 ATATAGAGGCTGGGGGTGGGGGG - Intronic
1168805099 20:667964-667986 TTGGAGGAGCTGGGAGTGGAGGG - Intronic
1169206003 20:3740727-3740749 ATGGAGAACCTTTGGGTGCCTGG + Intronic
1170117584 20:12877124-12877146 ATGGAAAAGCAGGGGATGGAGGG + Intergenic
1170143400 20:13147561-13147583 ATAGAGAAGCAGGGAGGGGCAGG + Intronic
1170431239 20:16278803-16278825 ACTGAGAAGCAGGGGATGGCGGG - Intronic
1170924157 20:20707739-20707761 AAGCAGAAGCTGAGGCTGGCTGG - Intronic
1171170962 20:23015080-23015102 CTGCAGAGCCTGGGGGTGGCAGG + Intergenic
1171359049 20:24573827-24573849 GTGGAGGAACTGGGGGTTGCTGG - Intronic
1171768390 20:29302153-29302175 AGGGATAAGCTGGGGGGGGAAGG + Intergenic
1171866005 20:30488070-30488092 AGGGAGCAGCTCGGGGTGGTGGG + Intergenic
1171869706 20:30515139-30515161 AGGGAGAAGCTGGGTGAGACAGG + Intergenic
1171870493 20:30520917-30520939 AGGGAGAAGCTGGGTGAGACAGG + Intergenic
1172027753 20:31960642-31960664 ATGGAGAGGCTATGGGTGGTGGG + Intergenic
1172185996 20:33031425-33031447 ATGAGCTAGCTGGGGGTGGCTGG + Intergenic
1172328209 20:34054019-34054041 AGTGAGAAGCTGGGGGTCACTGG - Intronic
1172638791 20:36428485-36428507 TTGGAGAAGCTGGTGGAAGCTGG + Intronic
1172699757 20:36845825-36845847 CTGAAGGAGCTGGGGGTGGGGGG + Intronic
1172930340 20:38582011-38582033 TGGAGGAAGCTGGGGGTGGCTGG + Intronic
1173374717 20:42473063-42473085 ATGGATAAACTGGGTGTTGCGGG - Intronic
1173663522 20:44750311-44750333 ACGGAGAACCTGGTGGTGGCCGG + Exonic
1173707658 20:45124336-45124358 ATGGTGGAGCTGGGTGGGGCTGG - Intronic
1173832433 20:46099770-46099792 CTGGAGGAGCTCAGGGTGGCCGG + Intergenic
1175141644 20:56865060-56865082 ATGGAAAAGCAGGGGGAGGCTGG + Intergenic
1175328746 20:58148186-58148208 AAGGAGAGGCTGTGGATGGCCGG - Intergenic
1175496724 20:59419625-59419647 TTGAAGAAGCTGGGGCTGTCTGG - Intergenic
1175503165 20:59464499-59464521 GTGAAGAAGCTGCAGGTGGCTGG - Intergenic
1175661974 20:60821243-60821265 ATGGGGAAGCTGAGGGATGCGGG + Intergenic
1175935598 20:62512546-62512568 AAGGAGCAGCAGGGGGTGGGTGG - Intergenic
1176007598 20:62874993-62875015 ATGAAGAAAATGGGGGTGGGGGG - Intergenic
1176288921 21:5034020-5034042 AGAGAGAAGCTGGCGGTGCCCGG - Intronic
1176304025 21:5114144-5114166 GTGGAGGAGCTGGGAGTGGTGGG + Intergenic
1176304038 21:5114184-5114206 GTGGAGGAGCTGGGAGTGGTGGG + Intergenic
1176304050 21:5114224-5114246 ATGGAGCAGCTGGGAGTGGTGGG + Intergenic
1176304063 21:5114264-5114286 GTGGAGGAGCTGGGAGTGGTGGG + Intergenic
1176304076 21:5114304-5114326 GTGGAGGAGCTGGGAGTGGTGGG + Intergenic
1176304088 21:5114344-5114366 GTGGAGCAGCTGGGAGTGGTGGG + Intergenic
1176308943 21:5139629-5139651 ATGGAGAAGCTGCAGGAGCCTGG + Intronic
1176602449 21:8806115-8806137 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1176602928 21:8809384-8809406 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1176611894 21:8991218-8991240 AGGGAGAAGCTGGCTGAGGCAGG - Intergenic
1178292493 21:31380926-31380948 ATAGAGAAGCTGGGGCTTGGGGG - Intronic
1179502565 21:41819469-41819491 GTGGGGAAGGTGGGTGTGGCGGG - Intronic
1179848118 21:44122404-44122426 ATGGAGAAGCTGCAGGAGCCTGG - Intronic
1179852968 21:44147686-44147708 GTGGAGGAGCTGGGAGTGGTGGG - Intergenic
1179852981 21:44147726-44147748 GTGGAGCAGCTGGGAGTGGTGGG - Intergenic
1179852993 21:44147766-44147788 GTGGAGGAGCTGGGAGTGGTGGG - Intergenic
1179853006 21:44147806-44147828 GTGGAGGAGCTGGGAGTGGTAGG - Intergenic
1179868313 21:44229584-44229606 AGAGAGAAGCTGGCGGTGCCCGG + Intronic
1179882687 21:44300121-44300143 CTGGAGAAGCTGCGGGCGTCGGG + Exonic
1179909468 21:44440410-44440432 GGGGAGGAGCTGGGGGTGACTGG - Intronic
1179929426 21:44557599-44557621 CTGGAGACGCTGAGGCTGGCAGG + Intronic
1179936857 21:44611581-44611603 ATGGAACAGGTAGGGGTGGCAGG + Intronic
1180344734 22:11697668-11697690 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1180345214 22:11700941-11700963 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1180352557 22:11816662-11816684 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1180352994 22:11819182-11819204 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1180385698 22:12175695-12175717 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1180730801 22:17980707-17980729 CTGGAGAAAGTGGGTGTGGCTGG - Intronic
1180831934 22:18910981-18911003 CTGGAGAAGGCGGGGGTGGCTGG + Exonic
1181035812 22:20169332-20169354 GTGGAGCAGCCGGTGGTGGCTGG + Intergenic
1181067911 22:20315361-20315383 CTGGAGAAGGCGGGGGTGGCTGG - Exonic
1181797637 22:25321444-25321466 CAGGAGAGGCTGGGTGTGGCTGG - Intergenic
1182451151 22:30422675-30422697 ACAGCGAAGCTGGGGGTGGCGGG + Exonic
1182619093 22:31608665-31608687 ATGGAGGAGCTTGGGGTGGTTGG + Intronic
1182890863 22:33817887-33817909 ATGGAGAAGCTGAAGGAGGGAGG + Intronic
1183093444 22:35539063-35539085 ATGGGGCAGGTGGGGGTGGAGGG - Intergenic
1183329639 22:37212395-37212417 AAGGAGAATGAGGGGGTGGCAGG + Intergenic
1183390351 22:37542163-37542185 ATGGCAAAGTTGGGGGTGGCAGG - Intergenic
1183978933 22:41528452-41528474 AAGGAGAAGGTGGGTGTGGGTGG - Exonic
1184141120 22:42577883-42577905 AAGGAGAAGCTGGAGCTGGCTGG - Intergenic
1184149228 22:42628845-42628867 ATGGAGAAGGGGAAGGTGGCTGG + Intronic
1184212496 22:43044110-43044132 AGGGAGAAGATGGGGGTGGGTGG - Intronic
1184513031 22:44944092-44944114 ATGGAGAAACTGAGGCTTGCGGG - Intronic
1184585841 22:45447616-45447638 ATGGAGAAGCTGGAGGAGAAGGG - Intergenic
1184626706 22:45739130-45739152 ATGAAGAAGGTGGGGCAGGCAGG + Intronic
1184643898 22:45885867-45885889 CTGGGGGAGCTGGGGGTGTCAGG + Intergenic
1185411334 22:50684495-50684517 AAGGAGCAGCTGGGGCTGGCTGG + Intergenic
1203282012 22_KI270734v1_random:136252-136274 CTGGAGAAGGCGGGGGTGGCTGG + Intergenic
950143714 3:10633054-10633076 AAGGAGATGCAGGGGCTGGCTGG + Intronic
950335169 3:12187559-12187581 GTGGAGCAGCCAGGGGTGGCTGG - Exonic
950365428 3:12480248-12480270 AGGGAGGAGCTGGGCCTGGCCGG - Intergenic
950525909 3:13523174-13523196 AGGGGGAAGCTGGGCGGGGCTGG - Intergenic
951675071 3:25229857-25229879 ATGGATGAGCTGGGTGTGACAGG + Intronic
952830204 3:37558451-37558473 ATAGAGAAGCAAGGGGTGGGAGG - Intronic
953183759 3:40619851-40619873 AAGGAGGAGGTGGGTGTGGCAGG - Intergenic
953313815 3:41907162-41907184 CTGGAGAAACATGGGGTGGCGGG + Intronic
954005619 3:47588211-47588233 AAGGAGCAGCTGAGGCTGGCGGG + Exonic
954411391 3:50372763-50372785 ACAGAGAAGGTGGGGGAGGCAGG + Intronic
954692697 3:52404161-52404183 ATGGAGGAGATGTGGGTGGTGGG - Intronic
954954083 3:54503702-54503724 GTTGAGAAGCAGGGGCTGGCTGG + Intronic
955560881 3:60189224-60189246 ATTTAGAAGCTGGGGGTGGGGGG + Intronic
956020401 3:64927760-64927782 ATGGTGCAGGTGGGGGTGGGAGG - Intergenic
959369880 3:105510135-105510157 AGGAAGAAGATGGGGGTGGTCGG + Intronic
959919029 3:111850294-111850316 AGGGAGAAGGTGAGGGGGGCAGG + Intronic
960260592 3:115563889-115563911 AGAGAAAAGCTGGGGGTGGGGGG - Intergenic
960425916 3:117507787-117507809 ACCTAGAAGCTGGGGGTGGTGGG + Intergenic
960696625 3:120402702-120402724 ATGGAGAAGAGGGCGGTGGCTGG - Intronic
960699456 3:120426344-120426366 CTTGGGAAGCTGGGGGTGGGTGG - Intronic
961236832 3:125374926-125374948 AGGGAAACGCTGGGGCTGGCTGG - Intronic
961521719 3:127470956-127470978 ATTGAGAGGCTGGGGATGGTGGG - Intergenic
962387740 3:134946360-134946382 CATAAGAAGCTGGGGGTGGCAGG - Intronic
962467019 3:135670044-135670066 ATGGTGAGGCTGGGAGTGGGAGG - Intergenic
966855832 3:184193357-184193379 ATGTAGAAGTTGGGGCTGGAAGG - Exonic
966920981 3:184611187-184611209 ATAGAGATGCTGATGGTGGCGGG - Intronic
967115231 3:186331614-186331636 GTGGGGGAGCTGGGAGTGGCTGG + Intronic
967272447 3:187742634-187742656 ATTTATAAGCTTGGGGTGGCGGG + Intronic
967923276 3:194628500-194628522 ATAGAGAAGCCTGGGGTGACAGG + Exonic
968558264 4:1261430-1261452 AGGAAGAAGCCTGGGGTGGCGGG + Intergenic
968936532 4:3614039-3614061 CTGGAGAAGCTGAGGATGGGAGG - Intergenic
968974407 4:3813609-3813631 CTGGAGAGGATGGAGGTGGCAGG + Intergenic
968978442 4:3834059-3834081 GTGGAGAAGGTGTGGGAGGCAGG - Intergenic
969331364 4:6474937-6474959 ACAGAGAGGCTGGGGGTGGCAGG - Intronic
969719997 4:8888305-8888327 AGGGAGAAGCCTGGGGCGGCCGG + Intergenic
969967438 4:11011753-11011775 GGGGAGGAGCTGGGGGAGGCAGG - Intergenic
970093636 4:12437452-12437474 ATGGAGAGCCTGGGGGTGGGGGG + Intergenic
970522458 4:16899361-16899383 TTGGAGAAGAGGGAGGTGGCTGG - Intergenic
971539886 4:27802946-27802968 TTGGAGAAACTGGGGGAGGGGGG - Intergenic
973375099 4:49280976-49280998 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
973375998 4:49286998-49287020 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
973376923 4:49293161-49293183 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
973377843 4:49299316-49299338 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
973378787 4:49305596-49305618 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
973379431 4:49310058-49310080 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
973380304 4:49316054-49316076 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
973381227 4:49322220-49322242 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
973382312 4:49329265-49329287 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
973385851 4:49513877-49513899 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
975962981 4:79935297-79935319 ATGGAGAGGGTGGGGGTGGGGGG - Intronic
976413948 4:84749778-84749800 AGGGAAAAGCAGGGGGTGTCAGG - Intronic
977063423 4:92284223-92284245 ATGGAGAAGTAGGGGGTGGTAGG - Intergenic
977361502 4:96011787-96011809 CTGGAGAAGCTGGTGGTTTCTGG + Intergenic
977991471 4:103447535-103447557 CTGGAGAGGCTGGAGGAGGCAGG + Intergenic
978854667 4:113380828-113380850 ATGGAGATGGTGGGGGAGGAAGG - Intronic
979049785 4:115916221-115916243 AAGGAGGAGCTGGAGGAGGCTGG - Intergenic
979158521 4:117429244-117429266 GTGGGGAAGGTGGGGCTGGCTGG + Intergenic
980988501 4:139718376-139718398 AAGGAGAAGCAAGGGGAGGCTGG + Exonic
982279451 4:153668371-153668393 AGGCAGAAGCTGCTGGTGGCTGG + Intergenic
984939972 4:184922494-184922516 ATTGAGGGGCTGGGGGAGGCAGG + Intergenic
985046511 4:185946278-185946300 ATGTAGAAGTTGGAGGAGGCAGG + Intronic
985527160 5:411860-411882 AGGTAGAAGCTGGGGGTGAGGGG - Intronic
985534525 5:456564-456586 AGGGTGAAGCTGGGGTTGGAGGG + Intronic
985635931 5:1035906-1035928 AGGCAGTGGCTGGGGGTGGCTGG + Intronic
985673967 5:1220811-1220833 AAGGAGAGGCTGGGGGTGTCTGG + Intronic
986253325 5:6081269-6081291 ATGGAGAGGCTGGGAGGCGCAGG - Intergenic
986788711 5:11139877-11139899 ATGTAGAAGCTGGGAAAGGCAGG - Intronic
986806796 5:11314838-11314860 ATGGGGTAGCCAGGGGTGGCTGG + Intronic
987977676 5:25035742-25035764 GAGGAGATGCTGGGGGTGGGTGG - Intergenic
988592990 5:32565190-32565212 GGGGAGAAGGTGGGGATGGCAGG + Intronic
988628325 5:32900953-32900975 ACAGAGCAGCTGGGGGTGGGAGG + Intergenic
990263850 5:54054904-54054926 ATGGAGAAGTTTGGTGTGACTGG - Intronic
992834795 5:80629751-80629773 GTGGAGAAGCTGGGTTTGGAAGG - Intronic
993086292 5:83367701-83367723 GTGGAGAAGATGGGAGAGGCTGG + Intergenic
994162071 5:96567938-96567960 ATGGAGGAGGAGAGGGTGGCAGG + Intronic
995394436 5:111672645-111672667 GTGGAGCAGCTGGGGGCGGTGGG - Intronic
997739718 5:136242983-136243005 AATGAGAATCTGGGAGTGGCCGG + Intronic
997933175 5:138088787-138088809 ATGGAGGTGCTTGGGGTGGGTGG - Intronic
998102914 5:139449166-139449188 GTGGAGCAGCTGGGGGAGGAAGG + Exonic
998612731 5:143706556-143706578 ATGTAGAGGCAGGTGGTGGCTGG + Intergenic
998664988 5:144287067-144287089 GGGGAGGAGCTGGGAGTGGCTGG + Intronic
999198976 5:149802684-149802706 ATGGGGCAGCTGGGGCTGGGAGG + Intronic
1001135695 5:169100754-169100776 ATGGAGAGGATGGAGGTGCCTGG - Intronic
1001237808 5:170044821-170044843 ATGGAGAAGCTGGGGGAGGTAGG - Intronic
1001579935 5:172791576-172791598 ATGAAGAAGCTGGGTGTGGGTGG - Intergenic
1002048178 5:176553722-176553744 AGGGAGATGGTGGTGGTGGCGGG - Intronic
1002591729 5:180295323-180295345 GTGGAGGAGCTAGGGGTGCCTGG + Intergenic
1003124653 6:3346653-3346675 ATGGTGCAGCTGGGAGTAGCTGG - Intronic
1003159457 6:3622833-3622855 ATGGAGAGGCTGGGTTTAGCCGG + Intergenic
1003660522 6:8056499-8056521 CTGGAGAAGGTGGCAGTGGCGGG - Intronic
1005417729 6:25619451-25619473 AAGGAGAAGCTGGGGCCAGCAGG + Exonic
1005605772 6:27475662-27475684 ATAGAGAAACTGGGGGAGGAGGG + Intergenic
1006563526 6:34934442-34934464 ATAAAGTACCTGGGGGTGGCTGG - Intronic
1006898463 6:37485064-37485086 ATGGGGAAGGGTGGGGTGGCTGG + Intronic
1007258818 6:40547704-40547726 ATGAGGAAGCTGGGGGTAGGAGG - Intronic
1007585435 6:42986256-42986278 GAGGAGAAGCTGGGGGAGGCTGG - Intronic
1007700027 6:43761043-43761065 ATGGAGAGGCAGGGGGTTGGTGG + Intergenic
1010116306 6:72316541-72316563 ATCAAGAAGCTGGGGATGGGAGG + Intronic
1011008083 6:82670670-82670692 ATGGTGCTGCTGGTGGTGGCGGG + Intergenic
1013213078 6:108003980-108004002 GTAGGGAGGCTGGGGGTGGCAGG - Intergenic
1013268123 6:108520337-108520359 ATGGAGTACCTGTGGGTGCCAGG + Intronic
1013872683 6:114785812-114785834 ATGTAGAAGCTGGACATGGCAGG - Intergenic
1013971798 6:116029026-116029048 ATGGAGGAGCTTGGTGTGGCTGG - Intronic
1014397349 6:120942019-120942041 ATAGAGAAGCTGGGAGAGACTGG + Intergenic
1014822798 6:126011532-126011554 ATGAAGAAGCTGGGGGTAGATGG - Intronic
1015066138 6:129031383-129031405 TTCCAGAAGCTGGGGGTGGGGGG + Intronic
1016524886 6:144990455-144990477 GTGGAGAAGCTGGGTGTAGGAGG + Intergenic
1017029589 6:150209101-150209123 ATGGAGAAACGTGGGGTGGCAGG - Intronic
1018054028 6:160036241-160036263 ATGGAGAAGCTGAGGGGTGCAGG - Intronic
1018163231 6:161068448-161068470 AAGGAGAAGAAGGTGGTGGCAGG + Intronic
1018883475 6:167909367-167909389 ATGGAGAAGGTGAGGATGGAGGG + Intronic
1019230317 6:170554785-170554807 ATGGAGAAGAAGCGGATGGCAGG - Intronic
1019284019 7:215299-215321 ATGGAGAGGATGGGGCTGGGTGG + Intronic
1019284038 7:215343-215365 ATGGAGAGGATGGGGCTGGGTGG + Intronic
1019284056 7:215387-215409 ATGGAGAGGATGGGGCTGGGTGG + Intronic
1019284073 7:215431-215453 ATGGAGAGGATGGGGCTGGGTGG + Intronic
1019284105 7:215517-215539 ATGGAGAGGATGGGGCTGGGTGG + Intronic
1019284123 7:215561-215583 ATGGAGAGGATGGGGCTGGGTGG + Intronic
1019284140 7:215605-215627 ATGGAGAGGATGGGGCTGGGTGG + Intronic
1019284186 7:215733-215755 ATGGAGAGGATGGGGCTGGGTGG + Intronic
1019284203 7:215777-215799 ATGGAGAGGATGGGGCTGGGTGG + Intronic
1019284221 7:215821-215843 ATGGAGAGGATGGGGCTGGGTGG + Intronic
1019284281 7:215993-216015 ATGGAGAGGATGGGGCTGGGTGG + Intronic
1019284299 7:216037-216059 ATGGAGAGGATGGGGCTGGGTGG + Intronic
1019284378 7:216257-216279 ATGGAGAGGATGGGGCTGGGTGG + Intronic
1019284396 7:216301-216323 ATGGAGAGGATGGGGCTGGGTGG + Intronic
1019284429 7:216389-216411 ATGGAGAGGATGGGGCTGGGTGG + Intronic
1019284449 7:216433-216455 ATGGAGAGGATGGGGCTGGGTGG + Intronic
1019336359 7:484816-484838 TTCGAGAAGGTGGGGGAGGCGGG + Intergenic
1019340036 7:504602-504624 CTGCAGAGGCTGGGGGTGGGTGG - Intronic
1019373184 7:674209-674231 TTGGAGTAGCTGGGTGTGGCTGG - Intronic
1019373193 7:674256-674278 CTAGAGTAGCTGGGTGTGGCTGG - Intronic
1019373206 7:674351-674373 CTAGAGTAGCTGGGTGTGGCTGG - Intronic
1019373211 7:674389-674411 ATGGAGTAGCTGGGCATGACTGG - Intronic
1019373251 7:674643-674665 CTAGAGTAGCTGGGTGTGGCTGG - Intronic
1021550652 7:21867941-21867963 ATGAAGAATATGGGGGTGGCTGG - Exonic
1021922302 7:25497531-25497553 TGGAAGAAGCTGGGAGTGGCAGG - Intergenic
1022317876 7:29262768-29262790 ATGGTGAAGATGGGGGTGCAGGG + Intronic
1022499641 7:30874417-30874439 ATGGAGAAACTGGGGCTCACAGG - Intronic
1024174788 7:46827875-46827897 AGGGAGAATCTGGTGGTGGGTGG - Intergenic
1024653726 7:51431423-51431445 AGGGAGAAGCTGGGGGATGGGGG + Intergenic
1024849648 7:53696463-53696485 AGGGAGAAGCTGGGAGAGGAGGG + Intergenic
1027139682 7:75648311-75648333 TTGGAGTAGCTGGGGCTGGTTGG + Intronic
1027432922 7:78132940-78132962 ATGGGGCTGTTGGGGGTGGCTGG + Exonic
1027877315 7:83787402-83787424 ATGAAGAGGATGGTGGTGGCTGG + Intergenic
1029969603 7:104776447-104776469 AAGGAGAAGCTGGCTGTGGGGGG - Intronic
1032585201 7:133139988-133140010 AAAGAGAAGGTGGGGCTGGCTGG - Intergenic
1032844673 7:135742210-135742232 CTGGAGAGGCTGGAGGTGGTGGG + Intronic
1033013794 7:137650967-137650989 ATGTGGGAGCTGGAGGTGGCTGG + Intronic
1033595227 7:142854552-142854574 AAGGAAAAGCAGGGGGTGGAGGG - Intergenic
1034959347 7:155355358-155355380 ATGCAGAAGATGGGAGGGGCTGG + Intergenic
1035328664 7:158082457-158082479 ATGGAGGAGCTGGCCCTGGCTGG - Intronic
1035560163 8:598299-598321 AGAAAGAAGATGGGGGTGGCCGG + Intergenic
1036596902 8:10221368-10221390 ATGGAAAAGCTGGGTGGTGCTGG - Intronic
1036599769 8:10249622-10249644 GTGCAGAAGCTGGTGGTGGGTGG - Intronic
1036644132 8:10601519-10601541 ATGGATAAGCCTGGGATGGCTGG + Intergenic
1038933843 8:32225565-32225587 ATGGAGCATTTGGGGGTGCCAGG + Intronic
1039468839 8:37801419-37801441 AGGGAGAACCTGGGTGTGGGAGG + Intronic
1040393889 8:46976123-46976145 ATGGAGACGCAGCGGGTGGAAGG + Intergenic
1040510021 8:48085070-48085092 AAGGAGAAGCTGGGTGAGGCTGG + Intergenic
1043577003 8:81669417-81669439 ATGGAGACACTGGGGGTTGAGGG - Intronic
1044755180 8:95454162-95454184 ATGTAGGAGTTGGGGGTGGAAGG - Intergenic
1045539241 8:103066850-103066872 ATGGCGTAGCTGGGCGTGGTGGG + Intronic
1045689926 8:104749779-104749801 AGTGAGAAGCTTGGTGTGGCTGG + Intronic
1046106391 8:109672216-109672238 ATTTAAAAGCTGGGGGTGGCTGG + Intronic
1046875623 8:119251731-119251753 ATTGAGCAGCTCTGGGTGGCTGG + Intergenic
1047216916 8:122883325-122883347 ATGGAGGAGATGGAGGTGGGCGG + Intronic
1047448093 8:124937751-124937773 ATGGAGAAGCCGGGCTTGGCTGG - Intergenic
1047547002 8:125827942-125827964 AAGGAGAAGTTGGTGGTGGTTGG + Intergenic
1047698422 8:127426800-127426822 AGGGAGGAGCTGGGGGAGGAGGG - Intergenic
1048807655 8:138255503-138255525 GGAGAGAAGCTGAGGGTGGCTGG + Intronic
1048982603 8:139711041-139711063 ATGGAGAAGCTGGGGATGCTGGG - Intergenic
1049102219 8:140588009-140588031 ATGGAGGAGATGGGGGAGGATGG - Intronic
1049416981 8:142499761-142499783 ATGGAATAGCTGGGGGTAGCGGG + Intronic
1049419482 8:142510580-142510602 CCGGAGGAGCTGGGGGCGGCGGG + Intronic
1049583162 8:143421786-143421808 AGGGAGAAGCTGGGGATGGGTGG + Intronic
1049724595 8:144139802-144139824 GTGCAGAAGGTGGAGGTGGCAGG + Exonic
1050331997 9:4555086-4555108 ATGGAGAAGCTGAGTCTGGGAGG + Intronic
1050967859 9:11831435-11831457 ATGGAGGTGTTGGGGGTGGGGGG + Intergenic
1051106583 9:13587667-13587689 ATGGAGCAGAAGGGGGTGGATGG - Intergenic
1051250050 9:15150459-15150481 AGGGAGAAGGTGAGTGTGGCTGG + Intergenic
1051372438 9:16370064-16370086 CTGGAGAAGCTGGGAATGGGTGG + Intergenic
1051628657 9:19122829-19122851 ATGGACCAGCAGGGGGTGGGTGG - Intronic
1051846403 9:21455867-21455889 AAGGAGAAGCTGGGGGCAGTGGG + Intergenic
1052223315 9:26054197-26054219 ATGGTGAAGATGGAGGTGGAGGG - Intergenic
1053146885 9:35718113-35718135 GTAAAGAAGCTGGGGGTGGAGGG - Intronic
1053290259 9:36875107-36875129 ATGGGGAAGCAGTGGGAGGCTGG - Intronic
1055200072 9:73648544-73648566 ATGGAGAAGGAGGTGGAGGCAGG + Intergenic
1055481984 9:76717686-76717708 ATGCAGAAGGTGTGTGTGGCTGG - Intronic
1056775932 9:89512613-89512635 AAGGAGAAGCTTGGGGTGGAGGG - Intergenic
1056933878 9:90900776-90900798 ATGGAGCAGGAGGGGGTGGGAGG - Intergenic
1056945613 9:90993380-90993402 ATGGACATGGTGGGGGTGGGGGG - Intergenic
1057130598 9:92651662-92651684 AGGGAGGAGCTGGAGGTGGAGGG - Intronic
1057279860 9:93701668-93701690 AAGGAGAGGATGGGGGTGGGGGG - Intergenic
1057488724 9:95506406-95506428 GTGGAGGAGCTGTGGGTGGAAGG - Exonic
1057724465 9:97558386-97558408 CTGGAAAAGTTGGGGGTGGGGGG + Intronic
1057777304 9:98021454-98021476 GAGAACAAGCTGGGGGTGGCGGG - Intergenic
1058986496 9:110212787-110212809 ATGCAGAAGCTGTTTGTGGCTGG - Intergenic
1059653109 9:116333856-116333878 ATGGTGATGGTGGGGGTGGAGGG - Intronic
1060035756 9:120254349-120254371 AGGGAGCGGCTGGGGGTGGGAGG - Intergenic
1060135608 9:121150406-121150428 ATGGAGAAGTTGGGGGGTGGAGG - Exonic
1060297890 9:122355508-122355530 GAGGAGAAGCTGGGAGTGGGTGG - Intergenic
1060473427 9:123967552-123967574 ATGGATGGGCTGGGGCTGGCTGG + Intergenic
1060872592 9:127054733-127054755 TTTGGGAAGCTGGGGGTGGGAGG + Intronic
1060936917 9:127521464-127521486 CTGGAGCAGCTGGGGGTGGCAGG - Intronic
1060959057 9:127666109-127666131 GTGGAGAAGCCGGAGTTGGCTGG + Intronic
1061301787 9:129709764-129709786 AGGAAGAGGCTGGGGGAGGCCGG - Intronic
1061708997 9:132474598-132474620 ATGGAGCTGCTGGGGGTTGGTGG + Intronic
1061755152 9:132807178-132807200 TGGGAGATGCTGGGGGGGGCGGG + Intronic
1061785179 9:133023501-133023523 ATGCAGCGGCTGGGGTTGGCAGG + Intergenic
1061914606 9:133742924-133742946 AAGGAGATGCTGGTGCTGGCTGG + Intergenic
1062062131 9:134502381-134502403 AGGGAGAAGCTGGGGTTGGGGGG - Intergenic
1203698817 Un_GL000214v1:119225-119247 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203699773 Un_GL000214v1:125523-125545 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203479507 Un_GL000224v1:113-135 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203480473 Un_GL000224v1:6409-6431 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203481440 Un_GL000224v1:12737-12759 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203482404 Un_GL000224v1:19046-19068 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203548993 Un_KI270743v1:152910-152932 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203549457 Un_KI270743v1:155639-155661 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1203550415 Un_KI270743v1:161951-161973 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1203569112 Un_KI270744v1:115471-115493 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203570061 Un_KI270744v1:121760-121782 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1185480973 X:445996-446018 AGGGAGTAGCTGGGGGAGTCAGG + Intergenic
1186038273 X:5448075-5448097 ATGGAGATGCTGGACATGGCAGG + Intergenic
1187069781 X:15877145-15877167 ATGGAGAAGTTGGAAGGGGCAGG + Intergenic
1187282461 X:17868241-17868263 ATGGACACGCTGAGGGTGGTAGG - Intergenic
1187383208 X:18824143-18824165 TTTGAAAAGCTGGGAGTGGCCGG + Intronic
1189018506 X:37309505-37309527 GTGGAGGGGTTGGGGGTGGCGGG - Intergenic
1189563067 X:42210670-42210692 GTAAAGAAGCTGGGTGTGGCCGG - Intergenic
1190777899 X:53568806-53568828 CTGTAGAAGCTGGAGGTGGAGGG + Exonic
1192191886 X:68996078-68996100 GTGGAGAAGCTGGGGCAGGGCGG + Intergenic
1192238823 X:69313889-69313911 ATTCAGGAGCTGGGGCTGGCAGG - Intergenic
1192705447 X:73524968-73524990 ATGGGAAAGCTGGGAGTAGCTGG + Intergenic
1192879988 X:75273836-75273858 CAGGAAAAACTGGGGGTGGCAGG - Intergenic
1193750973 X:85343029-85343051 TTGAAAAAGCTGGGGGTGGGGGG + Intronic
1194767621 X:97860448-97860470 AGGAAGAAGCTGAGGGAGGCTGG + Intergenic
1195716741 X:107825913-107825935 CTGGGGGAGCTGGGAGTGGCGGG + Exonic
1196868171 X:120087895-120087917 CCAGAGCAGCTGGGGGTGGCAGG - Intergenic
1198117237 X:133555970-133555992 AGGAGGAATCTGGGGGTGGCTGG - Intronic
1199428715 X:147734108-147734130 TTGGAAAGGCTGGGGTTGGCTGG - Intergenic
1200259031 X:154602250-154602272 ATGGAGGGGCTGGGGGAGGCTGG + Intergenic