ID: 1089498529

View in Genome Browser
Species Human (GRCh38)
Location 11:118919680-118919702
Sequence GGTCTGGGAGGAACACAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 393
Summary {0: 1, 1: 0, 2: 3, 3: 27, 4: 362}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089498529_1089498544 15 Left 1089498529 11:118919680-118919702 CCAGCCTGTGTTCCTCCCAGACC 0: 1
1: 0
2: 3
3: 27
4: 362
Right 1089498544 11:118919718-118919740 TGGGGAGGAGACCTTCGGCTGGG 0: 1
1: 0
2: 0
3: 17
4: 167
1089498529_1089498543 14 Left 1089498529 11:118919680-118919702 CCAGCCTGTGTTCCTCCCAGACC 0: 1
1: 0
2: 3
3: 27
4: 362
Right 1089498543 11:118919717-118919739 CTGGGGAGGAGACCTTCGGCTGG 0: 1
1: 0
2: 0
3: 15
4: 159
1089498529_1089498539 -3 Left 1089498529 11:118919680-118919702 CCAGCCTGTGTTCCTCCCAGACC 0: 1
1: 0
2: 3
3: 27
4: 362
Right 1089498539 11:118919700-118919722 ACCTGAGATGGGGTCTGCTGGGG 0: 1
1: 0
2: 3
3: 23
4: 264
1089498529_1089498542 10 Left 1089498529 11:118919680-118919702 CCAGCCTGTGTTCCTCCCAGACC 0: 1
1: 0
2: 3
3: 27
4: 362
Right 1089498542 11:118919713-118919735 TCTGCTGGGGAGGAGACCTTCGG 0: 1
1: 0
2: 1
3: 24
4: 242
1089498529_1089498537 -5 Left 1089498529 11:118919680-118919702 CCAGCCTGTGTTCCTCCCAGACC 0: 1
1: 0
2: 3
3: 27
4: 362
Right 1089498537 11:118919698-118919720 AGACCTGAGATGGGGTCTGCTGG 0: 1
1: 0
2: 1
3: 27
4: 237
1089498529_1089498538 -4 Left 1089498529 11:118919680-118919702 CCAGCCTGTGTTCCTCCCAGACC 0: 1
1: 0
2: 3
3: 27
4: 362
Right 1089498538 11:118919699-118919721 GACCTGAGATGGGGTCTGCTGGG 0: 1
1: 0
2: 3
3: 18
4: 246
1089498529_1089498541 0 Left 1089498529 11:118919680-118919702 CCAGCCTGTGTTCCTCCCAGACC 0: 1
1: 0
2: 3
3: 27
4: 362
Right 1089498541 11:118919703-118919725 TGAGATGGGGTCTGCTGGGGAGG 0: 1
1: 0
2: 2
3: 44
4: 494

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089498529 Original CRISPR GGTCTGGGAGGAACACAGGC TGG (reversed) Intronic
900502894 1:3015299-3015321 TGCCCTGGAGGAACACAGGCAGG - Intergenic
902067328 1:13699519-13699541 AGTCGGGGAGAAGCACAGGCTGG - Intergenic
902216027 1:14935055-14935077 GGCCTGGAAGGAGCACAGGAAGG - Intronic
903860233 1:26360428-26360450 GGCCTGGGGCGAACAGAGGCGGG + Intergenic
903998454 1:27322919-27322941 GGTCTGGGAGGCAGACAACCTGG - Intronic
904463275 1:30693037-30693059 GGGCTGGGAGGAGCGGAGGCCGG - Intergenic
905253562 1:36665534-36665556 TCTTTTGGAGGAACACAGGCAGG + Intergenic
905328593 1:37176012-37176034 AGTCAGGGAGTGACACAGGCTGG - Intergenic
905863203 1:41363564-41363586 TGTGGGGCAGGAACACAGGCTGG + Intronic
905864916 1:41371452-41371474 AGTCTTGGAGGCAAACAGGCGGG + Intronic
905936793 1:41830741-41830763 GGGGTGGGAGGGACACAGGGTGG - Intronic
906212936 1:44022234-44022256 GGACTGGGAGGAGGGCAGGCAGG - Intronic
906475230 1:46165089-46165111 GGTCTGGGGGAAACAAAGGGAGG - Intronic
906476252 1:46171488-46171510 GGTGAGGAAGGAACAGAGGCCGG + Intronic
906581738 1:46940778-46940800 GGTCTGTGAAGAATACAGGCAGG - Intronic
906601978 1:47138120-47138142 GGTCTGTGAAGAATACAGGCAGG + Intronic
906634750 1:47401832-47401854 GCTCTGGGAGGAAAAGATGCTGG + Intergenic
907305134 1:53509091-53509113 GGACTGGGAGCCACGCAGGCAGG + Intronic
910209437 1:84778190-84778212 AGTCTGGGAAGCACACAGGGTGG + Intergenic
910295237 1:85637565-85637587 AGTTGGGTAGGAACACAGGCTGG - Intergenic
912336219 1:108865651-108865673 GGTGTGGTAGGAAGACAGGTTGG - Intronic
912845987 1:113074919-113074941 GGTCGGGGAGGAAGAGGGGCCGG + Intronic
913168650 1:116212225-116212247 GGTGTGGCAGAAACACAGCCAGG + Intergenic
915135871 1:153731087-153731109 GGTCTGATAGGAAAACAGGTTGG + Intronic
915475220 1:156149248-156149270 ATTCGGGGAGGAGCACAGGCAGG - Intronic
915580787 1:156812045-156812067 GTTCTAGGAGGAACACATCCAGG - Intronic
916395426 1:164381733-164381755 GGTCTGGGAGAAAGACTGCCAGG - Intergenic
916656222 1:166877694-166877716 GGTGTGTGAGGTACACAGGTAGG - Intergenic
916739120 1:167632620-167632642 GGTTTGGGAGGGACGCAGGGAGG + Intronic
916770068 1:167899239-167899261 CCTCTGGGAGGAGCCCAGGCTGG - Intronic
919930392 1:202217517-202217539 GGGCTGGGAGGGATAAAGGCAGG - Intronic
920418124 1:205812477-205812499 GGCCTGCCAGGAACACAGGAGGG - Intronic
920838956 1:209537768-209537790 GGTATGAGTGGAACACAGGATGG - Intergenic
922822781 1:228495312-228495334 GGTCAGAGAGGAACCCAGTCAGG + Exonic
923356464 1:233160802-233160824 TGTCTGGAAGGACCACAGCCAGG + Intronic
923468632 1:234270244-234270266 GGTGTGGGAGGAATTGAGGCAGG - Intronic
923473626 1:234313468-234313490 GGTAAGGAAGGAACACAGGCCGG - Intronic
1062874889 10:935049-935071 GGGCTGGGCTGAAGACAGGCTGG - Intergenic
1064245259 10:13662943-13662965 GTGCTGGGAGGATTACAGGCAGG - Intronic
1064995640 10:21294677-21294699 GGTCTGGAAGAAAAATAGGCTGG + Intergenic
1066043892 10:31579776-31579798 GGTGTGGGCTGAGCACAGGCTGG + Intergenic
1067556526 10:47277045-47277067 AGTCTGAGAGGAACACAGTCAGG - Intergenic
1067801797 10:49364025-49364047 GGGCTGGGAGGAACAAAGAGAGG + Intergenic
1070513022 10:77178278-77178300 GGGATGAGAGGAACACATGCCGG - Intronic
1071504792 10:86226167-86226189 GGTCTGTGCGGGAAACAGGCAGG - Intronic
1072248218 10:93561350-93561372 AGGATGGGAGGAACAGAGGCAGG + Intergenic
1073600298 10:104839892-104839914 GGTAAGGAAGGAAGACAGGCAGG + Intronic
1075859351 10:125661482-125661504 GGCCTGGGGGGAACCCTGGCAGG + Intronic
1076132775 10:128025572-128025594 GGTCTGGGAGGAGCTCAGGATGG - Intronic
1076161192 10:128245487-128245509 GGTCTGGGTGGAAATCAGGGAGG - Intergenic
1076475783 10:130750566-130750588 GACCAGGGTGGAACACAGGCAGG - Intergenic
1077158327 11:1101423-1101445 TGTCTGGGAGGATCAAAGTCTGG - Intergenic
1077164955 11:1130786-1130808 GGGCTGGCAGGAGCTCAGGCAGG - Intergenic
1077516382 11:3004423-3004445 GCTCTGGGAGGAACTGAGGAAGG - Intronic
1078413571 11:11147474-11147496 GGCCAGTGAGGAACACAGGGAGG + Intergenic
1078669019 11:13348526-13348548 GGTGTGGGAGGAAGAGAGGAAGG + Intronic
1080931690 11:36817947-36817969 GGTCAGAGAGGCCCACAGGCAGG + Intergenic
1081533512 11:43981431-43981453 GATATGGGAGGGACACAGACAGG + Intergenic
1082027643 11:47584598-47584620 GCTTTGGGGGGGACACAGGCAGG + Intergenic
1083687194 11:64383615-64383637 GGTCTGGGTTGACCCCAGGCAGG - Intergenic
1083851347 11:65369266-65369288 TGGGTGGGAGGCACACAGGCAGG + Intergenic
1084427765 11:69094881-69094903 GGCCTGGGAGGCAGGCAGGCAGG - Intergenic
1085040391 11:73323372-73323394 GGACTGGTAGGTCCACAGGCAGG + Intronic
1088031858 11:105261196-105261218 GGTATGTGAGAAACACAGGGGGG - Intergenic
1089286720 11:117412195-117412217 GGTCTGGGTGGAGGAGAGGCTGG - Exonic
1089498529 11:118919680-118919702 GGTCTGGGAGGAACACAGGCTGG - Intronic
1089634484 11:119803577-119803599 GGGCTGGGGAGGACACAGGCAGG + Intergenic
1089680761 11:120117696-120117718 GTGCTGGGAGCACCACAGGCAGG + Intronic
1090071272 11:123546596-123546618 GGTCTGGGAGTAATCAAGGCTGG + Intronic
1091308834 11:134558795-134558817 ATGCTGGGAGGAACACAGGAAGG + Intergenic
1091683953 12:2548299-2548321 GCTCTGGGAGCACCACAGGAGGG - Intronic
1092093478 12:5823032-5823054 GTTGTGGGAGGGACACAGGGTGG - Intronic
1092953483 12:13528919-13528941 GGCCAGGAAGGAACACAGGCAGG + Intergenic
1095952894 12:47791186-47791208 GGCCTGGGAGAACCACAGGGAGG + Intronic
1096073271 12:48787814-48787836 GGTCTGGGAGGCACTGAGCCTGG - Intronic
1096116384 12:49057964-49057986 GGTCTGGGAGGGAGGCAGGAAGG - Intronic
1100085163 12:90901622-90901644 GGTATGGGAGGGATACAGACTGG + Intergenic
1100328975 12:93568443-93568465 GGTCAGAGAGGTAAACAGGCTGG + Intergenic
1100384094 12:94090002-94090024 GGTCTGGGAGGGAAGCAGCCTGG - Intergenic
1100610718 12:96190205-96190227 GTTCTGGAAGGTACACAGGCAGG - Intergenic
1101850328 12:108396857-108396879 GGTCTGGTAGGAACAAGGACAGG + Intergenic
1102222515 12:111204067-111204089 GGACTGGCAGGACGACAGGCTGG - Intronic
1102346821 12:112166121-112166143 GCTCTGGGTGCAGCACAGGCTGG - Intronic
1104969165 12:132523407-132523429 GGTTTGGGAGGAGCACACGCAGG + Intronic
1106598627 13:31168760-31168782 GGCCTGGGAGAGACAGAGGCTGG - Intergenic
1108707808 13:53005958-53005980 GGTCTGAGCGGATCACAGCCAGG + Intergenic
1113406430 13:110045124-110045146 GGTCTTGGAGAAACCCAGTCCGG - Intergenic
1113750803 13:112775357-112775379 GGCATGGGATGCACACAGGCGGG + Intronic
1113807571 13:113118534-113118556 GGTCAGTGAGGACCACGGGCTGG - Exonic
1113838231 13:113343542-113343564 GGTCTGTGAGTCACACAGCCAGG + Intronic
1114463252 14:22901816-22901838 GGTCTGGGGGGTAAAGAGGCTGG + Exonic
1114590919 14:23864087-23864109 GATCTGGGAAAAACACAGGTGGG - Intergenic
1114646528 14:24259380-24259402 GGGCTGGGTGGAGCTCAGGCTGG - Intronic
1114746326 14:25151852-25151874 GGTTTTGGCGGAACTCAGGCTGG - Intergenic
1116958004 14:50943923-50943945 GGTTTGGGCGGGACACTGGCGGG + Intronic
1119641404 14:76317899-76317921 TGGATGAGAGGAACACAGGCTGG - Intronic
1119643152 14:76329739-76329761 GGGCTGGCAGGAACAACGGCAGG - Intronic
1121124697 14:91398721-91398743 GGACAGGGAGCACCACAGGCTGG + Intronic
1121859758 14:97306257-97306279 TGTCTGAGAAGCACACAGGCTGG + Intergenic
1122294464 14:100697627-100697649 GGACCGGGAGGAAACCAGGCAGG + Intergenic
1123160134 14:106270158-106270180 GGAATGAGAGGAACACAGGGAGG - Intergenic
1123179921 14:106460097-106460119 GGCCTGGGCGGAAGTCAGGCAGG + Intergenic
1124124215 15:26923698-26923720 GGTCAGGGAAGAACAGAGACAGG - Intronic
1124232280 15:27955890-27955912 GGTTTGGGAGGAAGTCAGCCAGG - Intronic
1124372173 15:29110196-29110218 GGGGTGGGAGGCACACAGGCAGG - Intronic
1125333186 15:38602145-38602167 GGACTGGGAGGAACATAGCCAGG - Intergenic
1125973926 15:43934778-43934800 GGCCTGGGAAGGACAGAGGCTGG - Intronic
1126444881 15:48731273-48731295 TGTCTGGTAAGAACACAGGAAGG - Intronic
1127360479 15:58240772-58240794 GATCTGGGAGGAAAGCCGGCTGG + Intronic
1128511063 15:68314147-68314169 GGTGAGGGAGGCAAACAGGCTGG - Intronic
1129088327 15:73121210-73121232 TGTGTGGGAGGAGGACAGGCGGG - Intronic
1130609198 15:85345286-85345308 GGTCTGGGAGGAGGAGAGGGTGG - Intergenic
1130655342 15:85788645-85788667 GATGTGGGAGGCAGACAGGCGGG - Intronic
1130994960 15:88898596-88898618 GCTCAGGGAGGACCACAGGTGGG + Intergenic
1131178672 15:90225574-90225596 GCTCTGGGAGGCATACAAGCCGG + Intronic
1131267456 15:90925478-90925500 ACTCTGAGAGGTACACAGGCAGG + Intergenic
1132018395 15:98339162-98339184 GAGCTGGGAAGAATACAGGCAGG + Intergenic
1132380062 15:101360223-101360245 GGTGGGAGAGGAACAAAGGCGGG - Intronic
1132771866 16:1567993-1568015 GGTCGGGGAGGAACAGAGGCTGG + Intronic
1133275251 16:4634377-4634399 GGTCTGGGAGGTGGGCAGGCAGG - Intronic
1133628249 16:7592473-7592495 GCACTGGGAAGAACACAGCCAGG - Intronic
1135134266 16:19876108-19876130 TGGCTGGGAGGATGACAGGCAGG + Intronic
1135532055 16:23263270-23263292 GGTATTGGAGGCAGACAGGCAGG + Intergenic
1135548747 16:23382467-23382489 GGTCTGGAAGGTAAACAAGCTGG + Intergenic
1136102189 16:28004318-28004340 GTCCTGGGAGGAACAGTGGCTGG + Intronic
1136544691 16:30948597-30948619 GGGCTGGGCGGACCAAAGGCCGG + Exonic
1136776867 16:32876645-32876667 GGTCAGGGAGGAGCAGTGGCTGG - Intergenic
1136893750 16:33984868-33984890 GGTCAGGGAGGAGCAGTGGCTGG + Intergenic
1137695612 16:50460290-50460312 GGACTGGGAGGAGCATGGGCTGG - Intergenic
1137715567 16:50596195-50596217 GGTCTGGGTGGACCAAAGTCTGG + Intronic
1138305634 16:55971997-55972019 GGTCTTGGAGGAAGACATGATGG + Intergenic
1138850477 16:60622887-60622909 GGTCTGGAGGGACCACTGGCTGG - Intergenic
1139382735 16:66543858-66543880 GGGCTGGGAGGGACCCAGGATGG - Intronic
1139546244 16:67651111-67651133 AGCCTGGGAGGAAGGCAGGCAGG + Intronic
1139593695 16:67946631-67946653 GGTCTGTGGGGAACACACCCAGG + Exonic
1140612338 16:76615765-76615787 GGGCTGGGAGGAAGAGAGACAGG + Intronic
1142029978 16:87833653-87833675 GGGATGGCAGCAACACAGGCAGG - Intronic
1142315794 16:89344141-89344163 GCTCTGGGAGGAGCACACACGGG + Intronic
1203079283 16_KI270728v1_random:1138754-1138776 GGTCAGGGAGGAGCAGTGGCTGG - Intergenic
1142500830 17:332032-332054 GCTCTGGGGGGAGCAGAGGCAGG + Intronic
1142775479 17:2134837-2134859 GGTCTGGGATGATGACAGGGAGG - Intronic
1142967747 17:3591733-3591755 GGGCAGGGAGGGCCACAGGCTGG - Intronic
1143504564 17:7356541-7356563 GGCCTGGGAGGGACAGAGGGAGG - Intronic
1144826284 17:18107490-18107512 GGGCTGGGAGGCACAGATGCAGG - Exonic
1145911161 17:28543987-28544009 TGCCTGGGAGGAAGACAGGGTGG - Intronic
1147365790 17:39958298-39958320 GGTTAGGGATGAAGACAGGCTGG - Intergenic
1147605176 17:41770341-41770363 GGTCTGGGAGTCCCACAGGTAGG + Intronic
1147760418 17:42794637-42794659 GGTCTGGGAGGGGGACGGGCAGG - Exonic
1149484022 17:57027933-57027955 GCCCTTGGAGGAACACAGCCAGG + Intergenic
1151187675 17:72375695-72375717 GGTCTGGGTGCGACGCAGGCAGG - Intergenic
1151236997 17:72727903-72727925 GACCTGGGAAGAAGACAGGCAGG - Intronic
1151369749 17:73640339-73640361 TGCCTGGGAGGAACAGAGTCAGG - Intronic
1151785222 17:76272030-76272052 AGTCTTGCTGGAACACAGGCAGG + Intergenic
1151967908 17:77441247-77441269 AGTCTGGGAGGGAAGCAGGCCGG - Intronic
1152199346 17:78936032-78936054 GCGCTGGGAGGCCCACAGGCCGG + Intergenic
1152205023 17:78970034-78970056 GGTCTGGGAGGACAACAGTGTGG - Intergenic
1152251767 17:79216203-79216225 CGCCTGGGAGGCAAACAGGCTGG - Intronic
1152356890 17:79811856-79811878 GGTCAGGGAGGGATACATGCTGG - Intergenic
1152593817 17:81228657-81228679 TGTCTGAGAGCAAGACAGGCAGG + Exonic
1152701681 17:81822776-81822798 GGTCTGCGGGGAGCCCAGGCTGG + Exonic
1152797475 17:82315278-82315300 GTGCTGGGGGGACCACAGGCGGG + Exonic
1153026899 18:680560-680582 GGGCAGGGAGAAACCCAGGCAGG - Intronic
1153348641 18:4055164-4055186 GGTCACTGAGGGACACAGGCTGG + Intronic
1154432897 18:14321976-14321998 GGTCTTGGAAGAAGACAGGAAGG + Intergenic
1155162328 18:23206134-23206156 GGGCAGGGAGGAAGGCAGGCAGG - Intronic
1155896141 18:31329384-31329406 GTTGTGTGAGGAATACAGGCAGG - Intronic
1156317507 18:35984175-35984197 ATACTGGGAGGCACACAGGCAGG - Intergenic
1157313470 18:46569734-46569756 GGTTTGTGGGGAACACACGCTGG + Intronic
1157339611 18:46767895-46767917 AGGCTGGGAGGAGCACAGGGTGG - Intergenic
1157442498 18:47721543-47721565 GGACAGGGAGGAAGACAGGGAGG + Intergenic
1157596908 18:48869684-48869706 GGCCAGGGAGGAATACAGGGTGG + Intergenic
1157684724 18:49632900-49632922 GGTGGGAGAGGACCACAGGCAGG - Intergenic
1159078508 18:63708587-63708609 AGGCTGTGAGGGACACAGGCTGG + Intronic
1160306740 18:77747273-77747295 GGTCTGGTAGGTGCACAGGTGGG - Intergenic
1160990151 19:1857112-1857134 GGGCTGGCAGGCACCCAGGCCGG - Intronic
1161241968 19:3227794-3227816 GGCCTGGGAGGAAGGCAGGGGGG - Intronic
1161245554 19:3249720-3249742 GGTCTGAGAGGACCACAAGTTGG - Intronic
1162121744 19:8474215-8474237 GATCTGGGATGAACATGGGCAGG + Exonic
1162532766 19:11245433-11245455 GTTGTGGGGGAAACACAGGCAGG - Intronic
1165142271 19:33706889-33706911 ATTGTGGGAGGACCACAGGCCGG + Intronic
1165317390 19:35065257-35065279 CAGCTGGGAGGCACACAGGCTGG - Exonic
1166249621 19:41559810-41559832 GGTCAGGCAGGAAAAGAGGCTGG + Intronic
1166299042 19:41903932-41903954 GGCCGGGGATGACCACAGGCTGG - Intronic
1166390468 19:42406447-42406469 GGGCAGGGAGGAACTCAAGCTGG + Intronic
1167028198 19:46937726-46937748 GATCTGCAGGGAACACAGGCGGG - Intronic
1167116681 19:47492722-47492744 GGTGTGGGAGGGGCACAGCCAGG + Intronic
1167379032 19:49128113-49128135 GGTCTGGGCGGGACAGGGGCGGG + Exonic
1167914056 19:52725819-52725841 GGCCTGGGTGGGACAGAGGCGGG + Intronic
1168036422 19:53723183-53723205 GGCCTGGGAGGGGCAGAGGCAGG - Intergenic
1168151664 19:54452308-54452330 GTTGTGGGAGGGACACAGTCTGG + Intronic
1168715238 19:58523127-58523149 GGGCTAGGATGAACACAGGAAGG + Intronic
925838783 2:7970989-7971011 GGACTGAGAGGACCACAGGGTGG + Intergenic
926360056 2:12078513-12078535 GGTCTGGGACAAACACACCCAGG + Intergenic
927271990 2:21221194-21221216 TATGTGGGAAGAACACAGGCTGG + Intergenic
929387532 2:41427522-41427544 GCTCTGGTAGCAACACATGCTGG - Intergenic
930961248 2:57264583-57264605 GGAGTGGGAAGAACACAGACTGG + Intergenic
931627259 2:64267873-64267895 GGGCTGGCAGGAACACAGAGTGG - Intergenic
932221925 2:70006303-70006325 GGTCTGGGAGGACCAAGGCCTGG + Intergenic
933602188 2:84344413-84344435 GTTATGGGAGGGACTCAGGCGGG + Intergenic
933804515 2:85988500-85988522 GGTCTGGCTGGAGCACAGGTGGG - Intergenic
936029764 2:109061992-109062014 GGTCTGTGAGGATGACAGGAGGG - Intergenic
936401584 2:112168654-112168676 GGTGTGGACGGGACACAGGCTGG + Intronic
936534651 2:113302709-113302731 GTTCTGGAAGGAACACATGTGGG - Intergenic
937202025 2:120209903-120209925 GGCCTGGGAGGGTCTCAGGCTGG + Intergenic
937381038 2:121376535-121376557 GGTCGGGGAGGAAAACAGGCTGG + Intronic
939500777 2:142980602-142980624 TTTCTGGGAGGAAGGCAGGCTGG + Intronic
940000189 2:148959771-148959793 CGTGGGGAAGGAACACAGGCAGG + Intronic
942940051 2:181606268-181606290 GGGGTGGGAGGAAGACAGGGAGG + Intronic
944915616 2:204357599-204357621 CGTCTGGGAGGAAGAAAGGGAGG - Intergenic
945517627 2:210782736-210782758 GCTCTGCAATGAACACAGGCTGG + Intergenic
947206651 2:227667139-227667161 GGTCTGGGAGAGAAGCAGGCAGG - Intergenic
948574517 2:238941117-238941139 GGGCTGGGCTGAGCACAGGCAGG - Intergenic
948751885 2:240137800-240137822 TGACTGGGAGGAACACAGTGCGG - Intergenic
948884819 2:240877330-240877352 GGTCTGGGAGAGACAGAGGAGGG - Intronic
948971628 2:241432363-241432385 GGTCTGGGATGAACCCAAGAAGG + Intronic
1169327299 20:4686523-4686545 GGGGTGGGAGGAACGCGGGCGGG + Intronic
1172105510 20:32514972-32514994 GGTTTGGGAGGCACGGAGGCGGG + Intronic
1173929080 20:46803616-46803638 GGTGTGGCTGGAACACAGTCAGG - Intergenic
1174868812 20:54164476-54164498 GGTCTGGCAGGACCACACTCTGG - Exonic
1175111905 20:56654375-56654397 GGTCTGCGAGGACCACCTGCTGG + Intergenic
1175287872 20:57849895-57849917 GGCCTGGGAGGAACCAGGGCTGG - Intergenic
1175521185 20:59603874-59603896 GGTGTGGGGTGAACACAGGCAGG - Intronic
1175645124 20:60664401-60664423 GGGCTCAGAGGAAAACAGGCAGG + Intergenic
1176078536 20:63260251-63260273 GAGCTGGGAGAGACACAGGCTGG - Intronic
1176164310 20:63664754-63664776 GGTCTGAGAGGAAGGGAGGCAGG + Intronic
1178050135 21:28737922-28737944 GTTCAGGGAGAAACACAGGAAGG + Intergenic
1179077729 21:38139746-38139768 GATTTGGGAGTAAGACAGGCTGG - Intronic
1179469885 21:41603468-41603490 TGTCTTGGAGCACCACAGGCTGG + Intergenic
1179887113 21:44318937-44318959 GCCCTGGGAGGAGCTCAGGCAGG + Intronic
1180835156 22:18926063-18926085 GGGCTGAGAGGAACGGAGGCGGG + Intronic
1180835931 22:18929408-18929430 GGGCAGGGAGGAAGCCAGGCAGG + Intronic
1181432230 22:22888547-22888569 GGTAGGGAAGGAACAGAGGCAGG + Intronic
1181820082 22:25468717-25468739 GCTCTGCGAGGAATCCAGGCTGG + Intergenic
1181917025 22:26289632-26289654 GGCCTGGAAGGAACACTGGCTGG + Intronic
1182621976 22:31623396-31623418 GTTCTGGAAGGAACCCAGTCTGG - Intronic
1182622936 22:31627687-31627709 GGTCAGTGAGGAAAACTGGCAGG - Intronic
1183697805 22:39433054-39433076 GCTATGGGAGGCAGACAGGCTGG - Intronic
1183975599 22:41510262-41510284 GGTGTGGGAGGACCCCAGACTGG - Intronic
1184101036 22:42341899-42341921 AGTCTGGGAGGACCACAGGGAGG + Intronic
1184196124 22:42929915-42929937 TGTGTGAGAGGAACACAGGCAGG - Intronic
1184694469 22:46131815-46131837 GCTCAGGGAGAAACACAGGAGGG + Intergenic
1184817151 22:46881066-46881088 GGACAAGCAGGAACACAGGCTGG + Intronic
1185095643 22:48804627-48804649 TGTCCTGGAGGACCACAGGCTGG + Intronic
1185272510 22:49935644-49935666 GGTCCGGGAGGAGCAGGGGCGGG + Intergenic
1203285245 22_KI270734v1_random:151362-151384 GGGCTGAGAGGAACGGAGGCGGG + Intergenic
1203286022 22_KI270734v1_random:154707-154729 GGGCAGGGAGGAAGCCAGGCAGG + Intergenic
949751045 3:7353146-7353168 GGTCTGGAAGCAAAAAAGGCTGG - Intronic
950525148 3:13518929-13518951 GGTCTGCGAGGCCCACGGGCTGG - Intergenic
951998323 3:28756258-28756280 AGGCTGGGAATAACACAGGCTGG - Intergenic
952982524 3:38749219-38749241 GGGCTGGGAGGAAAACACACAGG + Intronic
953897087 3:46811172-46811194 GTTCAGGGAGGCACACAAGCTGG + Intronic
953918511 3:46936015-46936037 AGTGGGGCAGGAACACAGGCAGG + Intronic
954665541 3:52249512-52249534 AGTCTGGGAGGGCCACGGGCTGG - Intronic
956410440 3:68973301-68973323 GGTCGGGGAGGAAGAAAGGGAGG - Intergenic
956718818 3:72100605-72100627 GGACTGGGAGCAGCACAGGGGGG - Intergenic
958979961 3:100709485-100709507 GGTGGGGGAAGAACAGAGGCGGG - Exonic
959943824 3:112106794-112106816 GGTGTGGTAGTCACACAGGCTGG - Intronic
960192103 3:114719115-114719137 GCTTTAGGAGGAACACAGCCAGG + Intronic
961432775 3:126894735-126894757 GGTCTGGAGGGATCACAGACTGG + Intronic
963073961 3:141329264-141329286 AGGATGGGAGGAACACAGTCAGG - Intronic
965834126 3:172832109-172832131 GGTCAGGGAGGAGCACAGAGCGG + Intergenic
966863773 3:184244988-184245010 TGTCTGGGAGGAAGACAGGATGG + Intronic
967410351 3:189160725-189160747 GGTCTGGCAGGTAAACAGGGTGG - Intronic
967980567 3:195062782-195062804 GGTCTGTAAGGAACAAGGGCAGG + Intergenic
968083572 3:195863798-195863820 AGACTGGGAGGAAACCAGGCTGG - Exonic
968331951 3:197878407-197878429 GCTCTGGTAGGAACAGGGGCAGG - Intronic
968910994 4:3476965-3476987 GCTCTGGGCGGCCCACAGGCGGG - Intronic
969337911 4:6522504-6522526 GGGCTGGAGGGAACACAGGGTGG - Intronic
970208967 4:13687610-13687632 GGTCTGGTGAGAACACTGGCCGG + Intergenic
970589395 4:17546279-17546301 AGTATGGAAGGAACACAGGCAGG + Intergenic
971177208 4:24292828-24292850 GGGGTAGGAGGAGCACAGGCAGG - Intergenic
971177222 4:24292863-24292885 GGGGTAGGAGGAGCACAGGCAGG - Intergenic
971177236 4:24292898-24292920 GGGGTAGGAGGAGCACAGGCAGG - Intergenic
971177250 4:24292933-24292955 GGGTAGGGAGGAGCACAGGCAGG - Intergenic
971177299 4:24293077-24293099 GGGGTAGGAGGAGCACAGGCAGG - Intergenic
971177335 4:24293183-24293205 GGGGTAGGAGGAGCACAGGCAGG - Intergenic
971177476 4:24293602-24293624 GGATAGGGAGGAACACAGGAAGG - Intergenic
971619223 4:28832751-28832773 GGTTAGGGAGGAGAACAGGCTGG - Intergenic
972605620 4:40610729-40610751 GGTGTGGGAGGAACCCAGGGGGG + Intronic
972676065 4:41260475-41260497 GGTGTGGGAGGCAGACAGACGGG + Intronic
976218912 4:82740394-82740416 GGACGGGGAGGATCTCAGGCTGG + Intronic
976444515 4:85115515-85115537 AGTCTGGGATGAACCTAGGCTGG - Intergenic
978469963 4:109054761-109054783 GGTCTGGGAGGGACAGAGTGAGG + Intronic
980907061 4:138958552-138958574 ATTCAGGGAGGAAAACAGGCTGG + Intergenic
980963941 4:139502517-139502539 GGTGTGGGTGGAGCACAGGAAGG + Intronic
981761482 4:148200121-148200143 GGTCTGGCAGAAGCACAGGCAGG + Intronic
982120510 4:152138760-152138782 GCTCTGGGGCCAACACAGGCAGG + Intergenic
982728993 4:158935374-158935396 GGTCTGTGGGGAAGACAGGAGGG - Intronic
983252601 4:165361676-165361698 AGACTGGGAGGAAAACAGGGTGG + Intronic
984923735 4:184788105-184788127 GGCCTGGGAGGGACAGAGGCTGG + Intronic
985070422 4:186162361-186162383 GAACTGGGAGAAGCACAGGCCGG - Intronic
985660722 5:1155549-1155571 GGGCTGGGGGGACCCCAGGCAGG + Intergenic
985676539 5:1234407-1234429 TGGCTGGGAGGAACCCTGGCAGG - Intronic
985903494 5:2814875-2814897 GATGCGGGAGAAACACAGGCAGG + Intergenic
986110145 5:4708034-4708056 GTTTTGTGAGGAACACAGTCAGG + Intergenic
986674551 5:10171610-10171632 GGTCTGAGAGGTCCATAGGCAGG - Intergenic
986707078 5:10461164-10461186 GGACTGGGAGCACCACAGCCAGG - Exonic
986711917 5:10493875-10493897 GGTCTGGGACGGACACAGAAAGG + Intergenic
986773347 5:10993145-10993167 GGGCTGGAAAGGACACAGGCAGG - Intronic
987092729 5:14522242-14522264 AGTCTAGGAGGGACACAGACAGG - Intronic
988510633 5:31861761-31861783 AGTCTGGGAGGCACAAAGGGTGG - Intronic
989139404 5:38188527-38188549 GGTCAGAGTAGAACACAGGCTGG - Intergenic
992689011 5:79225296-79225318 AGTGTGGCAGGAAGACAGGCAGG + Intronic
996029933 5:118693374-118693396 GGTCTGAAAGGAACCTAGGCAGG - Intergenic
996034736 5:118746033-118746055 GTACTGGGAGGAACAGAGGAGGG + Intergenic
997210603 5:132074683-132074705 GGCTTGGGAGGGGCACAGGCTGG - Intronic
997355079 5:133257348-133257370 GGTCTGCCAGGCACACAGGGAGG - Intronic
997510060 5:134447909-134447931 GGGCTGGGAGGCACACTGGGTGG + Intergenic
997674931 5:135705925-135705947 GGCCTGGCTGGAACGCAGGCTGG + Intergenic
997890725 5:137673854-137673876 GCTCTGGGAGGGGCCCAGGCAGG + Intronic
1000882148 5:166710784-166710806 AGTCTGTAAGGAACATAGGCAGG - Intergenic
1001975426 5:175994797-175994819 TGTCTGAGAGTCACACAGGCTGG - Intronic
1002047986 5:176552786-176552808 GGCCTGGGAGGCAGACAGGGTGG + Intronic
1002242007 5:177848973-177848995 TGTCTGAGAGTCACACAGGCTGG + Intergenic
1002261458 5:177996358-177996380 GCTCAGGGAGGATCACAAGCCGG + Intergenic
1004714467 6:18204030-18204052 GGTCTAGGAGCAACAAAGACAGG + Intronic
1005892982 6:30154922-30154944 GCCCTGGGAGGAAAACAGGGAGG - Intronic
1011668210 6:89656480-89656502 GGTCGGGGAGAGACACAGGCAGG + Intronic
1017705371 6:157117860-157117882 CATCTGGGAAGAACAGAGGCAGG - Intronic
1018381550 6:163262366-163262388 TCACTGGGAGGATCACAGGCGGG + Intronic
1018726085 6:166614469-166614491 AGTGTGGGAGGGACACGGGCAGG - Intronic
1019056181 6:169225160-169225182 GGTCTGGGTTGAACACAAGCCGG + Exonic
1019359062 7:595446-595468 GGTCTGTGGGGAACACAGGCAGG - Intronic
1019722679 7:2582711-2582733 GGTGGGGGAGGAACAAAGGCGGG - Intronic
1019732978 7:2637723-2637745 GGTGTGGGAGGGTCACAGGAGGG + Intronic
1019918314 7:4147555-4147577 GCTATGGGAGGACCAAAGGCAGG - Intronic
1020043819 7:5024701-5024723 GCTCTGGGATGAACAAGGGCTGG + Intronic
1021072760 7:16262800-16262822 GGTCTGGGAGATCCACGGGCAGG + Intronic
1021434495 7:20598941-20598963 GGTTTGCAAGGAGCACAGGCAGG - Intergenic
1021689839 7:23221218-23221240 GGTCTGGGAGGATGCCAGGCTGG + Intergenic
1021761917 7:23910615-23910637 AGGCTGGGAGAACCACAGGCAGG + Intergenic
1023091120 7:36618516-36618538 GGTTTGGGAGGAACTGAGGGTGG + Intronic
1023850780 7:44149092-44149114 GGGCTGGGGGGATCACAGCCAGG + Intronic
1026224517 7:68428744-68428766 ATTCTGGGAGAAACACATGCAGG + Intergenic
1026976059 7:74499163-74499185 GGAGTGGGAGGAACACAGCCTGG - Intronic
1027264597 7:76487455-76487477 GGTCTTGGAGGAGCAGAGGGAGG - Intronic
1027315967 7:76985557-76985579 GGTCTTGGAGGAGCAGAGGGAGG - Intergenic
1029435589 7:100562431-100562453 GGGCTGGGAGGAACATGGCCAGG - Intronic
1029443590 7:100601138-100601160 GGGCTGGGAGGGACAGGGGCAGG + Intergenic
1032387973 7:131537716-131537738 GGATGGAGAGGAACACAGGCAGG - Intronic
1032524026 7:132565700-132565722 GCTTTGGGAGGAAGACAGGTGGG - Intronic
1033643190 7:143282212-143282234 GGTCTGGAATGCAGACAGGCTGG + Intronic
1034496855 7:151428365-151428387 TTCCTGGGGGGAACACAGGCAGG + Intergenic
1034592721 7:152156294-152156316 GGTGTAGGAGGAAGAGAGGCAGG + Exonic
1034830582 7:154304766-154304788 GGTCTGGGAGCACCGGAGGCAGG - Intronic
1035071243 7:156146526-156146548 GGACTGGGATGACCAGAGGCAGG - Intergenic
1035931118 8:3781412-3781434 GGACTGGGAGCAGCACAGTCTGG + Intronic
1040617088 8:49047701-49047723 GGGCTTGGAGAAAAACAGGCTGG - Intergenic
1041098270 8:54371597-54371619 GCTCTGTGAGGGAGACAGGCTGG - Intergenic
1042852158 8:73226930-73226952 GCCATGGGAGGCACACAGGCAGG + Intergenic
1046291804 8:112172087-112172109 AGTGTGGGAGGAAGACAGCCGGG + Intergenic
1047490756 8:125372964-125372986 GGACTGAGAGGAACCAAGGCTGG + Intergenic
1047597607 8:126394696-126394718 GGCCTGGGAGGAAGGCAGGAGGG - Intergenic
1048048633 8:130796550-130796572 GGTCTGGCTGGAACTCAGCCAGG + Intronic
1048162917 8:132037551-132037573 GGTCTCAAAGGAAAACAGGCTGG + Intronic
1048407138 8:134135314-134135336 GGGCTTGGAGGAAGAAAGGCAGG - Intergenic
1049099671 8:140569799-140569821 GGGCTGGGATGAAGGCAGGCAGG + Intronic
1049149469 8:141025306-141025328 CCTCTGGAAGGAACACAGCCCGG - Intergenic
1049209168 8:141377382-141377404 TGTCTGGTAGAAACAGAGGCTGG - Intergenic
1049213430 8:141397026-141397048 GGCCAGGGAGGAAGCCAGGCTGG + Intronic
1049221972 8:141432553-141432575 GGGTTGGGGGGAAGACAGGCTGG + Intergenic
1049335055 8:142079880-142079902 GGGCTGTGAGGGACACAGGGTGG - Intergenic
1049382804 8:142325761-142325783 GGTCAGAGAGGAAAAGAGGCTGG + Intronic
1049417747 8:142503274-142503296 GGTCTGGGAGGAGATGAGGCTGG + Intronic
1051386779 9:16517979-16518001 GGTCTCGAAGGAACACAGACTGG + Intronic
1051721424 9:20041471-20041493 GGCCTGGGATAAACACAGCCAGG + Intergenic
1057026979 9:91741390-91741412 GATCAGGGAGAAACAGAGGCAGG + Intronic
1057512979 9:95696470-95696492 GGTATGGGAAGGACAGAGGCGGG - Intergenic
1058926130 9:109665977-109665999 GGTGTGGGAGGTGCACAGCCAGG + Intronic
1060109633 9:120897289-120897311 CGTCTTGCAGGGACACAGGCTGG + Intergenic
1060394029 9:123303195-123303217 GGTCTTGGAGGAACCTGGGCTGG + Intergenic
1060506035 9:124199089-124199111 GGTCTGTGTGGAACAGAGGCTGG - Intergenic
1060588727 9:124802680-124802702 GGTCGAGGAGGACCACAGGGAGG - Intronic
1060723370 9:125992591-125992613 GGGCAGAGAGGAACAGAGGCCGG + Intergenic
1060856230 9:126916043-126916065 CCCCTGGGAGGCACACAGGCAGG - Intronic
1061153989 9:128846084-128846106 GGCCTGGGAGGAACACCGGGAGG - Intronic
1061306484 9:129735900-129735922 GGTATGGAAGGAAGACAGGGTGG - Intergenic
1062083334 9:134636059-134636081 GAGCTGGGAAGAACCCAGGCAGG - Intergenic
1062510839 9:136905015-136905037 GGTTTGGGAGGAACACTCCCTGG + Intronic
1203545460 Un_KI270743v1:125044-125066 GGTCTTGGAAGAAGACAGGAAGG - Intergenic
1187473337 X:19588581-19588603 GCTATGGAAGGAACACAGGAGGG - Intronic
1190235732 X:48613989-48614011 GCTCTGAGAGTCACACAGGCTGG - Intergenic
1190340622 X:49292644-49292666 GGTCTGGGGGAGACACGGGCCGG + Intronic
1190370830 X:49739275-49739297 GGCCCAGGAGGCACACAGGCTGG + Intergenic
1191218968 X:57965360-57965382 GGACTGAGAGGAGCACAGGGAGG + Intergenic
1191878263 X:65818752-65818774 GGTCTGGAAGTTACCCAGGCTGG + Intergenic
1196897553 X:120352651-120352673 GGTATGGGGGAAACACAGGAAGG - Intergenic
1197971026 X:132115149-132115171 GGACTGGGATGACTACAGGCTGG - Intronic
1200102992 X:153697399-153697421 GGTCAGGGAGGAGCAGTGGCTGG + Intergenic
1200142238 X:153908025-153908047 GGAGTGGGAGGAACTCAGGTGGG - Intronic
1200918663 Y:8593653-8593675 GGTCCATGGGGAACACAGGCAGG - Intergenic
1202380336 Y:24271443-24271465 GGTCTGGGAGGAGGAGAGGGTGG - Intergenic
1202490447 Y:25398682-25398704 GGTCTGGGAGGAGGAGAGGGTGG + Intergenic