ID: 1089498709

View in Genome Browser
Species Human (GRCh38)
Location 11:118920677-118920699
Sequence CAGGACAAGAAGAGGTGGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 333
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 311}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089498703_1089498709 6 Left 1089498703 11:118920648-118920670 CCTCTCTGTAACAACCACCACTG 0: 1
1: 0
2: 0
3: 25
4: 213
Right 1089498709 11:118920677-118920699 CAGGACAAGAAGAGGTGGACAGG 0: 1
1: 0
2: 0
3: 21
4: 311
1089498699_1089498709 29 Left 1089498699 11:118920625-118920647 CCCTTTTCCTTTAGAACACCGAG 0: 1
1: 0
2: 0
3: 9
4: 150
Right 1089498709 11:118920677-118920699 CAGGACAAGAAGAGGTGGACAGG 0: 1
1: 0
2: 0
3: 21
4: 311
1089498705_1089498709 -8 Left 1089498705 11:118920662-118920684 CCACCACTGTATAATCAGGACAA 0: 1
1: 0
2: 1
3: 25
4: 268
Right 1089498709 11:118920677-118920699 CAGGACAAGAAGAGGTGGACAGG 0: 1
1: 0
2: 0
3: 21
4: 311
1089498701_1089498709 22 Left 1089498701 11:118920632-118920654 CCTTTAGAACACCGAGCCTCTCT 0: 1
1: 0
2: 0
3: 3
4: 109
Right 1089498709 11:118920677-118920699 CAGGACAAGAAGAGGTGGACAGG 0: 1
1: 0
2: 0
3: 21
4: 311
1089498698_1089498709 30 Left 1089498698 11:118920624-118920646 CCCCTTTTCCTTTAGAACACCGA 0: 1
1: 0
2: 0
3: 12
4: 143
Right 1089498709 11:118920677-118920699 CAGGACAAGAAGAGGTGGACAGG 0: 1
1: 0
2: 0
3: 21
4: 311
1089498702_1089498709 11 Left 1089498702 11:118920643-118920665 CCGAGCCTCTCTGTAACAACCAC 0: 1
1: 0
2: 1
3: 29
4: 227
Right 1089498709 11:118920677-118920699 CAGGACAAGAAGAGGTGGACAGG 0: 1
1: 0
2: 0
3: 21
4: 311
1089498700_1089498709 28 Left 1089498700 11:118920626-118920648 CCTTTTCCTTTAGAACACCGAGC 0: 1
1: 0
2: 0
3: 1
4: 107
Right 1089498709 11:118920677-118920699 CAGGACAAGAAGAGGTGGACAGG 0: 1
1: 0
2: 0
3: 21
4: 311

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089498709 Original CRISPR CAGGACAAGAAGAGGTGGAC AGG Intronic
900670941 1:3854369-3854391 CAGGACAAGAAGTGAGGGTCAGG - Intronic
900749505 1:4385964-4385986 CAGGACAGAAATAGGTGAACAGG + Intergenic
901122632 1:6907800-6907822 CAGGAGCAGAAGGGCTGGACAGG - Intronic
902268752 1:15288126-15288148 CAGCACAGGCAGTGGTGGACAGG - Intronic
903019430 1:20383648-20383670 AAGGACAAGAAGGGGTGTGCTGG + Intergenic
903317490 1:22520020-22520042 CATGAGAGGAAGAGGTGGAGAGG - Intronic
903542134 1:24102377-24102399 CAGGAAAAGCAGAGCTGGCCAGG - Intronic
904320796 1:29696853-29696875 CGGGACAAGGAGAGGTGGAAGGG - Intergenic
904371206 1:30048556-30048578 CAGCTCAGGGAGAGGTGGACAGG - Intergenic
904780069 1:32939812-32939834 CAGAACTAGAACAGCTGGACTGG + Intronic
905920222 1:41714295-41714317 GAGGAGAAGAAGTGGAGGACGGG + Intronic
906304570 1:44708626-44708648 CAGGACAACAGGAGGCGGAGGGG + Intronic
906488116 1:46247343-46247365 CAGGGCTAGAAGAGCTGGACTGG - Intergenic
906488141 1:46247418-46247440 CGGGGCGAGAAGAGCTGGACGGG - Intergenic
907413780 1:54300291-54300313 CAGCACAGGAAGAGCTGGCCTGG + Intronic
907921053 1:58911973-58911995 CAGGCCAAGAAGAGGAGAAAGGG - Intergenic
912557314 1:110525482-110525504 CAGGACAGGAAAAGGAGGAATGG - Intergenic
912794949 1:112687618-112687640 CAGGAGGAGCAGAGGTGGGCAGG - Intronic
913480872 1:119288062-119288084 TAGGCAAAGAGGAGGTGGACAGG + Intergenic
914754550 1:150555287-150555309 CAGCACAAGCTGAGGTGGTCAGG - Intronic
915864384 1:159483185-159483207 CAGCACAAGAAAATGTGGACAGG - Intergenic
915941009 1:160118061-160118083 CAGGACAGGAGGAGGGGGAAGGG + Intronic
915994393 1:160548986-160549008 GAGGAGAAGAAAAGGAGGACAGG - Intronic
916636429 1:166674246-166674268 AAGAACAAGAAGAGGAAGACAGG - Intergenic
917365205 1:174223751-174223773 CTGGACAAGTAGAGGTACACAGG + Intronic
919193479 1:194253345-194253367 CAGGACAAGTATAGGGGAACAGG - Intergenic
920756993 1:208741909-208741931 AAGGAAAAGAAGAGATGGGCAGG + Intergenic
920966276 1:210704060-210704082 CAGGGCAAGGAGAGGTGCCCTGG + Intronic
922219917 1:223550654-223550676 CAGGAGAAAAAGAGCTGGGCTGG - Intronic
923136068 1:231120435-231120457 CAGGAGTAGAAGAGGAGGCCAGG + Intergenic
923854478 1:237830849-237830871 CTTGAAATGAAGAGGTGGACAGG + Intronic
924111269 1:240702256-240702278 CAAAAGAAGAAGATGTGGACAGG + Intergenic
924143815 1:241053178-241053200 AAGAACAAGAAGAGCTGGATAGG - Intronic
1062805620 10:417647-417669 CCTGACAGGAACAGGTGGACAGG - Intronic
1062805656 10:417797-417819 CCTGACAGGAACAGGTGGACAGG - Intronic
1062805684 10:417911-417933 CCTGACAGGAACAGGTGGACAGG - Intronic
1062805713 10:418025-418047 CCTGACAGGAACAGGTGGACAGG - Intronic
1062805755 10:418208-418230 CCTGACAGGAACAGGTGGACAGG - Intronic
1065731862 10:28716882-28716904 AAGGCCAAGAAGAGGTGGTGAGG - Intergenic
1065971617 10:30810297-30810319 CAGGGCAAGAAGAGGAGCCCTGG + Intergenic
1066127531 10:32356480-32356502 CAGGACAAGAACAGAGGGAGAGG + Intronic
1066505642 10:36039582-36039604 CAAGAAGAGAAGAGCTGGACTGG - Intergenic
1066654510 10:37685851-37685873 CAGGCCAGGGAGAGGTGGACAGG + Intergenic
1067560445 10:47301038-47301060 GAGGAAAAGTAGAGGTGCACGGG - Intronic
1070283819 10:75069527-75069549 CTGGACAGGAAGTGGTGGAGCGG - Intergenic
1070598586 10:77849722-77849744 CAGGAAAGGGAGAGGGGGACAGG + Intronic
1072368015 10:94734066-94734088 CAGGACAAGAAGAGAAGGCAAGG + Intronic
1072555794 10:96513142-96513164 CCGGAGCAGAAGAGCTGGACTGG - Intronic
1073540496 10:104313371-104313393 CAGGGCCAGAAGAGGTTGAGAGG + Exonic
1073897191 10:108176171-108176193 CAGGGAAAGAAGAGGTGGGTTGG + Intergenic
1075489722 10:122856394-122856416 CAGGTCAAGAACAGCAGGACAGG - Intronic
1075647651 10:124107249-124107271 CAGGACAGGCAGGGGTGGGCCGG - Intergenic
1075737121 10:124670771-124670793 CAGGATGAGAGGAGGTGGAATGG - Intronic
1075863361 10:125696552-125696574 CAGGACAAGAAGGGGTCGCTTGG - Intergenic
1076591840 10:131588862-131588884 CAGGGTGAGAAGAGCTGGACTGG - Intergenic
1079494770 11:21029706-21029728 CAGGAGAAGAAGAAGAGAACAGG + Intronic
1080994814 11:37586741-37586763 CAGCAAAAGAAGAGGTGGTGGGG - Intergenic
1082222381 11:49655574-49655596 CAAAGCAAGAAGAGGTTGACCGG + Intergenic
1083157918 11:60836837-60836859 CAGGCCAAGAAGAGGTGGGGTGG - Intergenic
1083728552 11:64641180-64641202 GAGGACATGAATAGGAGGACAGG + Intronic
1088680013 11:112231893-112231915 CAGGAGAAGAGGAGGGGGAGGGG + Intronic
1089498709 11:118920677-118920699 CAGGACAAGAAGAGGTGGACAGG + Intronic
1089631423 11:119787026-119787048 CAGGACAGGAAGGGGTGCTCCGG - Intergenic
1089890083 11:121872134-121872156 CAGAAAAAGAAGAGGAGGCCGGG + Intergenic
1091616279 12:2053216-2053238 CAGGGCGAGAAGAGGCGGAGAGG - Intronic
1091694211 12:2617139-2617161 CAGGACAACAGGTGGGGGACCGG - Intronic
1092251994 12:6904764-6904786 GAGGACAAAAAGAAGTGGGCAGG - Intronic
1092701142 12:11232180-11232202 CAGGTAAGGTAGAGGTGGACAGG + Intergenic
1093195098 12:16121410-16121432 CAGGTCAAGAAGAGGTACAGGGG + Intergenic
1096379893 12:51147514-51147536 CAGGATAGGAAGAGGTGGGGGGG + Intronic
1096492371 12:52019691-52019713 CAAGAAAAGAATAGGTGGCCAGG + Intergenic
1097193027 12:57229025-57229047 TGGGACATCAAGAGGTGGACAGG + Intergenic
1098991629 12:77070088-77070110 GAGGACAGGAAGAGCCGGACAGG + Intergenic
1102039839 12:109793875-109793897 CAGGAAGAGAAGAGGAGGGCAGG + Intronic
1102690166 12:114754098-114754120 CAGGACAAGAAGATCTTGACTGG + Intergenic
1104389994 12:128384079-128384101 CAAAACAAAAAGAGGTGGTCAGG + Intronic
1105764983 13:23550344-23550366 CAGGTCAAGAATTGGTGGAGAGG + Intergenic
1107195257 13:37643528-37643550 TAGGACAAGGGGAGGTGCACAGG + Intronic
1109386188 13:61631701-61631723 AAGGAAATGAAGATGTGGACAGG - Intergenic
1109957449 13:69586781-69586803 TAAGACAAGAAAAGGAGGACTGG - Intergenic
1110718408 13:78733630-78733652 CAGGAGAAGGAGAGGTGGCTTGG + Intergenic
1111476206 13:88751375-88751397 TTGGACAAGAAGACGTGAACTGG + Intergenic
1112873352 13:104002597-104002619 ATGGACAAGAAGAGGTTAACTGG - Intergenic
1114147944 14:19999734-19999756 CAGTACAAGCAAAGGTGTACTGG + Intergenic
1114534304 14:23413155-23413177 CAGGACAAAATTAGGTGGAAGGG + Intronic
1116030729 14:39568032-39568054 CAGGAGATGAAGAGATGGGCTGG + Intergenic
1116265531 14:42684852-42684874 GAGGATAAGAAAAGGTGTACAGG + Intergenic
1116672412 14:47860509-47860531 CAGGACAAGGAGTAGTGGTCAGG + Intergenic
1117084453 14:52185040-52185062 CAGGACAAAGGGAGGAGGACAGG + Intergenic
1119139115 14:72249241-72249263 CTGGTTAAGAAGAGGTGGCCAGG + Intronic
1119668122 14:76499128-76499150 GAGGAGAAGAGGAGGAGGACAGG - Intronic
1120781573 14:88490458-88490480 CAGGGCAGGAAGAGGTGGGAGGG - Intronic
1121845965 14:97172553-97172575 CTGGACAAGAAGTGGAGGAAAGG - Intergenic
1122198767 14:100109208-100109230 AAGGACAAGAGAAGGTGGATGGG - Intronic
1126071315 15:44866849-44866871 CTGGAAGAGAAGAGGTGCACTGG - Intergenic
1126539906 15:49810425-49810447 TAGGCCAAGAAGAGGAGCACAGG + Intergenic
1126915951 15:53466540-53466562 CAGCACACGAAGAGATGGGCAGG - Intergenic
1127193824 15:56562490-56562512 TTGGAGAAGAAGAGGTGGTCTGG - Intergenic
1127604739 15:60574980-60575002 CAGGAGAAGAAGAGGAGGTCTGG + Intronic
1127796272 15:62441137-62441159 CAGTACAAGCAGAGATGGATTGG + Intronic
1129631703 15:77267254-77267276 CAGGACCATCAGATGTGGACAGG - Intronic
1129669041 15:77596995-77597017 CAGGACAAAAGGAGGTGGGAGGG - Intergenic
1130681565 15:86001516-86001538 CAGGAGGAGAAATGGTGGACAGG + Intergenic
1130896954 15:88178385-88178407 TAGGAAAAGAAGAGGTGGCTAGG - Intronic
1130926038 15:88386578-88386600 AAGATAAAGAAGAGGTGGACTGG + Intergenic
1132771896 16:1568105-1568127 CAGGACAGGAAGACTTGCACAGG + Intronic
1133268663 16:4599981-4600003 CAGGACTAGAAGTGCTGTACAGG - Intronic
1133611154 16:7434516-7434538 CAGGAGATGAGGAGATGGACTGG + Intronic
1135938204 16:26798744-26798766 CAGAACAACAAGAGGGGCACTGG + Intergenic
1137239357 16:46641584-46641606 CTGGAGAAGAAGAGGTGTTCTGG - Intergenic
1137497835 16:48984410-48984432 CAGGACACCAAGAGGTGAAGTGG + Intergenic
1137822330 16:51457999-51458021 CAGGGAGAGAACAGGTGGACGGG - Intergenic
1140328810 16:74031854-74031876 CAGGACAAGAACAGATTGTCTGG - Intergenic
1140529751 16:75654605-75654627 CAGGACAAGTTGAGGGGGAAAGG + Intronic
1142151273 16:88513523-88513545 CAGGAGAGGTAGAGGTGGCCCGG + Intronic
1142969843 17:3603958-3603980 CAGGAAAGGAAGATGTGCACAGG + Intergenic
1144066925 17:11632777-11632799 CAGGAACAGAACAGGTGGAAAGG - Intronic
1144645924 17:16973323-16973345 GAGGACATGGAGAGGTGGAGAGG + Intergenic
1146923303 17:36727911-36727933 CAGGACAGGAGGAGGAGGATTGG - Intergenic
1147328901 17:39684803-39684825 CATGTCAAGAATAGGTGGACTGG - Intronic
1147662103 17:42122323-42122345 CGCGACACGAGGAGGTGGACTGG - Exonic
1149290437 17:55213211-55213233 CAGCACAAGAAGACTTGAACAGG + Intergenic
1150433052 17:65133840-65133862 CAGCACAAGAAAAGGTGCAGAGG - Intergenic
1150511265 17:65755286-65755308 CAGGAGAAAGAGAGGTGGAGAGG + Intronic
1150645260 17:66973856-66973878 CAGAACAAGAATTGGGGGACGGG - Intronic
1150910967 17:69387088-69387110 CTGGGCAAGAAGAGGTTGTCTGG + Intergenic
1151451941 17:74203414-74203436 GAAGACAGGAAGGGGTGGACGGG + Intergenic
1153661516 18:7330369-7330391 CAGCAGAAGAAGAGGAGGTCAGG - Intergenic
1154486146 18:14872838-14872860 CGGGAATAGAAGGGGTGGACAGG + Intergenic
1157661246 18:49447089-49447111 AAGGACAAGAAGGGTTGGCCTGG + Intronic
1158265265 18:55654369-55654391 CAGGAAAAGAAGTGGAGGAGAGG + Intronic
1159330894 18:66992663-66992685 CAGGACAACAAAATGTTGACTGG + Intergenic
1161064169 19:2229377-2229399 CCGGGCAAGGAGAGGAGGACTGG + Intronic
1162062323 19:8103691-8103713 CAGGGAAAGAAGGGGTGGAGGGG + Intronic
1162591658 19:11596310-11596332 GAGGACAGGAAGAGGAGGAAGGG - Intronic
1163061259 19:14763875-14763897 GAGGACAAGAGGAAGAGGACGGG - Intronic
1163243956 19:16080986-16081008 CAGGACAAAAAGATATGGAAAGG - Intronic
1165096177 19:33411088-33411110 CACGACAAGGAGATGTGGGCAGG - Intronic
1165564389 19:36712032-36712054 AAGAAAAAGAACAGGTGGACTGG - Exonic
1165593919 19:36995475-36995497 CACTACAAGAAGAGGTTGGCAGG - Intronic
1165694013 19:37886537-37886559 CATTGGAAGAAGAGGTGGACAGG - Exonic
1166344030 19:42154186-42154208 CAGGAAAAAAAGGGGGGGACAGG + Intronic
1166540028 19:43599069-43599091 CAGGACAAGGGAAGGTGGGCTGG - Exonic
1167220710 19:48196502-48196524 CGGGAGAGGAGGAGGTGGACTGG + Intronic
1202646642 1_KI270706v1_random:148048-148070 AAGTAAAAGAGGAGGTGGACGGG + Intergenic
925387023 2:3468916-3468938 CAGGACAAGATGGGGTTGAACGG + Intronic
926689807 2:15725435-15725457 CAGGTCAAGCAGCCGTGGACGGG + Intronic
926704426 2:15826615-15826637 CAGCCCAGGGAGAGGTGGACAGG + Intergenic
926908237 2:17825908-17825930 CAAGACCAGAAAAGGGGGACAGG + Intergenic
927707153 2:25303494-25303516 CAGGACCTGGAGAGGTGGCCTGG - Intronic
927990791 2:27445494-27445516 CAGGACAAGTTGGGGTGGATGGG + Intronic
928040258 2:27868628-27868650 CAAAACAAGAAGTGGTGGAAAGG - Intronic
928792987 2:34981077-34981099 CAGGACATGCACAGGTGGAGAGG + Intergenic
929907405 2:46058285-46058307 CAGGACAAGAGGAGGCTAACTGG + Intronic
930626721 2:53707005-53707027 CAGCAAAAGAAGAGCTGGGCAGG - Intronic
931325432 2:61217083-61217105 TAGGAAAAGAAGAGGTGGTTAGG - Intronic
932309442 2:70727961-70727983 CAGGATAAGAACAGGAGGATGGG + Intronic
932581429 2:72994891-72994913 CCGTACAAGCAGAGGTGCACAGG - Intronic
933738844 2:85517163-85517185 CAGGCAAAGAAGATGTGGAAGGG + Intergenic
935300783 2:101692239-101692261 CAGGAAAAGAAGAAGCAGACAGG - Intergenic
935384377 2:102485698-102485720 GGGGACTAGAAGAGGTGGGCAGG + Intronic
935557580 2:104527213-104527235 CAGGGCAAGCTGAGATGGACGGG - Intergenic
935786028 2:106549679-106549701 CAGGGCAAGGAGAGGTGGGAGGG + Intergenic
935786299 2:106551826-106551848 CAGGACACCAATAGGTGCACAGG + Intergenic
938664642 2:133521991-133522013 CAGGGCAAGGTGAGGTGGAAAGG - Intronic
938763549 2:134445494-134445516 CAGGACAGGATGCGCTGGACAGG - Intronic
939411669 2:141834648-141834670 CAGGACAAAGGCAGGTGGACAGG + Intronic
939948430 2:148439006-148439028 CAGGTTGATAAGAGGTGGACTGG - Intronic
941620025 2:167766917-167766939 CAGGCAAAGAAAAAGTGGACTGG - Intergenic
941934096 2:170970004-170970026 TAGAACAAGAAGACGTGGAAGGG + Intergenic
942331605 2:174830569-174830591 CAGGACAAGAAGACTAGGAATGG - Intronic
942348736 2:175030809-175030831 CAGGCCAAGAAGAGCTTCACAGG + Intergenic
942401457 2:175608116-175608138 TAGGATAAGAAGAGTTGGGCTGG + Intergenic
942762174 2:179412076-179412098 CAGGACAGGAAGATGTAGATGGG + Intergenic
942992706 2:182221068-182221090 GAGGACAAGAAGGGGTAGATGGG - Intronic
943710116 2:191083445-191083467 AAGGCCAAGAAGATGTGAACAGG + Intronic
945233785 2:207615854-207615876 CAGCCTAAGGAGAGGTGGACTGG + Intronic
947525109 2:230872849-230872871 GAGGACAATAGGAGGTGGGCAGG - Intronic
947590577 2:231382932-231382954 CAGGACAAGAGGAGGAGCAGAGG - Intergenic
947977197 2:234377063-234377085 CAGGACAAGAAGAGCAGGGAGGG - Intergenic
947983732 2:234431068-234431090 GAGGAGGAGAAGAGGAGGACTGG + Intergenic
948828059 2:240583679-240583701 CAGGATAAGAGGAGGCAGACAGG + Intergenic
1168893058 20:1306881-1306903 CAGCACAAGAAGAGGAGGCAGGG + Exonic
1169768222 20:9172431-9172453 CAGGAAAGGGAGAGATGGACAGG - Intronic
1171102239 20:22394976-22394998 CAGGACCAGGAGAGCTGGATTGG - Intergenic
1171410366 20:24943075-24943097 CAGGACCAGCAGAGCAGGACAGG + Intergenic
1171494644 20:25547288-25547310 CAGCAGATGAAGAGGTGGATGGG - Intronic
1172663205 20:36581517-36581539 CAGGACAGGGTGAGGTGCACTGG - Intronic
1174439748 20:50541076-50541098 CAGGAGAAGTAGAGGTGAAGAGG + Intronic
1175700625 20:61134350-61134372 CAGCACAAGGAGATGTGGAATGG + Intergenic
1175736518 20:61391062-61391084 CAGGACAAAAAGAAGCAGACAGG - Intronic
1176098999 20:63356512-63356534 CAGGGCAAGATATGGTGGACGGG + Intronic
1176241169 20:64076620-64076642 CAGGGCCAGAGGAGGCGGACCGG - Exonic
1176257032 20:64158193-64158215 GAGGACATGAACAGGTGGGCAGG - Intronic
1176795162 21:13366540-13366562 CGGGAATAGAAGGGGTGGACAGG - Intergenic
1177398063 21:20563237-20563259 CTGGACAAGTGGAGGTTGACTGG + Intergenic
1179025107 21:37673376-37673398 CAGGACTGGAAGAGGGGGAGGGG - Intronic
1180355288 22:11834431-11834453 AAGTAAAAGAGGAGGTGGACGGG - Intergenic
1180382963 22:12157896-12157918 AAGTAAAAGAGGAGGTGGACGGG + Intergenic
1181059820 22:20276978-20277000 CAGGGCAGGAAGAGGTTGAGAGG + Intronic
1181616532 22:24058695-24058717 CAGGACAAGAACAGGTACAAAGG - Intronic
1181643234 22:24215780-24215802 CATGGCTAGAAGAGGTGGTCTGG - Intergenic
1181832322 22:25570716-25570738 CAGGAGAAGCAGAGGGGGGCCGG - Intronic
1182542796 22:31054133-31054155 CAGAAAAAGAGGAGGTGGCCAGG + Intergenic
1183271407 22:36864851-36864873 CAAGCCAAAAAGAGGTGGAAGGG - Intronic
1183687032 22:39367102-39367124 CAGGGCAAGAGGAGGCGGACTGG - Intronic
1183782403 22:40007286-40007308 GAGGACAAGAGGAGGAGGAGAGG - Intronic
1184036904 22:41922688-41922710 CAGGAGAAGATGGGGTGGCCAGG + Intergenic
949276387 3:2287776-2287798 AAGGAGAAGAAGAGGAGGAAGGG + Intronic
950153590 3:10707057-10707079 CAGGGCAAGGAGGGGTGGCCAGG + Intronic
951950118 3:28190822-28190844 CTGGACATTCAGAGGTGGACAGG + Intergenic
954389515 3:50261267-50261289 CAGGACATGCAGAGCTGGGCAGG + Intergenic
957843238 3:85698579-85698601 CAGGAGAAGGAGAGGTGGGGTGG + Intronic
959604037 3:108222506-108222528 CAGGGCAAGAAGAGGGCCACAGG - Exonic
959968786 3:112385138-112385160 TAGTGCAAGAAGAGGTGGAAGGG - Intergenic
960573220 3:119205675-119205697 CAGGCCAAGGAGAGGTGAACTGG - Intergenic
962351533 3:134659979-134660001 CAGGACAAGGCGAGCTGGACAGG + Intronic
962463909 3:135639332-135639354 CAGGAGAAGAAGACCTGGTCTGG - Intergenic
962720986 3:138174686-138174708 CAGCACAGCAAGAGGTCGACAGG + Exonic
966854129 3:184182630-184182652 CAGAACAAGGAGAAGTGGTCAGG - Intronic
967275411 3:187769372-187769394 CAGAACAAGAAGAGGTTCAATGG + Intergenic
967482388 3:189988740-189988762 CAGGACAAGAAGAGCAGAAGGGG - Intronic
967526655 3:190502897-190502919 AAGAACTAGAAGAGTTGGACTGG - Intergenic
969301154 4:6298147-6298169 CAGGACAACTAAAGGTGGCCTGG - Intronic
971835005 4:31751155-31751177 CAAGTCGAGAAGAGGTAGACGGG + Intergenic
971891078 4:32522781-32522803 AAGGAAAAGAAAAAGTGGACCGG + Intergenic
972375005 4:38461610-38461632 CAGGATAAGAAGTGATGGAAAGG - Intergenic
973372877 4:49266187-49266209 AAGTAAAAGAGGAGGTGGACGGG + Intergenic
973388120 4:49528872-49528894 AAGTAAAAGAGGAGGTGGACGGG - Intergenic
975267786 4:72391505-72391527 CAGGACAAGAAGGGCTGGATGGG + Intronic
975405406 4:73982784-73982806 GAGGACAAGAAGAGTTTGCCAGG + Intergenic
975443919 4:74440995-74441017 CAGAAGCAGAAGAGGTGGAAGGG - Intergenic
976409318 4:84695001-84695023 CAGGAAAAGAGGAGGTAGCCAGG + Intronic
979846907 4:125525087-125525109 GAGGTCATAAAGAGGTGGACAGG - Intergenic
983057998 4:163122340-163122362 CAGAACAAAAAGAAGTGGAGAGG + Intronic
983511463 4:168613446-168613468 GAGGAGAAGATGATGTGGACAGG - Intronic
984426905 4:179598802-179598824 CAAGACAAGAACAGGTGGTGGGG - Intergenic
986566329 5:9118849-9118871 CAGGAAAAGAAGAGGACGACTGG + Intronic
990156944 5:52888291-52888313 GAGGAAAAGAAGAGGAGGAAAGG + Intronic
991405489 5:66297139-66297161 CAGGCCAAGAAGAGGAGGAAGGG - Intergenic
991722440 5:69506335-69506357 CACCAGATGAAGAGGTGGACAGG + Intronic
991977608 5:72198542-72198564 TATGAGCAGAAGAGGTGGACGGG - Exonic
992297654 5:75341779-75341801 CAGTACTAGAAGAGGATGACTGG - Intronic
992957531 5:81925466-81925488 CAGTAAAAGAAAAGCTGGACAGG - Intergenic
995747549 5:115419329-115419351 GAGGAAAGGGAGAGGTGGACAGG + Intergenic
997825226 5:137100319-137100341 AGGGACAAGGAGAGGTGGAATGG - Intronic
997859179 5:137400964-137400986 CAGCACATGAAGGGGTGGGCGGG - Intronic
999766980 5:154748591-154748613 CAGGACAAGTGGAAGTGGAAAGG + Intronic
1001495276 5:172183871-172183893 CAGGAGAAAAAGAGGAGGATAGG - Intronic
1002638582 5:180619904-180619926 GAAGACAAGGAGAGGTGGACAGG + Intronic
1002724879 5:181288191-181288213 CGGGAATAGAAGGGGTGGACAGG + Intergenic
1003149616 6:3537670-3537692 CTGGACAAGCACAGGTGGCCTGG + Intergenic
1003799246 6:9643685-9643707 CTGGAGAATAAGAGGTGGGCAGG + Intronic
1003866248 6:10365613-10365635 CAGGCCACCAAGAGGTGGAAAGG + Intergenic
1006798294 6:36744401-36744423 TAGGACAGGAAGGGGTGGGCAGG + Intronic
1007178775 6:39913629-39913651 CAGGGAGAGAAGAGGTGGAAGGG + Intronic
1007280431 6:40708388-40708410 CAGAAGAAAAAGAGGTGGAGGGG + Intergenic
1007406135 6:41637374-41637396 CGGGACTAGAAAAGGTGGCCTGG + Intronic
1007608432 6:43132706-43132728 AAGGTCAAGGAGAGGTGGAGGGG + Intronic
1008067014 6:47060967-47060989 CAGGACTTGAAGAGCTGGAGAGG - Intergenic
1008759613 6:54837916-54837938 TAGGACAAGGAGAGGTGGGAGGG + Intergenic
1010332743 6:74643582-74643604 CAGGACAATAATAGCAGGACAGG + Intergenic
1010381600 6:75231780-75231802 GTGGACAAGAAGGGGTGGGCGGG + Intergenic
1011391389 6:86857754-86857776 AAGGACAAGGATATGTGGACTGG + Intergenic
1012889486 6:104882422-104882444 CAGAGCAAGAAGAGATTGACAGG - Intergenic
1014681356 6:124434124-124434146 CAGGAAAACAAAAGGTGGAGAGG + Intronic
1015091260 6:129362181-129362203 CAGGAAAGGGAGAGATGGACGGG - Intronic
1015889513 6:137955486-137955508 CAGGGCAAGAAGAAGAGGGCGGG + Intergenic
1018398892 6:163402774-163402796 CAGGGCAAGAACTGGTGCACAGG + Intergenic
1018741836 6:166735136-166735158 CAGGATAAGAAGAGCTGGAAGGG + Intronic
1018972868 6:168540646-168540668 CAGGACAACATGAGGGTGACAGG - Intronic
1021017940 7:15558927-15558949 CAGGACAAGAAGAAATGGGTGGG + Intronic
1022035945 7:26534789-26534811 CAGGAGAGGAAGAGGAGGCCTGG - Exonic
1022404859 7:30079356-30079378 GAGGCGAAGAAGACGTGGACAGG + Exonic
1023252258 7:38277377-38277399 GAGGACAAGAAGAGATTGAGCGG - Intergenic
1023344866 7:39261205-39261227 CAGGAGCAGGAGAGGTGGCCTGG - Intronic
1023459357 7:40378188-40378210 AAGGAGGAGAAGAGGAGGACAGG - Intronic
1023607565 7:41943867-41943889 CAGAAGAGGAAGAGGTGGAGAGG - Intergenic
1023828851 7:44027957-44027979 CAGGGCCAGAAGAGAGGGACAGG + Intergenic
1028869699 7:95755804-95755826 CAGGACAAGAGTAGGTGGCAGGG + Intergenic
1029739151 7:102482214-102482236 CAGGGCCAGAAGAGAGGGACAGG + Intergenic
1029757152 7:102581393-102581415 CAGGGCCAGAAGAGAGGGACAGG + Exonic
1029775092 7:102680454-102680476 CAGGGCCAGAAGAGAGGGACAGG + Intergenic
1031515580 7:122694204-122694226 CTGGAAAAGAAGAGATGGACTGG + Intronic
1032400454 7:131620669-131620691 CAGGAAAGGAAGAGGAGGCCTGG - Intergenic
1033216297 7:139495923-139495945 GAGGACAGGCAGAGGTGGCCAGG - Intergenic
1033359278 7:140626638-140626660 GAGGAAAGGAAGAGGAGGACAGG - Intronic
1033813001 7:145039452-145039474 TTGGACAAGAAGAAGTGGTCAGG + Intergenic
1036218134 8:6897640-6897662 CAGGCCTAGAATAGGTGGAAGGG - Intergenic
1036801786 8:11797901-11797923 TAGTACAAGAATGGGTGGACAGG + Intronic
1037779196 8:21856117-21856139 CAGGAAAAGCAGAGATGCACCGG + Intergenic
1038028569 8:23615844-23615866 GAGGACAAGAAAAGGAGGACTGG - Intergenic
1038265932 8:26040120-26040142 CAGGAAAGGAAGATGTGGAGAGG + Intronic
1039417186 8:37405778-37405800 GAGGACAAGAAGAGTTGAAAAGG - Intergenic
1039443427 8:37611471-37611493 CAGAGCAGGAAGAGGGGGACAGG + Intergenic
1041360635 8:57049763-57049785 CAGGACAAGAACTTGGGGACTGG + Intergenic
1042661317 8:71157689-71157711 AAGGGCAAGAAGAGGAGAACTGG - Intergenic
1043182517 8:77103877-77103899 CAGGCAAAGAAGTGGTGGGCGGG - Intergenic
1043506876 8:80911123-80911145 GAGGACAAGGAGATGTTGACGGG + Intergenic
1045763133 8:105634417-105634439 CAGCACCAGAAGAGCTGGAATGG + Intronic
1051160213 9:14199259-14199281 CAGGACACAAAGAGGAAGACAGG + Intronic
1051257526 9:15230385-15230407 TAGGACTAGAGGAGGTGGAGTGG - Intronic
1051675126 9:19551385-19551407 CAGGGCTAGAAGAGATGGAGGGG + Intronic
1054352005 9:64025816-64025838 AAGTAAAAGAGGAGGTGGACAGG - Intergenic
1056549330 9:87638657-87638679 CAAGGCAGGAAGAGGTGGTCTGG + Intronic
1060276526 9:122186896-122186918 CAGGTCCAGGAGAGGCGGACAGG + Intronic
1060439668 9:123626941-123626963 CAGGAGAGGAAGAGGCAGACAGG + Intronic
1060943762 9:127558046-127558068 CAGGAAAAGAGGAGGGGGAAGGG - Intronic
1061073469 9:128326376-128326398 GAGGACAAGGAGAGGGGGAAAGG + Intronic
1061852241 9:133423075-133423097 CAAGACAAAAAGAGATGGATGGG - Intronic
1062117359 9:134816651-134816673 CAGGCCGGGAAGTGGTGGACTGG - Intronic
1062146352 9:134991932-134991954 CAGGAAAAGAAGGGGTGGTGGGG - Intergenic
1062617900 9:137406469-137406491 CAAGACAAACAGAGGTGGAGCGG - Intronic
1203696591 Un_GL000214v1:104213-104235 AAGTAAAAGAGGAGGTGGACGGG + Intergenic
1203552629 Un_KI270743v1:176815-176837 AAGTAAAAGAGGAGGTGGACGGG - Intergenic
1186001308 X:5014535-5014557 CAGGCCATGAAGAGGGGGAAGGG + Intergenic
1187070867 X:15886813-15886835 CAGGAAAATAAAAGCTGGACGGG - Intergenic
1187832571 X:23397793-23397815 CATCACAAGAAAAGGTGGAATGG + Exonic
1188663659 X:32791288-32791310 CAGGAAAAGCATAGGTGGGCTGG - Intronic
1189376010 X:40466851-40466873 GAGGACAAGAAGGGCTGGATTGG + Intergenic
1190685577 X:52869654-52869676 CAGGGCAAGCACAGGTAGACTGG + Intergenic
1190752599 X:53375253-53375275 CAGGACAGGCAGAGGTGGTCAGG - Exonic
1192116523 X:68416970-68416992 TACGAAAAGAGGAGGTGGACAGG + Intronic
1195709784 X:107764832-107764854 CAGAACAAGAAGAGTTGAGCAGG - Intronic
1197322328 X:125047962-125047984 CAGGACAAGAGGAGCAGGAAAGG + Intergenic
1197922359 X:131608865-131608887 CAGGCCAAGCAAAGGTGGACAGG - Intergenic
1199105583 X:143862870-143862892 CAGGAAAAGCAGAGGTAGAAGGG - Intergenic
1199594095 X:149493181-149493203 CAGGGGAAGAAGAGGTGGAAAGG + Intronic
1199699497 X:150365068-150365090 AAAGACAAGAAGAGGTGGGAGGG - Intronic
1200000100 X:153055970-153055992 GAGGACAAGAGCAGGTGAACAGG + Intergenic
1200003022 X:153071935-153071957 GAGGACAAGAGCAGGTGCACAGG + Intergenic
1200004701 X:153078074-153078096 GAGGACAAGAGCAGGTGCACAGG - Intergenic
1201288023 Y:12395554-12395576 CAGGAGGAGAAGGGGAGGACAGG + Intergenic