ID: 1089499902

View in Genome Browser
Species Human (GRCh38)
Location 11:118925769-118925791
Sequence GCCGCCCGGAGCCAGCCGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 216}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089499902_1089499911 5 Left 1089499902 11:118925769-118925791 CCGGCCGGCTGGCTCCGGGCGGC 0: 1
1: 0
2: 2
3: 23
4: 216
Right 1089499911 11:118925797-118925819 TGGTGCAGCGGCCCCGGGTCCGG 0: 1
1: 0
2: 1
3: 17
4: 272
1089499902_1089499908 -7 Left 1089499902 11:118925769-118925791 CCGGCCGGCTGGCTCCGGGCGGC 0: 1
1: 0
2: 2
3: 23
4: 216
Right 1089499908 11:118925785-118925807 GGGCGGCGGCGGTGGTGCAGCGG 0: 1
1: 0
2: 7
3: 70
4: 684
1089499902_1089499912 6 Left 1089499902 11:118925769-118925791 CCGGCCGGCTGGCTCCGGGCGGC 0: 1
1: 0
2: 2
3: 23
4: 216
Right 1089499912 11:118925798-118925820 GGTGCAGCGGCCCCGGGTCCGGG 0: 1
1: 0
2: 4
3: 25
4: 279
1089499902_1089499910 0 Left 1089499902 11:118925769-118925791 CCGGCCGGCTGGCTCCGGGCGGC 0: 1
1: 0
2: 2
3: 23
4: 216
Right 1089499910 11:118925792-118925814 GGCGGTGGTGCAGCGGCCCCGGG 0: 1
1: 0
2: 0
3: 34
4: 306
1089499902_1089499909 -1 Left 1089499902 11:118925769-118925791 CCGGCCGGCTGGCTCCGGGCGGC 0: 1
1: 0
2: 2
3: 23
4: 216
Right 1089499909 11:118925791-118925813 CGGCGGTGGTGCAGCGGCCCCGG 0: 1
1: 0
2: 3
3: 12
4: 200
1089499902_1089499913 7 Left 1089499902 11:118925769-118925791 CCGGCCGGCTGGCTCCGGGCGGC 0: 1
1: 0
2: 2
3: 23
4: 216
Right 1089499913 11:118925799-118925821 GTGCAGCGGCCCCGGGTCCGGGG 0: 1
1: 0
2: 1
3: 18
4: 174
1089499902_1089499917 23 Left 1089499902 11:118925769-118925791 CCGGCCGGCTGGCTCCGGGCGGC 0: 1
1: 0
2: 2
3: 23
4: 216
Right 1089499917 11:118925815-118925837 TCCGGGGCATGTCCAGCCACTGG 0: 1
1: 0
2: 0
3: 10
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089499902 Original CRISPR GCCGCCCGGAGCCAGCCGGC CGG (reversed) Intronic
900113578 1:1019683-1019705 GCGGCGCGGAGCCGGGCGGCAGG - Intergenic
900486262 1:2924217-2924239 GCCGCCCGAAGCCAGCTGGTGGG - Intergenic
900582455 1:3415770-3415792 GCAGCCCGGAGCCAGGAGGTGGG + Intronic
901007682 1:6179779-6179801 GCCGCGCGGCGCCAGCAGGGCGG + Intronic
901205967 1:7496094-7496116 GCCGCCAGGACCCAGAGGGCCGG + Intronic
902072114 1:13749221-13749243 GCCGCGCGCACCCGGCCGGCAGG - Intronic
903190207 1:21652004-21652026 GCCGCCCTGGGCCGGCCGGGCGG + Intronic
903750550 1:25617960-25617982 GCCCCCCGGACCCAGCAGCCTGG + Exonic
903811073 1:26035396-26035418 GGGGCCCGGCGCCTGCCGGCGGG + Exonic
904039377 1:27575435-27575457 GCCGCCCGGCCCCAGACTGCGGG - Intronic
904769016 1:32870757-32870779 GCCGCCCCGGGCCTGCCGGCCGG - Exonic
905865132 1:41372406-41372428 TCCCCCAGGAGCCAGCCTGCAGG + Intronic
906533969 1:46541197-46541219 GCTGCCTGGATCCAGCCGGAGGG + Intergenic
907422456 1:54356553-54356575 GCGGCCGGGAGCTAGGCGGCGGG + Intronic
907766938 1:57422318-57422340 GCAGCTCCTAGCCAGCCGGCGGG - Intronic
908473973 1:64470705-64470727 CGCGCCCGGAGCCCGTCGGCGGG + Intergenic
908796051 1:67832800-67832822 ACCTCCCGGGACCAGCCGGCGGG - Intronic
910759013 1:90717625-90717647 GCCGCCCGGTGCCAGGCTGTGGG - Intergenic
910981138 1:92961227-92961249 GCCGCCAGGTGCCGGACGGCAGG + Intronic
912358606 1:109075974-109075996 CCAGCTGGGAGCCAGCCGGCAGG - Exonic
912703562 1:111895799-111895821 TCTTCCCGGGGCCAGCCGGCTGG + Intronic
913586181 1:120277804-120277826 GCAGCATGAAGCCAGCCGGCTGG - Intergenic
913622005 1:120620565-120620587 GCAGCATGAAGCCAGCCGGCTGG + Intergenic
914568190 1:148889662-148889684 GCAGCATGAAGCCAGCCGGCTGG - Exonic
914604635 1:149240587-149240609 GCAGCATGAAGCCAGCCGGCTGG + Intergenic
916436722 1:164784377-164784399 GCCTCCCTGGGCCAGCTGGCAGG - Intronic
917797641 1:178543114-178543136 GCCGCCCAGTGCCTGCAGGCCGG - Intronic
920449545 1:206048845-206048867 TCCCCCCGGAGCCTGCTGGCTGG - Intronic
920647422 1:207813842-207813864 GCCTCCCACAGACAGCCGGCTGG + Intergenic
922241085 1:223755868-223755890 GCCCCCCACAGCCAGCCTGCAGG + Intronic
922461399 1:225816812-225816834 GGAGCCCCGAGCCAGCCCGCGGG - Intronic
922730681 1:227947574-227947596 GCGGCCCGGCGCAAGCCGGACGG + Intronic
1063504011 10:6580166-6580188 GCCGCCGGGAGGGAGCGGGCTGG - Intronic
1065367869 10:24952706-24952728 CCCGCCCCGGGCCCGCCGGCGGG + Intergenic
1065727104 10:28677343-28677365 GCCGCTCGGAGCCGCCGGGCAGG + Exonic
1066179325 10:32944306-32944328 GCCGCCCAGGCCCAGCCAGCTGG - Intronic
1066966831 10:42274836-42274858 CCAGCCTGGAGCCAGCCGACAGG - Intergenic
1067853281 10:49768878-49768900 GCCGCGCGGATCCGGCCTGCTGG - Intergenic
1069774335 10:70918055-70918077 GCAGCCCGGAGACAGCAGCCGGG - Intergenic
1073137671 10:101228853-101228875 GCCGCGGGGACCCAGCCCGCGGG + Exonic
1073241996 10:102065302-102065324 GCATCCCGGAGCCGGCCGGGCGG + Intergenic
1073266387 10:102230736-102230758 GGCGGCCGGAGCCAGCCCGGGGG + Exonic
1074377385 10:112951299-112951321 GCCGCCCGGAGCCGCCCCCCGGG + Intronic
1076922262 10:133460106-133460128 GCCGCCCCCAGCCCGCCGACGGG - Intergenic
1077216474 11:1397240-1397262 GCTGCCCTGAGCCAGCTGCCTGG + Intronic
1077306556 11:1871253-1871275 GCCGCCGGGATGCAGCAGGCAGG + Intronic
1077337617 11:2012472-2012494 GAAGCCCGGAGCCGGCCGCCGGG + Intergenic
1077342659 11:2032981-2033003 GCTCCCCGGAGCCTGCCTGCCGG + Intergenic
1077386442 11:2271502-2271524 GCCGCCCAGAGCCCTCAGGCCGG - Intergenic
1080606822 11:33870473-33870495 GCAGCCCGGAGCCCGCAGCCTGG - Intronic
1080606827 11:33870487-33870509 GCAGCCCGGAGCCCGCAGCCCGG - Intronic
1081938074 11:46918408-46918430 GCCGTCCGGCGGGAGCCGGCGGG - Exonic
1082029482 11:47594186-47594208 GCAGCCCGGAGCCAGATCGCGGG - Exonic
1083445576 11:62706228-62706250 GCAGCCCTGTGGCAGCCGGCGGG - Intronic
1083659791 11:64246735-64246757 GCTAACCCGAGCCAGCCGGCGGG - Exonic
1083933480 11:65858324-65858346 GCAGCTCGGAGCCGGCCGGCGGG - Exonic
1084562175 11:69911266-69911288 CCTGCCCGGAGCCTGCGGGCTGG - Intergenic
1084945646 11:72636974-72636996 TCCCCCCGGACCCAGCCGGCTGG + Intronic
1084945656 11:72636985-72637007 GCCCCTGGGTGCCAGCCGGCTGG - Intronic
1088972993 11:114789903-114789925 TCTGCCCGGAGCCACCTGGCAGG + Intergenic
1089257477 11:117201476-117201498 GCTGCCCGGAGCCAGGCTCCTGG - Intronic
1089387865 11:118079759-118079781 GCAGTCAGGAGCCAGCCTGCGGG + Intronic
1089499902 11:118925769-118925791 GCCGCCCGGAGCCAGCCGGCCGG - Intronic
1202820601 11_KI270721v1_random:67654-67676 GAAGCCCGGAGCCGGCCGCCGGG + Intergenic
1202825645 11_KI270721v1_random:88170-88192 GCTCCCCGGAGCCTGCCTGCCGG + Intergenic
1097264491 12:57737773-57737795 GCGGCCCGGAGCCCGAAGGCCGG - Exonic
1098029052 12:66235418-66235440 GCCGCGCGGCGGCGGCCGGCGGG + Intronic
1103659316 12:122500934-122500956 GCCGCACGGAGCCACCCGCTAGG + Intergenic
1104049457 12:125186179-125186201 GGCTCCCGGAGCCTCCCGGCCGG + Intergenic
1105409776 13:20161556-20161578 CCCGCCCCGCGCCAGCCGTCCGG - Intergenic
1108518226 13:51222415-51222437 GCCGCCCAGTCCGAGCCGGCCGG - Exonic
1113803267 13:113097095-113097117 GCTGCCCGGCGCCTGCCGCCCGG - Intronic
1116919847 14:50560775-50560797 GCCGCCCGCCGCCCGCCGCCGGG - Intronic
1117353481 14:54902558-54902580 GCGGCCCGGGCCCAGCAGGCCGG - Exonic
1118868396 14:69721093-69721115 GCCTCCTGCAGTCAGCCGGCAGG - Intergenic
1121643252 14:95500472-95500494 GCCGCCCACAGCCAGGCAGCAGG + Intergenic
1122228222 14:100291904-100291926 ACCCCCGGGAGCCAGCCTGCAGG + Exonic
1122418422 14:101561130-101561152 GCGGGCCGGAGCCAGGCGGCGGG + Intergenic
1122541375 14:102499521-102499543 GCCACTCGGAGCCAGCCCGCAGG - Exonic
1122692685 14:103538696-103538718 GCACCCCGGAGCCAGCGGGTTGG + Intergenic
1123108472 14:105854311-105854333 GCCGCCCCGAGCCTGTGGGCAGG + Intergenic
1124922277 15:34038801-34038823 GCCGCCGGGAGCCGGGAGGCTGG - Exonic
1126688309 15:51267269-51267291 ACCGACCGCAGGCAGCCGGCTGG - Intronic
1126777456 15:52112241-52112263 GCCGCCCTGAGCCTGCAGCCAGG + Exonic
1128264312 15:66253707-66253729 GCAGCCGGGAGCCGGGCGGCGGG + Exonic
1129158271 15:73732403-73732425 ACTGCCCGGGGCCGGCCGGCCGG + Intergenic
1131215123 15:90529960-90529982 GCCGCCCGAAGCCAGTCGTCCGG - Intronic
1131215302 15:90530548-90530570 GCCGCGCCGCGCCACCCGGCCGG - Intronic
1132656487 16:1043811-1043833 GTAGCCCGAAGCCGGCCGGCAGG + Intergenic
1133156615 16:3880578-3880600 GCCGGGCGGAGCGGGCCGGCCGG + Exonic
1136261803 16:29082325-29082347 GCGGCCCCGAGTCCGCCGGCCGG - Intergenic
1138492124 16:57382847-57382869 GCCACCCGGAGGCAGGCGGTGGG + Exonic
1138595239 16:58026137-58026159 GGAGCTCGGAACCAGCCGGCGGG - Exonic
1139451226 16:67029333-67029355 TCAGCGCGGAGCCAGCCAGCGGG + Exonic
1139547133 16:67654577-67654599 GCAGCCCTGACCCTGCCGGCAGG + Exonic
1141858660 16:86701753-86701775 GCCGGCCACAGCCAGCAGGCCGG + Intergenic
1141965307 16:87438216-87438238 CACGCCCCGACCCAGCCGGCTGG + Intronic
1142124690 16:88404346-88404368 GCCGCCCAGGGCCAGTCTGCCGG - Intergenic
1142434214 16:90046906-90046928 GCCGCCCTGAGACAGATGGCGGG - Intergenic
1142685369 17:1574597-1574619 GCCCCACGGAGCCCGCCGGCAGG + Exonic
1144185152 17:12789771-12789793 GCAGCCCGGAGCCCGCCGCAGGG - Exonic
1147184231 17:38705130-38705152 CCCGCCCGCCGCCAGCCGCCGGG - Intergenic
1148188966 17:45665646-45665668 GAAGCCCGGAGACAGCCAGCAGG + Intergenic
1148463455 17:47851038-47851060 GCCGCCTGCCGCCAGCCGCCGGG - Exonic
1148788784 17:50161397-50161419 GCCGCACGGAGGCAGGGGGCTGG - Intergenic
1151414582 17:73952919-73952941 GCCGGCCGGAGGGAGCCGGCAGG - Intergenic
1151662508 17:75526112-75526134 GCCCCCCGCACCCAGCCGGCCGG - Intronic
1152111368 17:78359359-78359381 GCTGCCCGGGGCCACCCTGCCGG - Intronic
1152356377 17:79809681-79809703 GCGGCCTGGAGCCAGCCAGGTGG - Intergenic
1152438186 17:80288768-80288790 GCCTCCTGGAGCCGGCAGGCAGG - Intronic
1152532331 17:80925947-80925969 GCCGCCCTGCCCCAGCCTGCAGG - Intronic
1152586394 17:81191364-81191386 GCCACCCGGAGCCGGCCCGCGGG + Intronic
1152834334 17:82519758-82519780 GCCGAGCGGAGGCCGCCGGCCGG - Exonic
1158435711 18:57434736-57434758 GCCGCCCGTGGGCCGCCGGCCGG + Intergenic
1158836194 18:61333878-61333900 GGCGCGCGGAGCCAGCCCTCTGG + Intronic
1160717862 19:584543-584565 GCCGCCTGGTGGCAGCCGGCAGG - Intergenic
1160769086 19:822242-822264 GCCGACCGCAGCCACCCGGGAGG - Intergenic
1160789868 19:918419-918441 GCCTCCCTGAGCCATCCTGCTGG + Intronic
1160811483 19:1014801-1014823 GCCGGACGAAGCCAGCAGGCCGG + Intronic
1160929115 19:1561405-1561427 GCCGCCCCCAGCCAGGCAGCCGG + Intronic
1161103094 19:2430992-2431014 CCAGCCTGGAGGCAGCCGGCAGG + Intronic
1161569214 19:5021171-5021193 GCCGCCCGAAGCCTGCAGCCAGG - Intronic
1161694356 19:5757795-5757817 GCTGTACGGAGCCAGCAGGCAGG - Intronic
1163404978 19:17116509-17116531 GCATCCCGGAGTCAGGCGGCTGG + Intronic
1163494637 19:17639178-17639200 CCCGCCCCGAGCCAGCCAGGTGG - Exonic
1163528545 19:17835969-17835991 GCCACCTGGTGCCAGCCAGCTGG - Exonic
1163692943 19:18746951-18746973 GCCGACCCCAGCCAGCCAGCCGG + Intronic
1165036379 19:33036741-33036763 ACTGCCCGGGGCCAGCGGGCCGG - Intronic
1165157740 19:33798059-33798081 CCGCCGCGGAGCCAGCCGGCCGG - Intronic
1165349602 19:35268816-35268838 GCCGCCCGGAGCCGGCGGGCGGG + Intergenic
1166108816 19:40610635-40610657 ACCGCACGGAGCCAGCTGCCAGG + Exonic
1167008107 19:46788364-46788386 GCCTCCCGGATCCAGGCGTCCGG - Exonic
1167070813 19:47221233-47221255 TCTTCCCTGAGCCAGCCGGCGGG - Exonic
1167643626 19:50694848-50694870 GCGGGCCGGGGCCTGCCGGCCGG + Intronic
1167792187 19:51689519-51689541 GCCGCCCCGGGCCCGCAGGCCGG - Intergenic
1168016528 19:53578118-53578140 GCTGTCCGGCTCCAGCCGGCCGG + Exonic
925090501 2:1151298-1151320 ACCCCCCGGAGGCAGCCCGCCGG - Intronic
925169653 2:1743414-1743436 TGCGCCCGGAGCGAGCCGGGCGG - Intronic
925245258 2:2376973-2376995 GCTGCACAGAGCCAGCAGGCAGG + Intergenic
925730669 2:6917759-6917781 GGCGCCCGGTGGCAGCGGGCGGG + Intronic
926166891 2:10526607-10526629 GCCGCCCGCAGCAGGCGGGCAGG - Intergenic
927884520 2:26710317-26710339 GCAGCCAGGAGCGAGCTGGCAGG + Intronic
929452824 2:42048164-42048186 GCCGCGCGGGGCCGGCCGGCCGG + Exonic
929966729 2:46542552-46542574 GCCGCGCGGCGGCAGCAGGCGGG + Intronic
930798710 2:55420081-55420103 GCCGCCCAGATCCTGGCGGCGGG + Intergenic
934559241 2:95303764-95303786 GCTGCCCCAAGCCTGCCGGCTGG + Intronic
934709686 2:96506824-96506846 GCCACCCAAAGCCAGCAGGCTGG + Intronic
937343184 2:121104911-121104933 GCCACCATGAGTCAGCCGGCTGG + Intergenic
940962214 2:159798185-159798207 GCGGCCCGGAGCATGACGGCGGG + Exonic
941020968 2:160407659-160407681 GCCGCGCGGCGGCGGCCGGCGGG + Intronic
941295696 2:163736337-163736359 GCCGCGCCGCGCCGGCCGGCCGG + Intergenic
942151074 2:173076175-173076197 GGCGGCCGGAGCGAGCGGGCGGG + Intronic
945241569 2:207681506-207681528 GCTAACCCGAGCCAGCCGGCGGG + Intergenic
947651039 2:231786476-231786498 GCCTCCCGGCGCCTGCCCGCAGG - Exonic
948116148 2:235495158-235495180 GACGCCTGGGGGCAGCCGGCGGG + Intronic
948402215 2:237692294-237692316 GGGGCCAGGAGCCAGCCCGCCGG - Intronic
948578499 2:238969146-238969168 GCCGCCCGCAGCCTGCCAGGAGG + Intergenic
948886818 2:240888828-240888850 GCCTTCGGGAGCCAGCAGGCTGG - Intronic
948910384 2:240999509-240999531 GCGGCCCAGAGCCAGGAGGCTGG + Intronic
948933852 2:241149860-241149882 GCGCCCCGGAGCCAGCCAGCTGG + Intronic
1169557608 20:6767624-6767646 GCGGCCGGGAGGGAGCCGGCAGG + Intergenic
1172872639 20:38145189-38145211 GCTGCCCTGACCCAGCCTGCTGG + Intronic
1173007381 20:39150699-39150721 GCCTCCCCGGGCCAGCAGGCAGG - Intergenic
1173143702 20:40506708-40506730 GCCGCATGGGGCCAGCCAGCAGG + Intergenic
1173516355 20:43667623-43667645 GCCGGCCGGTGTCAGCTGGCAGG + Intronic
1174365742 20:50055201-50055223 GCCGCCTGGCTCCAGCCTGCTGG + Intergenic
1175428875 20:58889237-58889259 GCAGCCCGGAGCCAGAGAGCAGG - Intronic
1175767595 20:61601987-61602009 GCCGCCCAGAGCCAAGCTGCAGG + Intronic
1175874008 20:62220905-62220927 GCCGGGCGGACCCAGCCGGAGGG + Intergenic
1175916130 20:62426919-62426941 GCCTCAGGGAGCCAGCCGGCAGG - Intronic
1176240310 20:64072841-64072863 GCCGCCCAGGCCCAGCCGGACGG - Intergenic
1178692361 21:34760509-34760531 CCAGCCAGGAGCCAGCCTGCTGG - Intergenic
1179802392 21:43817075-43817097 CCCGGCCGGAACCAGCAGGCAGG + Intergenic
1180184339 21:46132000-46132022 GCCGCTCGGAGCCGTCCAGCAGG - Exonic
1180226035 21:46393091-46393113 GCCGCCCTGAGCCCGGCAGCAGG - Intronic
1181030511 22:20147133-20147155 GCCCCCTGGAGCCAGGCCGCCGG + Exonic
1181051940 22:20242022-20242044 GCCGCCCGGTGACAGCCCGCCGG - Exonic
1181457954 22:23070344-23070366 GCCGCCCGCCGCCAGTCCGCGGG - Exonic
1182548978 22:31090995-31091017 CCCGCACAGAGCCAGCCCGCTGG - Exonic
1182576487 22:31276606-31276628 GCTAACCTGAGCCAGCCGGCGGG + Intronic
1183520613 22:38294341-38294363 GCCTCCCGCATCCAGCCGGCTGG - Exonic
1183972496 22:41488323-41488345 GCTGCCAGGAGGCAACCGGCAGG - Intronic
1184796952 22:46738230-46738252 GCCGCCCGCCGCCCGCCGCCCGG - Exonic
1184970500 22:48016515-48016537 GCTGACCTGAGCCAGCCGCCAGG - Intergenic
1185315706 22:50178324-50178346 GCCTCCCGGAGCCAGGAGGGGGG + Exonic
950404562 3:12796689-12796711 GCGCCGCGGAGCCGGCCGGCGGG - Exonic
952947663 3:38490262-38490284 GCAGCCTGAAGCCAGCGGGCAGG - Exonic
954778860 3:53045316-53045338 CCCGCCCGGAGCGAGCCCGGGGG + Intronic
960702310 3:120450817-120450839 GGCGGCCGGAGCGAGCCTGCGGG - Intronic
961446230 3:126983018-126983040 GCCGCCCAGAGCCCGGGGGCGGG - Intergenic
961665759 3:128492493-128492515 GGCGCACGGGACCAGCCGGCAGG + Intronic
964431056 3:156606233-156606255 GCGGTGGGGAGCCAGCCGGCCGG + Intergenic
967859613 3:194141323-194141345 GCCGCCCGGGGCCCTCCGCCCGG + Intergenic
969032812 4:4227430-4227452 GTCTCCCGGAGCCAGCCCGAGGG + Intergenic
973531814 4:51843287-51843309 GCCGCCCGGCCCCGGCCCGCTGG - Intronic
975633022 4:76421045-76421067 GCCGCCCCGTCCCAGCCGCCAGG - Intronic
977809951 4:101347023-101347045 GCAGCCCGGAGCGAGTCGGCGGG - Exonic
978795718 4:112705911-112705933 GCGGCCCCGAGTCCGCCGGCCGG + Intergenic
979785660 4:124712747-124712769 GCGGGGCGGAGCCGGCCGGCCGG - Intergenic
984146355 4:176065954-176065976 GGCGCCCTGAGCGAGCAGGCGGG + Intronic
986661734 5:10065587-10065609 GCCGGCCGGCCCCAGCGGGCCGG + Intergenic
988470417 5:31532298-31532320 TCCGCCCGGAGAGAGCTGGCCGG + Exonic
996442995 5:123512612-123512634 GCCGCGCCGAGGCAGCCGCCGGG - Intronic
997265214 5:132491106-132491128 GGCCCCAGGAGCCAGCCGGCTGG - Intergenic
999736523 5:154517382-154517404 GTGCCCAGGAGCCAGCCGGCTGG - Intergenic
1002926798 6:1609766-1609788 GCCTCCGGGAGCGGGCCGGCAGG + Intergenic
1003290652 6:4776208-4776230 GGGGCCGGGAGCGAGCCGGCAGG - Intronic
1005701040 6:28400155-28400177 GCCGGCAGAAACCAGCCGGCTGG - Intergenic
1006369194 6:33633779-33633801 GACGCCCGGAGCTCGCGGGCCGG + Intronic
1006423360 6:33949128-33949150 GCAGCGTGGGGCCAGCCGGCTGG - Intergenic
1008555660 6:52670999-52671021 GCCGCCCGGATTCAGCCGGAGGG + Intergenic
1010032969 6:71289091-71289113 AGCCCCCGGAGCAAGCCGGCGGG + Exonic
1012912901 6:105137233-105137255 GCCGCCCCGCGCCCCCCGGCGGG + Intergenic
1014844480 6:126258393-126258415 GCCACCAGGAGCCAGGCAGCTGG - Intergenic
1016330048 6:142945797-142945819 GCGGCCCGGAGGCGGGCGGCCGG - Intergenic
1017158252 6:151341639-151341661 GGCGCGCGCAGCCCGCCGGCAGG - Intronic
1018892038 6:167989539-167989561 GCCTCCGGGAGGCAGCAGGCAGG - Intergenic
1019474413 7:1236929-1236951 GGCGGCCGGACCCAGCCCGCCGG + Exonic
1019778998 7:2928920-2928942 GCAGGCGGGAGCCGGCCGGCTGG + Intronic
1027132280 7:75599418-75599440 GCTCCCAGGAGCCAGCTGGCTGG + Intronic
1029640270 7:101815951-101815973 GCCGCCAGGAGGCAGCAGGCGGG - Intronic
1031977925 7:128105486-128105508 GGCCCCAGGTGCCAGCCGGCAGG + Intergenic
1034223070 7:149460400-149460422 GCCGCCGGGACGCAGCCGGCCGG - Intronic
1034448611 7:151125934-151125956 GCCGTGCGCAGCCGGCCGGCCGG + Intronic
1035566317 8:643543-643565 GCTGCCAGGGCCCAGCCGGCAGG - Intronic
1035747621 8:1973708-1973730 GCCGCGCGGAGCCAGCGCTCCGG - Intergenic
1036645538 8:10609639-10609661 GCCGCCCGGAGCCACCATGATGG - Exonic
1037143011 8:15540330-15540352 GCCTCCGGGAGCCCGCTGGCTGG - Exonic
1039903278 8:41767704-41767726 CCCGCCCCGAGCCCGCCGGCCGG - Intronic
1044542245 8:93420987-93421009 GCAGCCCTGAGCCAGCAGGGAGG + Intergenic
1045336195 8:101205895-101205917 GCCGCCCGGACCGAGCGCGCCGG - Intronic
1048852971 8:138662033-138662055 GCCCCCAGGGCCCAGCCGGCCGG - Exonic
1048941650 8:139405368-139405390 GCCGCCTGGAGGCAACTGGCTGG - Intergenic
1049105201 8:140608507-140608529 GCTGCCCGCAGCCGGCAGGCAGG + Intronic
1049109613 8:140635149-140635171 CCCGCCCGGGGCCCGCGGGCTGG - Intronic
1049509264 8:143019308-143019330 CCCGGAGGGAGCCAGCCGGCAGG - Intronic
1051449412 9:17178642-17178664 ACTGCCCGGGGCCTGCCGGCTGG + Intronic
1056856585 9:90134905-90134927 GCAGCCCGCAGCCAGCGGGATGG - Intergenic
1061285828 9:129621932-129621954 GCGGCCCAGAGGCAGCCGGGAGG - Intronic
1062045066 9:134421235-134421257 GCCTCCAGGAGCCAGCCGGCAGG - Intronic
1062364557 9:136202660-136202682 GCAGCCCGGAGCCAGCTCCCTGG - Intronic
1203781969 EBV:105774-105796 GGCGCCCGGTGCCAGAAGGCCGG + Intergenic