ID: 1089499913

View in Genome Browser
Species Human (GRCh38)
Location 11:118925799-118925821
Sequence GTGCAGCGGCCCCGGGTCCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 174}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089499907_1089499913 -7 Left 1089499907 11:118925783-118925805 CCGGGCGGCGGCGGTGGTGCAGC 0: 1
1: 0
2: 4
3: 25
4: 237
Right 1089499913 11:118925799-118925821 GTGCAGCGGCCCCGGGTCCGGGG 0: 1
1: 0
2: 1
3: 18
4: 174
1089499896_1089499913 23 Left 1089499896 11:118925753-118925775 CCAGGCGTGCGGGCGTCCGGCCG 0: 1
1: 0
2: 0
3: 8
4: 127
Right 1089499913 11:118925799-118925821 GTGCAGCGGCCCCGGGTCCGGGG 0: 1
1: 0
2: 1
3: 18
4: 174
1089499904_1089499913 3 Left 1089499904 11:118925773-118925795 CCGGCTGGCTCCGGGCGGCGGCG 0: 1
1: 0
2: 2
3: 33
4: 261
Right 1089499913 11:118925799-118925821 GTGCAGCGGCCCCGGGTCCGGGG 0: 1
1: 0
2: 1
3: 18
4: 174
1089499902_1089499913 7 Left 1089499902 11:118925769-118925791 CCGGCCGGCTGGCTCCGGGCGGC 0: 1
1: 0
2: 2
3: 23
4: 216
Right 1089499913 11:118925799-118925821 GTGCAGCGGCCCCGGGTCCGGGG 0: 1
1: 0
2: 1
3: 18
4: 174
1089499895_1089499913 24 Left 1089499895 11:118925752-118925774 CCCAGGCGTGCGGGCGTCCGGCC 0: 1
1: 0
2: 0
3: 6
4: 71
Right 1089499913 11:118925799-118925821 GTGCAGCGGCCCCGGGTCCGGGG 0: 1
1: 0
2: 1
3: 18
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089499913 Original CRISPR GTGCAGCGGCCCCGGGTCCG GGG Intronic
900201232 1:1407559-1407581 GGGCAGCGGACCCGGGTCGGGGG + Intergenic
900307892 1:2019805-2019827 GTGGAGGGTCCCCGGGTCCGCGG + Intronic
904081001 1:27872570-27872592 CTGCAGCGGCACCGGCTCCATGG - Exonic
904500141 1:30908566-30908588 GTGCGGCGGCCCCGGCTTCATGG + Exonic
904578916 1:31525122-31525144 GTACAGAAGCCCCGGGTCTGGGG - Intergenic
904938895 1:34151257-34151279 GTGCAGTGGCCCTGGGTTGGGGG - Intronic
905369204 1:37474401-37474423 GCGCAGCGGCCGCGGGGGCGGGG + Intergenic
914239829 1:145846043-145846065 GAGGAGCGGCCCAGGGTCCCTGG + Exonic
915333249 1:155126435-155126457 GGCCAGGGGCCCCGGGTCCGTGG + Intergenic
918044783 1:180935354-180935376 GCGCAGGGGGCCCTGGTCCGCGG - Exonic
920418394 1:205813409-205813431 GCCCATCGGCCCGGGGTCCGAGG + Intronic
1068083374 10:52346890-52346912 GTGCAGGGGCCCCTGGACGGTGG + Intergenic
1069687915 10:70330951-70330973 GTTCAGGGTCCCCGGGTCCCCGG - Intronic
1071966520 10:90857834-90857856 CCGCAGCGGCCGGGGGTCCGGGG - Intergenic
1076306136 10:129467000-129467022 GTGCGGCGGCGCCGGGCCTGAGG - Intergenic
1076706134 10:132302554-132302576 CTGCAGAGGCCCCTGGTCTGGGG - Intronic
1076717740 10:132374924-132374946 TTGCAGGGGCCCCGGGGCAGCGG + Intronic
1076856076 10:133116148-133116170 GGGCAGCGGCCCAGGGTAGGGGG - Intronic
1076916407 10:133424776-133424798 GTGGAGCGGGGCCGGGTGCGGGG - Intergenic
1076920013 10:133446416-133446438 GTGAGGCGGACCCGGGGCCGTGG - Intergenic
1076936514 10:133569571-133569593 GTGGAGCGGAGCCGGGTGCGGGG - Intronic
1077159814 11:1107581-1107603 GTGCAGTGGCCCCGGGGGCTTGG + Intergenic
1077285484 11:1763578-1763600 GTGCAGGGGACCCGGGGCAGAGG - Intronic
1077502182 11:2914400-2914422 GTGCAGAGGCCCCAGGGCTGGGG + Intronic
1077505888 11:2929793-2929815 GTGGGCCGGCCCCGGGCCCGCGG - Intergenic
1077575349 11:3378914-3378936 CTGGAGGGGCCTCGGGTCCGCGG + Intronic
1079362002 11:19777280-19777302 CAGCAGCGGCCCCGGGGCGGGGG + Intronic
1080896635 11:36453735-36453757 GTACAGGGGCCACGGGTCCCAGG + Intronic
1081612205 11:44569267-44569289 TTGCAGAGGCCCCGGGTCTGTGG - Intronic
1082814584 11:57499671-57499693 GAGCAGCGGCCCAGGGGGCGGGG + Intronic
1083707877 11:64529229-64529251 GTGCTGAGACCCTGGGTCCGGGG - Intergenic
1083800134 11:65041735-65041757 CTGCAGCAGCACCGGGTCCGCGG - Exonic
1083901969 11:65647566-65647588 GGGCAGCGGCCTCGGGCCGGAGG - Exonic
1084888097 11:72223770-72223792 GGCCAGCGGCTCCGGGACCGAGG + Intronic
1089499913 11:118925799-118925821 GTGCAGCGGCCCCGGGTCCGGGG + Intronic
1090943527 11:131409623-131409645 GTGCAGCGGCACGGGGGCAGGGG + Intronic
1091226049 11:133956939-133956961 GTGCCGCTGCGCCGGGGCCGGGG - Exonic
1096512595 12:52139647-52139669 GTGCAGTGGCACCGGGCCCTGGG - Intergenic
1098403145 12:70095117-70095139 GTGCAGTTGCCCAGGGTCCTGGG - Intergenic
1102973621 12:117190462-117190484 GCGCGGCGGCCCCAGGTACGCGG - Intronic
1103983545 12:124752163-124752185 GTGCAGCCGCCCCGCGGCCACGG - Intergenic
1104947598 12:132423556-132423578 GAGCAGCGGCCCCGGGAGGGCGG + Intergenic
1105022885 12:132828884-132828906 GTGCATCGGCCTCGGGTCCCCGG + Intronic
1107437374 13:40391976-40391998 GTGCAGCTGCTCCGGGGCCGTGG - Intergenic
1108615618 13:52129074-52129096 GCGCAGCGGCCCCGGGAACCCGG - Exonic
1112733692 13:102394694-102394716 GGGCAGCGGCGGCGGGACCGGGG + Intronic
1113676240 13:112209705-112209727 CTGCAGGGGCCCCGGCTCTGGGG - Intergenic
1113904953 13:113814882-113814904 GTGCTGTGGCCCCGGGGCAGGGG + Exonic
1113923541 13:113928175-113928197 GTGCAGGGGCCGCGGCTCCTGGG - Intergenic
1113967647 13:114163513-114163535 GTCCAGCTGCCCTGGGTCTGTGG - Intergenic
1114618494 14:24081259-24081281 CTCGAGCGGCCCCGGGTCCGGGG - Exonic
1118332247 14:64823673-64823695 GTGCAGCTGCCCCGGGCTGGTGG - Intronic
1118493856 14:66288454-66288476 GTTCAGAGGCCCCTGGTCCCTGG + Intergenic
1121828894 14:97033282-97033304 CTGCTGCGGCCCCGGGGCGGCGG - Intergenic
1122825578 14:104368929-104368951 GGGCAGTGGCCCAGGGTCTGTGG + Intergenic
1123631012 15:22259287-22259309 CTGCAGGGGCCCTGGGTCCGAGG + Intergenic
1128075671 15:64823943-64823965 TGGCTGCGGCCCCGGGTCCCGGG - Exonic
1128635308 15:69298942-69298964 GTGCAGGGCCCGCGAGTCCGGGG + Exonic
1128987178 15:72230352-72230374 GTGCTGAGGCCCCGTGTCCGGGG - Intronic
1130540353 15:84817371-84817393 GGGCAGGGGCCCGGGGGCCGGGG + Exonic
1131085898 15:89575557-89575579 GTGCCGCCGCCCCGGGGCCCCGG - Exonic
1132055884 15:98649833-98649855 CTGCAGCGGACCCGGGACCCGGG + Intronic
1132897920 16:2237661-2237683 CTGCAGGGACCCCGGGACCGAGG - Intronic
1133706879 16:8363342-8363364 ATGCAGTGGCCCAGGGTCCAGGG - Intergenic
1136505195 16:30698588-30698610 GCGCACCGGCCCCGGGGCCCCGG - Intronic
1136579458 16:31142849-31142871 CTGCAGCAGCGCCAGGTCCGAGG + Exonic
1137677219 16:50309651-50309673 GTGCGCCGGGCCCGGCTCCGTGG + Intronic
1137731466 16:50693572-50693594 GGGCTGCGGCTCCGGGTGCGCGG - Intergenic
1140091934 16:71846010-71846032 GTGGGGCGGCTCCGGGGCCGGGG + Exonic
1140326257 16:74005928-74005950 GTGCAGCTGCCCTGCGGCCGAGG + Intergenic
1141972012 16:87491219-87491241 CTGCAGGGGCCCTGGGTCCGAGG - Intronic
1142283743 16:89162528-89162550 GTGCGGCTGCCCCGGGCCCCAGG + Intergenic
1142509796 17:386157-386179 GCGGGGCCGCCCCGGGTCCGGGG - Intronic
1142804208 17:2363066-2363088 GTCCAGCGGCACCGCATCCGGGG + Exonic
1143375418 17:6464203-6464225 GTGCCGCGGCCCCGGCGCCTGGG - Exonic
1143544773 17:7589542-7589564 GGGCAGCGTCCCGGGGGCCGCGG + Exonic
1143651669 17:8267248-8267270 GTGCAGAGGCTCCGCGTCCTGGG + Intronic
1146058275 17:29591834-29591856 GGGCAGCGGTCCCGGGCCCCCGG + Intronic
1146787408 17:35731911-35731933 GTGGAGCGGGGCCGGGTCAGGGG + Intronic
1147612800 17:41811657-41811679 CTGCAGCGGCCCCGCGCCCGCGG - Exonic
1147793053 17:43025205-43025227 GAGCCCCCGCCCCGGGTCCGCGG - Intergenic
1147969280 17:44210956-44210978 GTGCAGAGGGTCGGGGTCCGTGG + Intronic
1150124990 17:62629616-62629638 GTGCAGAGGGCACGGTTCCGAGG - Intronic
1151319497 17:73343946-73343968 GTGCAGAGCCCCTGGGACCGTGG - Intronic
1152516124 17:80825957-80825979 GTGGAGCAGCCCTGGGTCAGCGG + Intronic
1152576413 17:81143242-81143264 CTGCAGCAGCCCCAGGTCCCAGG + Intronic
1152908502 17:82983737-82983759 GGGCAGGGGCCCCGGGGCGGAGG + Intronic
1153480536 18:5543213-5543235 GGGCAGCGGCCCCCGGCCGGTGG - Intronic
1157402832 18:47401644-47401666 GTGCGGTGGCCCCGGGTGGGAGG - Intergenic
1157402843 18:47401686-47401708 GTGCGGTGGCCCCGGGTGGGAGG - Intergenic
1157402856 18:47401728-47401750 GTGCGGTGGCCCCGGGTGGGAGG - Intergenic
1157402887 18:47401853-47401875 GTGCGGTGGCCCCGGGTGGGAGG - Intergenic
1157402919 18:47401979-47402001 GTGCGGTGGCCCCGGGTGGGAGG - Intergenic
1157402941 18:47402063-47402085 GTGCGGTGGCCCCGGGTGGGAGG - Intergenic
1157403017 18:47402355-47402377 GTGCGGTGGCCCCGGGTGGGAGG - Intergenic
1157403063 18:47402523-47402545 GTGCGGTGGCCCCGGGTGGGAGG - Intergenic
1157403074 18:47402565-47402587 GTGCGGTGGCCCCGGGTGGGAGG - Intergenic
1157403085 18:47402607-47402629 GTGCGGTGGCCCCGGGTGGGAGG - Intergenic
1160256237 18:77250607-77250629 GAACAGCGGCCCGGGCTCCGGGG - Exonic
1160694398 19:475555-475577 GTGCAGAGGCCCTGGGGCAGCGG + Intergenic
1160727211 19:622646-622668 GTGCAGAGGCAGCGGGTCAGTGG - Exonic
1160860242 19:1234538-1234560 GGGCAGCAGCCCCGGTTCCTCGG - Intronic
1161487342 19:4543405-4543427 GTCCTGCGGCCCCGGGTAGGGGG + Exonic
1161495617 19:4584370-4584392 GGGCTGCGGCCCCGGGTCCGAGG + Intergenic
1161939732 19:7395004-7395026 GAGCAGCAGCCCCAGGTCCCCGG + Intronic
1162585286 19:11554464-11554486 GGGCAGAGGCCCCGGGACCACGG - Intronic
1162722365 19:12670059-12670081 GTACAGCGGCCACGGCTACGAGG + Exonic
1162914136 19:13865355-13865377 GTGCAGGCGCCTCGGGCCCGGGG + Intronic
1163363519 19:16862996-16863018 GGGCAGCGGGCCAGGGCCCGTGG - Intronic
1165423300 19:35732772-35732794 GTGCAGCAGCCTCGGGGCCAGGG + Exonic
1165837844 19:38770363-38770385 TGGCAGCGGCCCCGGCTCTGCGG - Intergenic
1165841721 19:38792334-38792356 TGGCAGCGGCCCCGGCTCTGCGG + Intergenic
1166859637 19:45802254-45802276 GTGCAGCGGCCCTGGGGGTGGGG + Exonic
1167619615 19:50553457-50553479 GTGCAAAGGCCCTGGGGCCGGGG - Intronic
1168082305 19:54019109-54019131 GTGGAGCTGCCCCGGGTCATGGG + Intergenic
1168408125 19:56121174-56121196 GCGCGGCGGCCCCGGGACCAAGG - Exonic
927606563 2:24491495-24491517 GAGCCGCGGCGCCGGGCCCGAGG + Intergenic
930071474 2:47369628-47369650 GGGCAGCGGCCCCCGGCCCTCGG + Intronic
932314070 2:70768060-70768082 GTGCAGCGGCTCCGCGGCGGCGG + Exonic
932758770 2:74426283-74426305 CTGCAGAGGCCTCTGGTCCGTGG + Exonic
937152558 2:119696004-119696026 GTGCAGCTGCCCTGAGTCTGTGG + Intergenic
942314054 2:174682446-174682468 ACGGGGCGGCCCCGGGTCCGCGG + Intronic
947155990 2:227163960-227163982 GTGCCGGGGCCCCGGGACAGCGG + Intronic
948292595 2:236837216-236837238 ATGCAGAGGCCCCTGGTCAGTGG + Intergenic
948751668 2:240136699-240136721 GTGCAGCGGCCGTGGGGCCCTGG - Intronic
948899157 2:240947419-240947441 GTGCAGGGACCTCGGGTCAGTGG - Intronic
1168764589 20:373059-373081 GTGCAGCAGCCCTGGGGCCTTGG + Intronic
1169849611 20:10035087-10035109 GTCCATGGGCCCCGGGTCCCCGG - Exonic
1172272683 20:33663461-33663483 GCGGAGCGGCCCCGGGTCGTGGG + Intronic
1172284642 20:33732136-33732158 GCGCAGCGGCCGCGGGGCGGAGG + Intronic
1172702693 20:36862903-36862925 GAGCAGCGACGCCGAGTCCGCGG - Exonic
1173822663 20:46029318-46029340 GCGGCGCGGCCCCTGGTCCGGGG - Intronic
1174472227 20:50769554-50769576 ATGGAGCGGCCCTGGGTCTGCGG - Intergenic
1175806209 20:61830565-61830587 CTGCAGCGGCCCCGCCTCCCAGG + Intronic
1176023221 20:62973100-62973122 AAGGAGCGGCTCCGGGTCCGCGG + Intergenic
1181680739 22:24494645-24494667 GTGCAGCCGCCGCGTGCCCGTGG + Intronic
1182320113 22:29473276-29473298 GTGCAGCTGCCCCTGGGCAGGGG + Intergenic
1183190616 22:36319968-36319990 GTGCAGTGGACCCGAGTCCTGGG + Intronic
1183536120 22:38402400-38402422 GTTCAGGGGCCCCGGGGCCAGGG - Intergenic
1184759862 22:46537904-46537926 GAGCCGCGGCCCCGAGCCCGAGG - Intergenic
1185232898 22:49693527-49693549 GTGCGGAGGCCCAGGGTCCAAGG + Intergenic
1185296700 22:50058282-50058304 GTGCAGCGGCGGCGGCCCCGGGG + Intergenic
950088379 3:10277619-10277641 GTGCAGCAGCCAGGGGTCAGAGG - Intronic
950446521 3:13041962-13041984 CTGCACCGGCCCGGGGTCCCCGG - Intronic
951217841 3:20040887-20040909 GTGCAGCGGCCCCAGGCGGGAGG - Intronic
954688562 3:52383781-52383803 GTGCAAGGGCCCTGGGTCCTGGG + Intronic
955322088 3:57981740-57981762 CTGCAGGGGCCCCGGGCCCACGG - Intergenic
955818776 3:62874801-62874823 GAGCAGCGGCGGCGGGGCCGGGG - Exonic
961775174 3:129279148-129279170 GAGCACCGGCCCCCGCTCCGGGG + Intronic
964635143 3:158850319-158850341 GTGCAGAGGCCCCAGCTCAGAGG + Intergenic
966592272 3:181696064-181696086 GCGCAGCGGCGCCAGGTCCGAGG - Intergenic
968640678 4:1712874-1712896 CTGCAGCGGCCACGGGACCGTGG - Intergenic
968659761 4:1794105-1794127 GGGAACCGGCCCCGGGTCGGAGG + Intronic
968831664 4:2935232-2935254 GTGCTGCCGCCCCAGGCCCGCGG - Intergenic
969053325 4:4387297-4387319 GTGCGGCGGCCCCAGGACCGGGG + Intronic
969480341 4:7443610-7443632 GTGCAGAGACCCAGGGTCCACGG + Intronic
969541544 4:7793743-7793765 GTGCAGAGCCTCCGGGTCTGTGG + Exonic
970689502 4:18606372-18606394 CTGCAGCTGCCCCAGGTGCGTGG + Intergenic
978885371 4:113761516-113761538 GTGCAGCGGGGCCGAGGCCGCGG + Intronic
990910073 5:60843984-60844006 GTGCGGGGGCCCCGGGAGCGGGG - Intronic
991371568 5:65925587-65925609 GGGCAGCGGGCCGGGGGCCGGGG - Intergenic
1007227134 6:40322851-40322873 GTGCAGCTGCTGCTGGTCCGAGG + Intergenic
1017914373 6:158819672-158819694 GTGCAGCCGCCCCAGGGCCGAGG - Intergenic
1018742955 6:166744371-166744393 GAGACGCGGCCCCGGGCCCGGGG + Intronic
1019088294 6:169502081-169502103 GGGCAGCCGCCCCGGGGCTGCGG + Intronic
1019293346 7:261085-261107 GGGCAGCTGCCCCGGGGCTGTGG + Intergenic
1019312498 7:369569-369591 GTGCCGAGGCCCCGGGCCCCAGG + Intergenic
1019343061 7:517562-517584 GCGCCGCCGCCCCGGGCCCGAGG + Intronic
1019399650 7:844903-844925 GTGCAGCACCCCCGGGGCCCTGG - Intronic
1024520867 7:50303792-50303814 GACCAGCGGCCCCGGGTGCAGGG + Intergenic
1025777375 7:64570554-64570576 CTGCACCGGCCCGGGGTCGGGGG + Intergenic
1032125460 7:129189487-129189509 GTGCGGCGGAGCCGGGTCTGGGG + Intronic
1032130718 7:129225245-129225267 GCGGAGCGGCCCCCGGTCCCCGG + Exonic
1034478713 7:151303649-151303671 TTGGAGCGCCCCCGGGCCCGCGG + Intergenic
1034483598 7:151341944-151341966 GTGGAGCGGCCGCGGGGCGGGGG + Intronic
1034671914 7:152865479-152865501 GTGCAGTGGCCCCGACTCTGAGG - Intergenic
1034671922 7:152865514-152865536 GTGCAGTGGCCCCGACTCTGAGG - Intergenic
1036397009 8:8378193-8378215 GTGCAGGGGCGCTGGGGCCGGGG + Intronic
1036561440 8:9903289-9903311 GCGCAGCGGCCGCGGGCGCGAGG - Intergenic
1037970594 8:23168952-23168974 GTGCAGTGGCCACAGGACCGGGG + Intergenic
1041839166 8:62248948-62248970 GAGCGGCGGCCGCGGGGCCGAGG + Exonic
1042695095 8:71547417-71547439 GTGCAGCCGCCCAAGGCCCGTGG - Intronic
1045477968 8:102569316-102569338 GTGAAGCAGCCCTGGGTCCAGGG - Intergenic
1049208246 8:141373289-141373311 GAGGAGCGGCCCCGGGTACCCGG + Intergenic
1049773174 8:144393076-144393098 GTGCAGCCGCCCAGGGCCGGCGG + Exonic
1053122994 9:35560256-35560278 CTGCAGCTGGCCCGGGCCCGGGG + Exonic
1057274088 9:93667090-93667112 GTGCAGCGAACCCTCGTCCGAGG - Exonic
1057605732 9:96496722-96496744 GTGCAGCGGACCCGCTCCCGGGG + Intronic
1062645194 9:137544202-137544224 GGGCAGTGGCCCCAGGTCAGAGG - Intronic
1197110745 X:122771421-122771443 ATGCAGTGGCCCCAGGACCGAGG - Intergenic
1198256177 X:134925923-134925945 GTGCAGGAGCCCCAGGTGCGGGG - Intergenic
1200003258 X:153072699-153072721 GGGCAGCGGTCCGGGGTCCGGGG + Intronic
1200004465 X:153077310-153077332 GGGCAGCGGTCCGGGGTCCGGGG - Intergenic
1200048146 X:153413439-153413461 AAGCAGGGGTCCCGGGTCCGAGG + Intergenic