ID: 1089502230

View in Genome Browser
Species Human (GRCh38)
Location 11:118939557-118939579
Sequence TGCCATGGTGATGGGTCCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 265
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 236}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089502230 Original CRISPR TGCCATGGTGATGGGTCCAG AGG Intronic
900241243 1:1618555-1618577 TGCCCAGGGGATGGGTCCTGTGG + Intronic
900431372 1:2604631-2604653 TGCCAGGGTGGTGGGTGCCGGGG + Intronic
902220483 1:14961340-14961362 TGACATGGTGTAGTGTCCAGGGG + Intronic
903708346 1:25303399-25303421 TGCCATGGTGCTGGGTCTTGTGG + Exonic
903718768 1:25389014-25389036 TGCCATGGTGCTGGGTCTTGTGG - Exonic
904797625 1:33069354-33069376 TGCCCTGGGGCTGGGTGCAGTGG + Intronic
906913431 1:49982220-49982242 TGCCATGGTGCCAGGTGCAGTGG + Intronic
907875028 1:58477560-58477582 TGCCATGGTGATTGCTTCAAGGG + Intronic
909515362 1:76501284-76501306 GGCTTTGGTGATGGCTCCAGAGG - Intronic
909534837 1:76725014-76725036 TGCCATGGGGATGTTTCCTGGGG - Intergenic
915351437 1:155229063-155229085 TGCCATTGAGATGGGAACAGTGG + Intergenic
915354220 1:155246243-155246265 TGCCATTGAGATGGGAACAGTGG + Intergenic
916576961 1:166076005-166076027 TGTCATGGTGATGGGGATAGTGG - Intronic
919303888 1:195805515-195805537 AGCCAGGGACATGGGTCCAGAGG + Intergenic
919868903 1:201805398-201805420 TGCAATTGTGATGGGTAGAGAGG + Intronic
920269564 1:204752606-204752628 GTCCATGCTGATAGGTCCAGGGG - Intergenic
922532698 1:226356528-226356550 TGTCATGGTGATGGTTTCACAGG + Intergenic
1065514879 10:26515166-26515188 TGCCATTGGGCTGGGTGCAGTGG - Intronic
1067787482 10:49260981-49261003 TGCCATGGGGATTGGTCCCAAGG + Intergenic
1067922464 10:50473998-50474020 TGTCATGGTGAAAGGTCAAGAGG + Intronic
1070059646 10:72969270-72969292 TGATATGGTGCTGGGTGCAGTGG - Intergenic
1070096342 10:73340997-73341019 TGCCATGATGCTGGCTGCAGTGG - Intronic
1070499914 10:77062982-77063004 AGCTATGGTGATGGGTCCTGTGG + Intronic
1071147376 10:82590815-82590837 TGCCAAGGTGTTGGGTGCAAAGG + Intronic
1071485495 10:86099492-86099514 TGCCCTGGTGAAGGGACAAGGGG - Intronic
1074032783 10:109705245-109705267 TCCAATGGTGATGGGCCCAGTGG + Intergenic
1076402595 10:130193669-130193691 CGCCATGGTGAGGAGTCCTGCGG - Intergenic
1076655363 10:132019985-132020007 TGCCATCATGCTGGGTACAGTGG - Intergenic
1076790859 10:132775990-132776012 TGCAATGGACATGTGTCCAGGGG + Intronic
1077235311 11:1479304-1479326 AGGCATGGAGATGGGTCCTGAGG - Intronic
1078797554 11:14607907-14607929 GAACATGATGATGGGTCCAGAGG + Intronic
1078932978 11:15927389-15927411 GGCCATGGTGATTGGTTTAGGGG - Intergenic
1083985390 11:66211234-66211256 TGCCATGTTGATGAGTCCCACGG - Exonic
1087171189 11:95051294-95051316 TTCAATGGCCATGGGTCCAGAGG - Intergenic
1087556305 11:99725781-99725803 TGCCATTTTGAATGGTCCAGTGG + Intronic
1089133966 11:116234725-116234747 TGCAAGGGTGCTGGGCCCAGGGG + Intergenic
1089502230 11:118939557-118939579 TGCCATGGTGATGGGTCCAGAGG + Intronic
1089603086 11:119626950-119626972 TGGCCTGGGGATGGGGCCAGGGG + Intronic
1089639328 11:119837119-119837141 TGACAGGTTGATGGGTGCAGTGG + Intergenic
1090275055 11:125413251-125413273 TGCCTAGGTGATGAGGCCAGAGG + Intronic
1090648642 11:128787252-128787274 TCTCATGGTGATGGCACCAGAGG - Intronic
1090751266 11:129748366-129748388 TGTCATGGTGCTGGGTACAGGGG + Intergenic
1093027754 12:14260146-14260168 TGCCATGGTGACGGCTCCCGGGG - Intergenic
1093093773 12:14949809-14949831 GTCCATGGTGATTGGTCCCGGGG + Exonic
1093097624 12:14989824-14989846 TGCCATGGACATGGGGCCTGTGG - Intergenic
1093616694 12:21233849-21233871 TGCTCTGGTGATGGATCCAGAGG - Intronic
1094394782 12:29994149-29994171 TGGCAGGGTGAGGGGTGCAGTGG - Intergenic
1094480353 12:30876557-30876579 TACTTTGGTGATGGGGCCAGAGG - Intergenic
1096344846 12:50836823-50836845 TCCCATGGTGCTGGGACCACAGG + Intergenic
1097866197 12:64561096-64561118 TGAGATGGGGGTGGGTCCAGAGG + Intergenic
1099844509 12:88012775-88012797 TGACATGGGGAAGGGTGCAGTGG + Intronic
1100865660 12:98854022-98854044 TGTCTTGCTGATGAGTCCAGAGG - Intronic
1101002117 12:100367019-100367041 TGCAGTGGTGATGGGGCCACAGG - Intronic
1102043821 12:109817348-109817370 TGCCATGGTGAGGGGTGCAGTGG - Intronic
1104005201 12:124886834-124886856 TGCCATGGGGCCGGGTGCAGTGG - Intergenic
1105278562 13:18950118-18950140 GGGCATGGTGATGGGGACAGAGG - Intergenic
1106201047 13:27537640-27537662 TGCCATTGTGATGGGCTCTGGGG - Intergenic
1106777646 13:33024456-33024478 TGTCCTGCTGATGGGTGCAGAGG + Intronic
1110362262 13:74641140-74641162 AGCTATGGGGATGGTTCCAGAGG + Intergenic
1111843149 13:93474011-93474033 TGCCATGGTGCTGGCTGCAGTGG - Intronic
1112414793 13:99195263-99195285 GGCCATGGTGATAGGTAGAGGGG - Intergenic
1113854452 13:113436012-113436034 TGCCTGGGTGCTGGGTCCCGGGG - Intronic
1114131806 14:19800758-19800780 TGCCAAGGGGAAGGATCCAGGGG - Intronic
1114856310 14:26448696-26448718 TGCCAATGTGACAGGTCCAGTGG - Exonic
1116902116 14:50371616-50371638 TGCCATGATGCTGGCTGCAGTGG + Intronic
1117285630 14:54283179-54283201 TGCCCTACTGATGGGACCAGTGG - Intergenic
1117733860 14:58750662-58750684 TGCCATGATGCTGGCTTCAGGGG + Intergenic
1122763577 14:104048915-104048937 TGCTGTGGTGCTGGGTTCAGGGG + Intronic
1123540079 15:21281212-21281234 TGCAATGGTTATGGGTGGAGGGG - Intergenic
1123574875 15:21656462-21656484 TGCTAAGGTGAAGGATCCAGGGG - Intergenic
1123611490 15:22098951-22098973 TGCTAAGGTGAAGGATCCAGGGG - Intergenic
1123818628 15:24004024-24004046 TGCCATGGAGATGGGTGTAGGGG + Intergenic
1124695583 15:31861899-31861921 TGCCATGGTGAAGGACACAGGGG - Intronic
1126331634 15:47538394-47538416 TGACATGCTGCTGGGTCCTGTGG - Intronic
1127980911 15:64034352-64034374 AGCCATGTTGATGGGGGCAGGGG - Intronic
1128455870 15:67831046-67831068 TGCCAGGGTAATGTGTCCAGAGG - Intronic
1128945151 15:71814741-71814763 TGGCATGGCCATGGGTCCAGAGG + Intronic
1128994475 15:72286652-72286674 TGGCAAGGTCATGGGTCCATAGG - Intronic
1129174027 15:73827030-73827052 GGCCATAGTGATTGGTTCAGAGG - Intergenic
1130330533 15:82918702-82918724 TGCCATAGTGACAGATCCAGTGG - Intronic
1130442874 15:83973160-83973182 TGCCAAGGTGATGGGGTCAGTGG - Intronic
1130620225 15:85454102-85454124 TGCCATGGAAGTGGGTCCTGTGG + Intronic
1202948390 15_KI270727v1_random:8370-8392 TGCAATGGTTATGGGTGGAGGGG - Intergenic
1202983743 15_KI270727v1_random:390706-390728 TGCTAAGGTGAAGGATCCAGGGG - Intergenic
1133046610 16:3091804-3091826 GGCCATGGTGAGGGGCCCTGGGG + Exonic
1134364039 16:13560321-13560343 GGCTATGGTGATTGGTTCAGGGG - Intergenic
1135174434 16:20215517-20215539 AGCCATTGTGATAGGTCCAGAGG - Intergenic
1135186392 16:20319579-20319601 TGCCAGGGTTATGGGTCAAAGGG + Intronic
1137685334 16:50382753-50382775 TGGCTTGGTGATTGGTACAGAGG + Intergenic
1138307654 16:55992751-55992773 TTCCAAGGTGCTGGGTCCACAGG + Intergenic
1138659756 16:58510088-58510110 TGCCCTGGAGATAGCTCCAGAGG - Intronic
1142328221 16:89432372-89432394 TGCCACGGCGATGGGTCCTGAGG - Intronic
1145899627 17:28481934-28481956 TGAAAAGGTGCTGGGTCCAGTGG - Intronic
1146425144 17:32731624-32731646 TGCCATGATGCTGGCTGCAGTGG + Intronic
1147421209 17:40323000-40323022 TGCCATGGTGATGTCTGCCGTGG + Intronic
1148695222 17:49554853-49554875 TGCCATGGGGATGGGGCCACGGG - Intergenic
1149144382 17:53472370-53472392 CACCATGTTGATAGGTCCAGTGG - Intergenic
1150051531 17:61969066-61969088 TGGCATGGGGCTGGGTGCAGTGG + Intronic
1150451408 17:65271960-65271982 TCCCATGGTAATGGGTCCTCAGG - Intergenic
1151977033 17:77488946-77488968 TGCCCTGCTGCTGGGTGCAGAGG + Intronic
1152588126 17:81198135-81198157 TGCCCCTGTGATGGGTCCTGGGG + Exonic
1152908244 17:82982089-82982111 CTCCATGGTGATGGGCCAAGCGG + Intronic
1156295786 18:35789738-35789760 TGCCCTGGAGATGAGTCTAGTGG + Intergenic
1156454183 18:37283613-37283635 TGGCATGGTGATGGGTGCAAGGG + Intronic
1156771666 18:40735161-40735183 TGCCTTGGTGAAGAGGCCAGTGG - Intergenic
1157213297 18:45761940-45761962 GGCCATGGGGATTGGTCCAAGGG + Intergenic
1159877962 18:73831929-73831951 GGCCAAGGTGATGGGCACAGAGG - Intergenic
1161761761 19:6178660-6178682 TGCAATGGAGCTGGGTGCAGTGG - Intronic
1163784440 19:19267566-19267588 TGCCATGGGTAGGGGTCCACTGG - Intronic
1166233059 19:41436959-41436981 TGTCATGCTGAAGGGGCCAGTGG + Intronic
1167774219 19:51544390-51544412 TGCCCTTGTTATGGGGCCAGTGG + Intergenic
1168232615 19:55042826-55042848 TGCCATGGTGAGCGGCCCTGTGG - Intronic
926648089 2:15311937-15311959 TGTCAAGGTAATGGGTGCAGTGG - Intronic
927007024 2:18861517-18861539 TGGCATGGGGATGGCTACAGTGG - Intergenic
927196521 2:20551450-20551472 TGCCATGGGGCTGTGGCCAGCGG - Intergenic
927917321 2:26945515-26945537 TCGCATGGTGATGGGTGCGGGGG - Intronic
928840320 2:35598414-35598436 TGCCATGATGCTGGCTGCAGTGG + Intergenic
933196386 2:79394833-79394855 TGCCTTGTTTATGGGTCCTGAGG + Intronic
937067108 2:119025848-119025870 TGCCACTGTGAGGGGTCCAGAGG + Intergenic
937192710 2:120120139-120120161 TGACAGGGTGGTGGGCCCAGTGG + Intronic
937194773 2:120143504-120143526 TGCCATGGTGAAGGATGGAGGGG + Intronic
937407122 2:121640272-121640294 TGACAGGCTGATGGGTGCAGCGG + Intronic
938119524 2:128623823-128623845 GGCCATGGTGATGGGTCTGAGGG + Intergenic
938722208 2:134076753-134076775 TGCCATGATGCTGGCTGCAGTGG - Intergenic
941397291 2:164989733-164989755 TGCAATGGTTATGGGTGGAGGGG - Intergenic
941920424 2:170845327-170845349 TCCCAGGGTAAAGGGTCCAGTGG + Intronic
942247886 2:174024115-174024137 GGCCACGGTGATGGTTCCTGCGG + Intergenic
942385628 2:175439642-175439664 TGCCATGGGGCAGGGTGCAGTGG + Intergenic
943129232 2:183837189-183837211 TGCCATGATGCTGGCTGCAGTGG + Intergenic
944538666 2:200736362-200736384 TGACATGGTGATGTGTGCAATGG + Intergenic
944539158 2:200740291-200740313 GGCCATGGTGTTGGCTGCAGAGG - Intergenic
944971635 2:205000214-205000236 TCCTATGGTAATGGGTGCAGTGG + Intronic
945212835 2:207401492-207401514 TGTCATGGTGATTGATGCAGAGG - Intergenic
946381356 2:219351143-219351165 TGCCATGGTGATGGGGGGCGGGG + Intergenic
946434000 2:219640266-219640288 GGCCAAGTTGATTGGTCCAGTGG + Intronic
946682275 2:222229896-222229918 AGCCATTGTGCTGGGCCCAGAGG - Intronic
947020969 2:225675224-225675246 TGCCTTGGTGATGGGATCATTGG - Intergenic
947136496 2:226981268-226981290 TGCCGAGTTGATGGGTGCAGCGG + Intronic
947949861 2:234137804-234137826 TGCCATTGTGCTGGCGCCAGAGG - Intergenic
948225261 2:236304874-236304896 TACCAAGGTGATGGCTCCATAGG - Intergenic
948556908 2:238818319-238818341 ACCCTGGGTGATGGGTCCAGAGG + Intergenic
948759061 2:240179362-240179384 TGTCATGGTGATGGGGCCACAGG + Intergenic
1169355800 20:4904034-4904056 TCCCATGGTGCTGGGACCACAGG - Intronic
1170649574 20:18227186-18227208 TGCCCTGGTGCTGGATCCACTGG + Intergenic
1172979176 20:38927973-38927995 TGGCATGGTCATGGGTGCAATGG + Intronic
1173903340 20:46607026-46607048 TGCCATGGTGCCTGGTACAGAGG - Intronic
1174363699 20:50043839-50043861 GGCCATGGTGATCTCTCCAGAGG + Intergenic
1174680234 20:52399467-52399489 AGCCATGGAGATAGATCCAGAGG - Intergenic
1174945453 20:54980305-54980327 GGCCATGGCAATGGGTCCTGTGG + Intergenic
1175052504 20:56168308-56168330 GGCTATGGTGATTGGTTCAGGGG - Intergenic
1179813060 21:43884570-43884592 TGCCCTGGTGCTGGATGCAGGGG + Intronic
1182142381 22:27972231-27972253 GGCCATGGAGAGGGGCCCAGAGG + Intergenic
1182150861 22:28026222-28026244 TGCCACGTTGAGGGGTGCAGAGG - Intronic
1182583299 22:31328142-31328164 TGCCTTGGGGATGAGGCCAGGGG - Intronic
1184324876 22:43775340-43775362 TGCCATAGTCATGGGCCCACCGG - Intronic
1184488702 22:44796635-44796657 TGCTATGATGATGGGCCCAAAGG + Intronic
1184687453 22:46103071-46103093 TGACACGGTGATGGGGACAGTGG + Intronic
1185275301 22:49948035-49948057 CGCCCTGGTGAGGGGTGCAGGGG + Intergenic
950168823 3:10822247-10822269 GGCCATGGTGCGGGGTGCAGGGG + Intronic
950294924 3:11821162-11821184 TTCCATGGATGTGGGTCCAGGGG + Intronic
950749461 3:15117303-15117325 TGCCATGAGGCAGGGTCCAGCGG - Intergenic
952819377 3:37472849-37472871 TGCCATGTGGTTGGGTGCAGTGG + Intronic
953571036 3:44072140-44072162 TGCCATGGTTATAGGGCCTGTGG - Intergenic
953916704 3:46925094-46925116 GGGCAGGGTGATGGGTCCTGTGG - Intronic
954215852 3:49124174-49124196 TGCCATGGTGAGGGAGCCAGCGG - Exonic
954497804 3:50982417-50982439 TGCCATCGTGCTGGCTGCAGTGG + Intronic
954522609 3:51242753-51242775 TGCAATGGTGGTGGGAGCAGGGG + Intronic
954746432 3:52790036-52790058 TGCCATGCAGCTGGGCCCAGAGG - Intronic
956723424 3:72137984-72138006 TGCCAGGGAGATGGCCCCAGAGG + Intergenic
957710767 3:83856194-83856216 TGCAATGGTCAGGTGTCCAGTGG + Intergenic
960098566 3:113713429-113713451 TGGCATTGTGATGGGTTCATGGG - Intergenic
960527046 3:118721684-118721706 TGTCATGGTGATGTGTTCTGTGG - Intergenic
960917010 3:122705547-122705569 TGCCATAATGCTGAGTCCAGTGG - Intronic
961391952 3:126557606-126557628 TGCCATGGCCATGGTCCCAGTGG - Intronic
961614306 3:128166758-128166780 AGGCGTGGTGATGGATCCAGAGG - Intronic
962280738 3:134049867-134049889 TGCCCAGGTGAGAGGTCCAGAGG - Intronic
962352062 3:134663658-134663680 AGTCCTGGTGCTGGGTCCAGTGG + Intronic
962474952 3:135747438-135747460 TGCCAAGGTGATGTTTACAGGGG - Intergenic
963898405 3:150710500-150710522 TGCCTTGTTGCTGTGTCCAGAGG - Intergenic
965028738 3:163335802-163335824 AGCCATGGCCATGGCTCCAGAGG - Intergenic
968430252 4:554218-554240 TGCCATGTTCATGGGCCCACTGG + Intergenic
971353442 4:25872927-25872949 AACCATGGTGATGGGTCGGGGGG - Intronic
976447844 4:85152085-85152107 TGCCATGGTGGTGGATCCACTGG + Intergenic
980731055 4:136824373-136824395 TGCCATGATGCTGGCTGCAGTGG - Intergenic
981881168 4:149614541-149614563 TGCAATGGTGATAGGGCCAAGGG - Intergenic
984863219 4:184257872-184257894 TGCCATGGTGGTCAGTCCAGAGG - Intergenic
985735922 5:1582791-1582813 TTCCATTGTGAAGGGTCCAATGG - Intergenic
989791170 5:45403431-45403453 TGCCATGGTTATGTTTCCTGAGG - Intronic
990174196 5:53088919-53088941 TGCTATAGTCATGGGTCCATAGG + Intronic
993898077 5:93562413-93562435 TCCCAAGGAGATGGGTCCACAGG + Intergenic
994226817 5:97262066-97262088 TGTCATGGTGAAGGATCCTGTGG - Intergenic
997463804 5:134073120-134073142 GGCACTGGTGATGGGTCCAGAGG - Intergenic
1000125769 5:158242381-158242403 TGGCATCGTGATGGGCCCTGGGG + Intergenic
1001087518 5:168711389-168711411 TGCCCTGTTGAAGGGTCCACTGG + Intronic
1001537556 5:172508757-172508779 TGCCATGGTGGTGGGAAGAGGGG + Intergenic
1001550412 5:172598453-172598475 GGCCAGGGTGATGGCTCCTGTGG + Intergenic
1002065640 5:176650420-176650442 TGCCCCGGGGATTGGTCCAGAGG - Intronic
1002402490 5:178998928-178998950 TGCCATCGTGGTGGGTTCTGGGG + Intergenic
1003011800 6:2433828-2433850 TGCCTTGGTGATTGGCTCAGCGG - Intergenic
1005391137 6:25334382-25334404 TGCCTTGGTGATTTGTCTAGAGG + Intronic
1007738420 6:43996343-43996365 TTCCTTAGTGATTGGTCCAGTGG - Intergenic
1008032591 6:46713798-46713820 GACCATGGTGATGGATACAGAGG - Intronic
1008138197 6:47801195-47801217 TGCCACGCTGTAGGGTCCAGTGG - Intronic
1010519572 6:76817403-76817425 TGCCATGATGCTGGCTGCAGTGG + Intergenic
1010534854 6:77013831-77013853 GGCCTTGGTGAGAGGTCCAGGGG + Intergenic
1016533098 6:145079921-145079943 TATCATGGTGTTGGGTCCATGGG - Intergenic
1018292828 6:162310375-162310397 TGCCATGGTGACGGAAGCAGAGG + Intronic
1018742692 6:166742679-166742701 TGGCATGTTGGTGGGTGCAGTGG - Intronic
1019153849 6:170025995-170026017 TGTCGTGGTGCTGGGGCCAGGGG - Intergenic
1019422785 7:958766-958788 TGCCATGGAGGTGGGTGCACAGG + Intronic
1019642124 7:2109137-2109159 TGGGATGGTGATGGGCCCACAGG - Intronic
1020443643 7:8245461-8245483 TGACAGGTTGATGGGTACAGTGG + Intronic
1020701220 7:11485834-11485856 TGCATTGTTGATGAGTCCAGTGG + Intronic
1022443294 7:30451107-30451129 GGCCATGGTCATGAGTCCTGGGG + Intronic
1022685676 7:32594065-32594087 GGCCTTGGGGATGGGGCCAGGGG + Intergenic
1023839875 7:44090684-44090706 GGCAATGGTGAAGGGTCCAGGGG + Intergenic
1024786364 7:52911718-52911740 TGCCATGATGCTGGCTGCAGTGG - Intergenic
1024794698 7:53007468-53007490 TGCCATGATGCTGGCTGCAGTGG + Intergenic
1030371096 7:108700093-108700115 TTCCATTGTGATGGGGCCTGGGG + Intergenic
1030691334 7:112537871-112537893 GGCCATAGTGATTAGTCCAGAGG - Intergenic
1032093121 7:128921962-128921984 TGCCATGTGGCTGGGTGCAGTGG - Intergenic
1032453820 7:132056800-132056822 TGCCATGCTGCTGGGTCTAATGG - Intergenic
1034029434 7:147743853-147743875 TGCCATGGTGATGGCTACTGTGG + Intronic
1034116885 7:148591462-148591484 TGCCCTGGAGATGGGTCCACAGG + Intronic
1034383941 7:150722392-150722414 GGCTATGGTGAGGGGTCCTGAGG + Exonic
1034385440 7:150737153-150737175 TGCCCCGGTGATGGGTGCTGAGG + Intronic
1034534446 7:151718260-151718282 TCCCATGGTGGTGGGTGGAGGGG + Intronic
1035054366 7:156024251-156024273 TGCCATGTTGATCCGGCCAGGGG + Intergenic
1035109719 7:156470983-156471005 TGCCATGATGATGTTTCCTGAGG + Intergenic
1037581714 8:20249473-20249495 TTCCCAGGAGATGGGTCCAGGGG - Exonic
1039923808 8:41911248-41911270 TGCCATGGGGAAGGGAACAGAGG + Intergenic
1040858427 8:51974014-51974036 TGCCATGGGGATAGGTGCAGAGG + Intergenic
1041325483 8:56659080-56659102 TGCCCTGGTCATGGGTGCTGAGG + Intergenic
1041770477 8:61467469-61467491 GGCCATGGTGATGGGTTCAGAGG - Intronic
1042201757 8:66285452-66285474 TGCCATGGACAGGGCTCCAGGGG - Intergenic
1043712215 8:83435749-83435771 TGCCATGTTAATGGCACCAGCGG + Intergenic
1044401915 8:91782635-91782657 TGCCAAAGTGGTGGGTCCAAGGG + Intergenic
1045782728 8:105886695-105886717 TGCCATGATGCTGGCTGCAGTGG + Intergenic
1046491033 8:114953162-114953184 TGCCATGGGAATGGCTACAGTGG + Intergenic
1046504655 8:115121988-115122010 TGGTGTGGTGATGGGTCCAAGGG + Intergenic
1047843533 8:128780658-128780680 TGGAATGCTGAGGGGTCCAGAGG + Intergenic
1048245487 8:132792673-132792695 TGTCATGGTGCTAGGTCCTGGGG + Intronic
1048286607 8:133146634-133146656 TGCCATGGAGATGTTTACAGAGG - Intergenic
1049282219 8:141755529-141755551 GGCTATGGTGCTGGTTCCAGGGG - Intergenic
1049364960 8:142232676-142232698 TGGCTTGGTGATGGGTAGAGAGG - Intronic
1052340368 9:27359117-27359139 GGTCATTGTGATGGGTGCAGAGG - Exonic
1053160124 9:35808352-35808374 TGCCATGGTCCTGAGTCTAGGGG - Intronic
1055891039 9:81123247-81123269 TGCCATGATGCTGGCTTCAGTGG - Intergenic
1057290485 9:93803048-93803070 TGGCTTGGTGAGGGGTTCAGAGG - Intergenic
1060544261 9:124451107-124451129 TGGCATGGTCACAGGTCCAGAGG + Intergenic
1060551958 9:124489883-124489905 TGCCATGTGGCTGGGTGCAGTGG - Intronic
1060970951 9:127737543-127737565 AGTCATGCTGATGGGACCAGGGG + Intergenic
1062019241 9:134308632-134308654 TTCCATGGTGTGGGCTCCAGTGG - Intergenic
1062216137 9:135390791-135390813 AGACATGGTGTTGGGTGCAGGGG + Intergenic
1186438150 X:9561104-9561126 TGTCATGGTGATGGGTCATTGGG - Intronic
1186507643 X:10106120-10106142 TCCCATGGTGATGAGTCGTGAGG - Intronic
1187046174 X:15649238-15649260 TTCCATAGTGATGGGGACAGAGG - Intronic
1188186896 X:27127741-27127763 TGCCCTGGCGATGGGGACAGGGG - Intergenic
1189706971 X:43768686-43768708 TGCCATGGGGAAGATTCCAGAGG - Exonic
1191741944 X:64445826-64445848 TGCCTTGGGGCTGGGTGCAGTGG + Intergenic
1192025374 X:67444635-67444657 TGCCATAATGAGGGCTCCAGTGG + Intergenic
1193693583 X:84679730-84679752 TACCATGGTGCTGGGTTCAAGGG + Intergenic
1197342076 X:125286997-125287019 TGCCATGATGCTGGCTACAGTGG + Intergenic
1198361265 X:135897758-135897780 TACCAAGGTGATGGGTTCATAGG - Intronic
1198365255 X:135933486-135933508 AGCCATGCTGGTAGGTCCAGAGG + Intergenic