ID: 1089504822

View in Genome Browser
Species Human (GRCh38)
Location 11:118956251-118956273
Sequence ATTTTGTCCTGGGGGTGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 423
Summary {0: 1, 1: 2, 2: 4, 3: 44, 4: 372}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089504822_1089504839 13 Left 1089504822 11:118956251-118956273 CCCTCCCACCCCCAGGACAAAAT 0: 1
1: 2
2: 4
3: 44
4: 372
Right 1089504839 11:118956287-118956309 GGCAGGGCCTCACTTGCCTCAGG 0: 1
1: 0
2: 0
3: 25
4: 263
1089504822_1089504830 -10 Left 1089504822 11:118956251-118956273 CCCTCCCACCCCCAGGACAAAAT 0: 1
1: 2
2: 4
3: 44
4: 372
Right 1089504830 11:118956264-118956286 AGGACAAAATCAGCCACCCCAGG 0: 1
1: 1
2: 1
3: 7
4: 207
1089504822_1089504832 -8 Left 1089504822 11:118956251-118956273 CCCTCCCACCCCCAGGACAAAAT 0: 1
1: 2
2: 4
3: 44
4: 372
Right 1089504832 11:118956266-118956288 GACAAAATCAGCCACCCCAGGGG 0: 1
1: 0
2: 0
3: 13
4: 157
1089504822_1089504833 -4 Left 1089504822 11:118956251-118956273 CCCTCCCACCCCCAGGACAAAAT 0: 1
1: 2
2: 4
3: 44
4: 372
Right 1089504833 11:118956270-118956292 AAATCAGCCACCCCAGGGGCAGG 0: 1
1: 0
2: 1
3: 30
4: 543
1089504822_1089504834 -3 Left 1089504822 11:118956251-118956273 CCCTCCCACCCCCAGGACAAAAT 0: 1
1: 2
2: 4
3: 44
4: 372
Right 1089504834 11:118956271-118956293 AATCAGCCACCCCAGGGGCAGGG 0: 1
1: 0
2: 0
3: 16
4: 226
1089504822_1089504831 -9 Left 1089504822 11:118956251-118956273 CCCTCCCACCCCCAGGACAAAAT 0: 1
1: 2
2: 4
3: 44
4: 372
Right 1089504831 11:118956265-118956287 GGACAAAATCAGCCACCCCAGGG 0: 1
1: 0
2: 0
3: 10
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089504822 Original CRISPR ATTTTGTCCTGGGGGTGGGA GGG (reversed) Intronic
900233194 1:1572868-1572890 ATTTTGTCTTGGGGGGGGGGGGG + Intronic
903354217 1:22736518-22736540 ATGGTTCCCTGGGGGTGGGAAGG + Intronic
904332664 1:29772681-29772703 GGTTTGGCCTGGGGGTGGGGAGG + Intergenic
904618519 1:31762618-31762640 CATATGTTCTGGGGGTGGGATGG - Intronic
905907876 1:41631646-41631668 ATGCTGCCCTGGGGGTAGGAGGG - Intronic
906380424 1:45328896-45328918 CCTTTCTCCTGGGGGTTGGAGGG + Intergenic
906676018 1:47694249-47694271 ATCCTGGCCTGGGGGTGGGCTGG + Intergenic
907242789 1:53090039-53090061 ATTTGGTGCGGGGGGTGGGTAGG + Intronic
907972187 1:59393858-59393880 ATTGTGTCCTGAGCCTGGGAGGG - Intronic
908254516 1:62292057-62292079 ATGGTTTCCTGGGGCTGGGAGGG - Intronic
908673297 1:66573033-66573055 ATGTTTGCCTGGAGGTGGGAGGG + Intronic
909086795 1:71177896-71177918 CTGTTTTCCTGGGGGTGGGAGGG + Intergenic
909201150 1:72691867-72691889 ATTTTGTCCTGGGGGTTCTTTGG + Intergenic
909493905 1:76256623-76256645 ATTTTGCCAGGGGGGTGGGGTGG + Intronic
910498984 1:87867037-87867059 ATTATGTCCTGGGGGTAAGAGGG + Intergenic
912451200 1:109768781-109768803 ATGATGGCATGGGGGTGGGAGGG + Intronic
913583080 1:120246265-120246287 ATTTTGTCCTGGTGGGGAGTGGG - Intergenic
913625092 1:120652095-120652117 ATTTTGTCCTGGTGGGGAGTGGG + Intergenic
914565068 1:148858083-148858105 ATTTTGTCCTGGTGGGGAGTGGG - Intronic
914607756 1:149272159-149272181 ATTTTGTCCTGGTGGGGAGTGGG + Intergenic
915349787 1:155217119-155217141 GTTTTGTCCTGGGGGTGGGAGGG - Intergenic
915353044 1:155238396-155238418 GTTTTGTCCTGGGGGTGGGAGGG - Intronic
915358939 1:155273899-155273921 CTTTTGTCCTGGGGATAGGTAGG - Intronic
917285463 1:173417896-173417918 CTTTTTAACTGGGGGTGGGAGGG + Intergenic
917730021 1:177865911-177865933 ATCTTTTGCTGGGGGTGGGGTGG - Intergenic
917818914 1:178740783-178740805 AATCTTTCCTGGGGGTGGGGAGG - Intronic
919955573 1:202411535-202411557 ATAAGGTACTGGGGGTGGGAGGG + Intronic
920303637 1:205004973-205004995 CTTCTGTGCTGGGGGCGGGATGG + Intronic
920543713 1:206798447-206798469 AAATTGACTTGGGGGTGGGAAGG - Intergenic
921455928 1:215371463-215371485 ATTTTATCCCAGGGGTGAGAAGG - Intergenic
921671357 1:217927311-217927333 AGTGTGTCCTGGGAGTGGTAGGG + Intergenic
922419910 1:225452416-225452438 AATGTGTCCTGGGGCTGGAAGGG - Intergenic
922804157 1:228377122-228377144 GTCTTGTCCTTGGGGTGGTAGGG - Exonic
923989871 1:239424388-239424410 CATTTGTGGTGGGGGTGGGAGGG + Intronic
924251326 1:242135992-242136014 ACTTGTTCCTCGGGGTGGGAGGG + Intronic
1063532504 10:6848162-6848184 TTTTTGTCGGGGGGGTGGGACGG + Intergenic
1064316923 10:14266148-14266170 TCTTTGTCCTGGGGGTGGGAGGG + Intronic
1064434634 10:15300594-15300616 ATTTTTTTTGGGGGGTGGGAGGG - Intronic
1064828021 10:19428126-19428148 AGTTTCTCCTTGGGGTGGGCAGG + Intronic
1064888929 10:20146534-20146556 ATATTGTCCTGAGGGAGGGAGGG - Intronic
1065342330 10:24719322-24719344 AATATATCCTGGGGGTGGGGAGG + Intronic
1067161487 10:43828662-43828684 TTTTTGTCCTGGGAGTAGGGTGG + Intergenic
1068213289 10:53951314-53951336 ATTTTTTGGTGGGGGTGGGAGGG - Intronic
1068275853 10:54795314-54795336 ATTTTGTCCTGGTGGTGACTTGG - Intronic
1069851704 10:71409545-71409567 CTGCTGGCCTGGGGGTGGGATGG + Intronic
1070369953 10:75772849-75772871 ATTTTTTGGGGGGGGTGGGATGG + Intronic
1072493002 10:95927358-95927380 ATTTTTTCCTGAGAGTGAGATGG - Intronic
1072671655 10:97434394-97434416 ACTTGGTACTGGGGCTGGGATGG + Intergenic
1072838335 10:98741527-98741549 ATTTTGTGGCGGGGGTGGGTTGG - Intronic
1074406558 10:113184645-113184667 ATTTGGCCCTGGGGGAGGGATGG - Intergenic
1074553322 10:114465571-114465593 ATTTTGCTCTGGGAGAGGGATGG + Intronic
1076896821 10:133317223-133317245 TCTGTGTCCTGGGGGAGGGAGGG - Intronic
1076944788 10:133638294-133638316 AGATTCGCCTGGGGGTGGGAGGG - Intergenic
1077515399 11:2998708-2998730 CATTTCTCCAGGGGGTGGGATGG + Intergenic
1078353960 11:10619443-10619465 CTTTTATCCTGGGTATGGGAGGG + Intronic
1078512469 11:11995703-11995725 CTTTTGTGCTGGGGGTGAGGAGG - Intronic
1078537322 11:12185469-12185491 ATCCTGTCATGGGGATGGGAAGG - Intronic
1078663199 11:13303769-13303791 ATTCTGGCCAGTGGGTGGGAGGG - Intronic
1080090564 11:28343182-28343204 ATTTTTTCATGGGGTGGGGAAGG + Intergenic
1080824975 11:35840419-35840441 ATCTTGACATGGGGGTGGGGAGG - Intergenic
1081957489 11:47106249-47106271 ACTTTGTCTTAGGGGTGGGAAGG + Intronic
1083951149 11:65957055-65957077 AGGTTGTCCTGTGGGAGGGAGGG + Intronic
1084168290 11:67387327-67387349 CTTTTGGCAAGGGGGTGGGAGGG + Intronic
1085761695 11:79247001-79247023 GTTTTGTTTTGGGGGTGGGGGGG - Intronic
1086107162 11:83158042-83158064 ATTGTGTTCTGTGGGTTGGAAGG + Intronic
1087083982 11:94198138-94198160 AATTTGTCCTGAGGTAGGGAGGG + Intergenic
1088118549 11:106340467-106340489 CTTCTGTGCTGGGGCTGGGAAGG - Intergenic
1088182686 11:107129865-107129887 ATTTAGTCAGGGGGGTGAGAGGG + Intergenic
1088433741 11:109787571-109787593 AATTAGTCCTGGGGGTGGGTGGG - Intergenic
1088544578 11:110946707-110946729 ATTTTGTCCTGGAGTGGGAAGGG - Intergenic
1089011084 11:115132384-115132406 ATTTTGGCTTGGGGGATGGAGGG + Intergenic
1089170485 11:116508133-116508155 CTTTTGTTCTGGTGGAGGGAAGG + Intergenic
1089504822 11:118956251-118956273 ATTTTGTCCTGGGGGTGGGAGGG - Intronic
1089597577 11:119590846-119590868 ATCTTTTCCTGGAGGTGGAAGGG + Intergenic
1089683091 11:120130361-120130383 ACCTTGTCCTCGGGGTGGTAAGG - Intronic
1090003455 11:122981003-122981025 GTTGTGTCCATGGGGTGGGATGG + Intronic
1091644983 12:2266359-2266381 ATATTGACCTGGGGGTTGCAGGG + Intronic
1092057411 12:5519418-5519440 ATGTTGTACTTGGGGTGGGAGGG + Intronic
1092152785 12:6262537-6262559 TGGGTGTCCTGGGGGTGGGAAGG - Intergenic
1092161319 12:6316949-6316971 ATTTCACCCTGGGGGTGGGGTGG - Intronic
1093894286 12:24560255-24560277 ATTTAATTGTGGGGGTGGGAAGG - Intergenic
1094795247 12:33964675-33964697 TTTTTGTGGTGGGGGTGGGTGGG - Intergenic
1095455011 12:42374069-42374091 ACATTGTCCTGGGGGTGGGTGGG + Intronic
1096231146 12:49897576-49897598 GTGTAGACCTGGGGGTGGGAGGG + Exonic
1097397591 12:59094580-59094602 ATTTAGTCTTGGCGGTGGGATGG + Intergenic
1097870102 12:64594768-64594790 TTTTTGAGCTGGGGGTGGTACGG + Intergenic
1098433637 12:70447072-70447094 ATTTTTGCCTGGGGGAAGGATGG + Intergenic
1098866326 12:75767866-75767888 CTTTTGTCCTGGTAGTGGGAAGG - Intergenic
1099035346 12:77580301-77580323 ATTCTGTCCTGGGGCTAGGGTGG - Intergenic
1100441114 12:94617763-94617785 ACTCTGTGTTGGGGGTGGGATGG + Intronic
1100891597 12:99132029-99132051 CTGCTGGCCTGGGGGTGGGAAGG - Intronic
1100949231 12:99827110-99827132 TTTTTGTTGTGGGGGTGGCAGGG - Intronic
1101530334 12:105567759-105567781 GTTCTTTCCTGGGGATGGGATGG + Intergenic
1101820611 12:108181262-108181284 ATTTATTCCTGGGGGTGTGTGGG + Intronic
1101885474 12:108657521-108657543 ATGTTCACCTGGGTGTGGGAGGG + Intronic
1102077994 12:110075081-110075103 CTTTAGTCCTGGGAGTGGTAAGG + Intergenic
1102453156 12:113056342-113056364 AACTATTCCTGGGGGTGGGAGGG - Intergenic
1102781211 12:115566471-115566493 ATTGTGTGTTGGGGGTGGGTGGG - Intergenic
1103131762 12:118475280-118475302 ATTTTATCCTGGGCTAGGGATGG + Intergenic
1103209926 12:119158352-119158374 ATGTTTTCCCTGGGGTGGGAGGG - Exonic
1103233115 12:119349154-119349176 ACTTTTTACTGGGGGTGGGTGGG + Intronic
1103464512 12:121131466-121131488 CTTTAGTCCTGGGAGTGGTAAGG - Intergenic
1104062575 12:125281057-125281079 ATTTTGGCCTTGGGGTGGAGAGG + Intronic
1104806095 12:131590477-131590499 ACTCTGCCCTGGGGGTGGGGGGG - Intergenic
1104825730 12:131708054-131708076 TTTTTGTCTTTGGGGTAGGAAGG + Intergenic
1105399178 13:20072668-20072690 TTTTTGTGGTGGGGGTGGCAGGG + Intronic
1106555545 13:30805358-30805380 ACTTGGACCTTGGGGTGGGAGGG + Intergenic
1106808359 13:33334556-33334578 TTTATGTCTTGGGGGTGAGAGGG - Intronic
1108493557 13:51003779-51003801 ACTTTGTCCTGAGGGTCGTAGGG - Intergenic
1108676427 13:52740850-52740872 ATGATGACCTGGGGCTGGGAAGG + Intergenic
1108922415 13:55692711-55692733 ATTTTTTCCAGGGGTAGGGAAGG - Intergenic
1109322014 13:60822488-60822510 AAGATGTTCTGGGGGTGGGATGG + Intergenic
1110227377 13:73133665-73133687 ATTTGGTTCTGCGGTTGGGATGG + Intergenic
1111006214 13:82253089-82253111 ATTTTTTCCGGGGGGGGGGGGGG + Intergenic
1111629971 13:90838051-90838073 TTTTTATCTTGGGGGTGGGGAGG - Intergenic
1112066229 13:95795988-95796010 ATTTGGGCCTGGGGGTAGGGAGG - Intergenic
1112430624 13:99347322-99347344 TTTTTTTCCTGGGGGGGGGGGGG - Intronic
1115618192 14:35116250-35116272 TTTTTTTTCTGGGGGTGGGGAGG + Intronic
1115772566 14:36681327-36681349 ATTTGGTAGTGGGGGTTGGATGG + Intronic
1117066979 14:52021005-52021027 TTTTTCTGCTGGGGATGGGAGGG - Intronic
1117994938 14:61469573-61469595 ATTTTGTCTTCAGGGTGGGGTGG - Intronic
1118846097 14:69548855-69548877 ATGTTCTCCTGGGAGTGGGTGGG + Intergenic
1119357873 14:74021900-74021922 TTTTTTTTCTGGGGGAGGGACGG - Intronic
1119852461 14:77875763-77875785 ATTTGGCCCTGGTGCTGGGAAGG + Intronic
1119978122 14:79048637-79048659 ATTTTTTGCTGGTGGAGGGAGGG + Intronic
1122286937 14:100657927-100657949 ACTTTGTCCTGGGTGTGAAAGGG + Intergenic
1122993710 14:105251164-105251186 GTTTTCTCCTCGGGATGGGAGGG - Intronic
1124659887 15:31538549-31538571 ATTTTGTCCTGGATGTGTGAGGG - Intronic
1125183552 15:36905255-36905277 ATTTTGTCGGGGGGTGGGGAGGG + Intronic
1125507983 15:40277992-40278014 CTTTCGTTCTGGGGGTGGGGAGG + Intergenic
1126274124 15:46856212-46856234 ATTTTATCCTGAAGGTGGTAAGG - Intergenic
1126383863 15:48074302-48074324 ACTTTGGCTTGGGGCTGGGATGG - Intergenic
1127921219 15:63495857-63495879 CTGTTGGCCTGGGGGTGGGGAGG - Intergenic
1127957109 15:63863146-63863168 ATTTTTTCCTGAGGGTTGGGGGG - Intergenic
1128067568 15:64774693-64774715 CTGTTGTCATGGGGGTGGGCGGG - Intronic
1128559258 15:68653845-68653867 TTTTTTTCCTGGGGGAGAGAAGG - Intronic
1128919040 15:71593905-71593927 TTTTTGCCGGGGGGGTGGGAAGG - Intronic
1129221456 15:74133982-74134004 ATTTTGCCCTCGGGTTTGGAAGG - Exonic
1130156924 15:81358524-81358546 ATGTGGTCCTCTGGGTGGGAGGG + Intronic
1130647003 15:85737309-85737331 AAGGAGTCCTGGGGGTGGGATGG - Intronic
1131356142 15:91748971-91748993 TTTTAGTCCTGGGGGAGGGGTGG + Intergenic
1131493101 15:92880067-92880089 AGTGTGACTTGGGGGTGGGAGGG + Intergenic
1131963592 15:97814335-97814357 ATTTTGTGCTTGGGGTGGCCAGG - Intergenic
1132041186 15:98525569-98525591 TCTTTCTCCTGGGGGTGGGGAGG - Intergenic
1133296332 16:4754287-4754309 AGTTGGTCCTGGAGATGGGAGGG - Intronic
1133475532 16:6117874-6117896 ATTTAATCATGGTGGTGGGAAGG - Intronic
1134352023 16:13446559-13446581 ATTTTGAGCTGGGGGTTAGAAGG + Intergenic
1134802030 16:17093606-17093628 ACTTTTTTCTGGGGGTGGGCAGG + Intergenic
1136060220 16:27721331-27721353 GCTTTGTGCAGGGGGTGGGATGG + Intronic
1136184358 16:28577228-28577250 ATATTTGCCTGGGGGTGGGGTGG + Intronic
1136866307 16:33758367-33758389 TTTTTCTCCTGGGGGCGGGAGGG + Intergenic
1137578215 16:49617808-49617830 ATTGTGTCCTGGGTGTGAGCAGG - Intronic
1138462356 16:57158014-57158036 TATATGTCCTGGGGGTGGAATGG - Intronic
1139631355 16:68233913-68233935 CTCTTGTCCTGAGGGTGGGCAGG - Intronic
1140058846 16:71549690-71549712 ATTCTGTCCAGGGGGAGAGAAGG + Intronic
1140123972 16:72105316-72105338 ATTTTGGCCTGGAGGTCAGAAGG - Exonic
1140400747 16:74669360-74669382 TTTTTGGCGGGGGGGTGGGAAGG - Intergenic
1140567671 16:76063435-76063457 ATTTTTTCTTGGTGGTGGGCTGG + Intergenic
1141227238 16:82129542-82129564 ATTTTCTCTTGGTGTTGGGATGG - Intergenic
1141295495 16:82764460-82764482 GGTTTAACCTGGGGGTGGGAGGG + Intronic
1141631805 16:85291822-85291844 GTTTTGTGCTGGCGGGGGGATGG - Intergenic
1142060327 16:88025106-88025128 ATGTTTTCCTGCTGGTGGGATGG + Intronic
1142177083 16:88650370-88650392 ACTTTGCTCTTGGGGTGGGATGG - Intronic
1142247402 16:88976343-88976365 GTGTTCTCCTGGGGGTGGGAGGG - Intronic
1203105854 16_KI270728v1_random:1357828-1357850 TTTTTCTCCTGGGGGCGGGAGGG - Intergenic
1203127660 16_KI270728v1_random:1604540-1604562 TTTTTCTCCTGGGGGCGGGAGGG + Intergenic
1142558318 17:794608-794630 ATTTTATCCTGGGTGTGAGAGGG + Intergenic
1143931920 17:10438038-10438060 ATCTTTTGCTGGGGGTGGGGAGG + Intergenic
1143965974 17:10756723-10756745 TCTTTGTCCTGGGGGTGGAGTGG + Intergenic
1144631147 17:16873179-16873201 ACTTTGTCCCTGGGGTGGGTGGG - Intergenic
1144638225 17:16924252-16924274 CTTTTGTCCTGGGGGGCTGATGG + Intergenic
1144650140 17:17002158-17002180 ACTTTGTCCCTGGGGTGGGTGGG + Intergenic
1145371529 17:22310580-22310602 GTTTTGTGGTGGGGGTGGGTGGG + Intergenic
1146027231 17:29332094-29332116 CATTTGTTCTGGGGGTGGCAGGG - Intergenic
1146386140 17:32375433-32375455 GTTGAGTACTGGGGGTGGGAAGG + Exonic
1147419418 17:40314738-40314760 CTTCTGTCCTGGGGCTGGCAAGG + Intronic
1147576068 17:41599720-41599742 ATCTGCTCCTGGGGGTGGGTGGG + Intergenic
1147688376 17:42300468-42300490 CTGCTGTCCTGGGGGTGGGATGG + Intronic
1148391032 17:47273130-47273152 TTTTTGTCCAGGTGTTGGGAAGG + Intronic
1148567958 17:48644909-48644931 TGTCTGTCCTGGGGGTGGGAGGG + Intergenic
1150576508 17:66435413-66435435 GTTTTGTCGTGTGGGTGTGATGG + Intronic
1151469703 17:74310255-74310277 CCTATGTTCTGGGGGTGGGAGGG - Intronic
1152592878 17:81222446-81222468 ATGTTGTCCTGGGGACCGGAGGG + Intronic
1152943797 17:83187148-83187170 CACTTGTCCTGGGGCTGGGATGG - Intergenic
1154086166 18:11307549-11307571 GTTCTGAGCTGGGGGTGGGAGGG - Intergenic
1154353445 18:13606202-13606224 ATTTTCTTCTGGGGCTTGGAAGG + Intronic
1155646435 18:28083891-28083913 ATTTTCACATGAGGGTGGGAGGG + Intronic
1156815318 18:41303624-41303646 TATTTGTCTTGGAGGTGGGATGG - Intergenic
1157736390 18:50053527-50053549 TTTTTTTCCTGGGGGTGGGGTGG + Intronic
1158395356 18:57075221-57075243 ATTTTGAGCTGGGGGTGGGAGGG + Intergenic
1158788620 18:60746775-60746797 ATTTTGTCCTCTGGGTAGCAGGG - Intergenic
1161121746 19:2530847-2530869 ACTTTTTCCTGGGGTTGGGAGGG + Intronic
1161915535 19:7225391-7225413 ATTTTGGCTTGGTGGTGGGGCGG - Intronic
1162341342 19:10093175-10093197 CTTTTATCCTGGTGGGGGGATGG - Exonic
1162367757 19:10259602-10259624 ATTTAGGCCTGGGGGCGGGGTGG - Exonic
1162395722 19:10417224-10417246 ATTTTGGCGAGGAGGTGGGAGGG + Intronic
1162726930 19:12695454-12695476 AGTCTGACCTGGGGGTTGGATGG + Intronic
1162955114 19:14093043-14093065 TTTTGGTCGGGGGGGTGGGAGGG - Exonic
1165742521 19:38212190-38212212 TGTGTGTCCTCGGGGTGGGAAGG - Intronic
1166212551 19:41316437-41316459 ACTTTGTCCTGGGGTTTAGATGG - Exonic
1166388922 19:42397980-42398002 ACTTTGTCCTGAGGGTGAGGGGG + Intergenic
1166558228 19:43715814-43715836 ACTTTGTCCTTGGGGGGTGATGG + Intergenic
1166903211 19:46082882-46082904 ATTTTCCCCTGGGTGTGGGATGG + Intergenic
1167254342 19:48418416-48418438 ACTTTGTCCTGGGGGTGCTAGGG + Intronic
1167267062 19:48488498-48488520 ACTTTGTCCTGGGGGTGCCAGGG - Intronic
1167666370 19:50824609-50824631 ATATTGTACTGGTGGTGGGGGGG - Intergenic
1168270258 19:55245898-55245920 AGCTTGTCTTGGGGGTGGTAAGG - Intronic
1168345445 19:55648400-55648422 CCTTTGTCCCGCGGGTGGGAGGG - Exonic
1168378671 19:55901883-55901905 GTTTTGTCGGGGGTGTGGGATGG - Intronic
925751726 2:7095516-7095538 AGGCTGTCCTGGGGGTGGCAGGG + Intergenic
927800017 2:26090021-26090043 GATTTTTCCTGGGAGTGGGAAGG - Intronic
928243364 2:29605865-29605887 ATTTTGTCAGAGGGGTGGGGAGG - Intronic
928915735 2:36468394-36468416 ATTTTGTTGTGGCGGAGGGATGG + Intronic
929815265 2:45225584-45225606 ATGTTTTCCAGGGGGTGGGGTGG - Intergenic
932077794 2:68681397-68681419 ATTGAATCATGGGGGTGGGACGG - Intronic
933993478 2:87650417-87650439 AGTTTGGCCAGTGGGTGGGATGG - Intergenic
934620185 2:95798860-95798882 CCTCTGTCCTGGGGCTGGGAGGG + Intergenic
934634999 2:95976937-95976959 TTTTTTTCCTGGGGGTGTGGAGG + Intronic
934640703 2:96025697-96025719 CCTCTGTCCTGGGGCTGGGAGGG - Intronic
934798629 2:97128304-97128326 TTTTTTTCCTGGGGGTTGGGAGG - Intronic
934834799 2:97575197-97575219 TTTTTTTCCTGGGGGTGGGGAGG + Intronic
937098486 2:119250871-119250893 ATCTCGTCCTGCGGGAGGGATGG - Intronic
937132017 2:119520937-119520959 AATTTTTTCTGGGGGTAGGAAGG - Intronic
937310542 2:120900114-120900136 AGAATCTCCTGGGGGTGGGAGGG + Intronic
938953094 2:136275303-136275325 TTTTTGTCCTTGGGTTTGGAAGG - Intergenic
939676553 2:145079475-145079497 ATCTGCTGCTGGGGGTGGGAAGG - Intergenic
945857129 2:215082359-215082381 GTTTTATCCTGAGGGTGGGAAGG - Intronic
946110683 2:217412655-217412677 TGTTGGTCCTGGGGGTGGGTGGG + Intronic
948294500 2:236850518-236850540 ATGATGTCCTGGTGATGGGATGG + Intergenic
1168789617 20:567504-567526 ACTTGGTTCTGGGAGTGGGATGG + Intergenic
1169132386 20:3173038-3173060 AGCTTCTGCTGGGGGTGGGAGGG + Intronic
1170354837 20:15480621-15480643 TTTGTGTCATAGGGGTGGGAAGG + Intronic
1171937876 20:31293250-31293272 TTTGTGTGCTGGGGGAGGGAGGG + Intergenic
1172594953 20:36144463-36144485 GTTTTCCCCTGGGAGTGGGAAGG - Intronic
1172764794 20:37345831-37345853 ATTTTGGCCTGGGGGCGGATGGG + Intronic
1172971906 20:38879858-38879880 ATCTTGTCCTGGTGGTGCTAAGG + Intronic
1173763011 20:45580895-45580917 ATTCTGTCTTTGGGGTAGGAAGG - Intergenic
1174116756 20:48231516-48231538 ATGTTTTCCTGGAGGTGGCAGGG + Intergenic
1175884320 20:62280306-62280328 AGTGTGTCCTGGGGCTGGTATGG + Intronic
1177060649 21:16369546-16369568 TTTTTGGCCAGGGGGTGGCAGGG - Intergenic
1177677777 21:24324516-24324538 ATTGTGTGCTGGGGTGGGGATGG + Intergenic
1177880429 21:26687961-26687983 ATTTTTGCCTGGAGGAGGGAGGG + Intergenic
1180183005 21:46126347-46126369 ATCTTGGGCTGTGGGTGGGAAGG + Intronic
1181050117 22:20234398-20234420 ATCCTGACCTGGGGATGGGAAGG + Intergenic
1182005551 22:26956556-26956578 AATATGTGCTGGGGGAGGGAGGG - Intergenic
1182551303 22:31102241-31102263 AGACTGTCCTGGGGGTGGGAGGG + Intronic
1183095965 22:35552533-35552555 TGTGTGTGCTGGGGGTGGGAGGG - Exonic
1183795127 22:40111162-40111184 AATTTGTCCTGTCCGTGGGAAGG + Intronic
1184414586 22:44344880-44344902 CTGTTGGCCTGGGGGAGGGAGGG - Intergenic
1184981697 22:48100091-48100113 ATATTGCCCTGGTGGAGGGAAGG - Intergenic
1185338866 22:50282874-50282896 ACTTCGTCCTGGGGGAGGGAGGG + Exonic
1185379941 22:50503692-50503714 CTTTTCTCCTGTGGGAGGGAGGG + Exonic
949111568 3:267380-267402 ATTTAGGCCTTGGGGTGGGGTGG + Intronic
949619050 3:5789485-5789507 ATTTTCTCCAGGTGATGGGATGG - Intergenic
950817285 3:15719168-15719190 ATTTTGTCCTGTAGTTGAGAGGG + Intronic
951150298 3:19280845-19280867 AGTGTGTGCTGGGGGTGGGAAGG + Intronic
951311943 3:21137857-21137879 TGCTTGTCCTTGGGGTGGGACGG + Intergenic
951529757 3:23687240-23687262 ATTTCGGCCTGGGGATGGGTGGG - Intergenic
951860440 3:27245815-27245837 ATGTTTTTCTGAGGGTGGGAGGG - Intronic
952341372 3:32450482-32450504 ACTTTGGCCTGGGAGTGGGTTGG + Intronic
952532652 3:34278152-34278174 ATTTTTACCAGGGGCTGGGAAGG + Intergenic
952946345 3:38479983-38480005 ACTGTGTCCTGGGGATGGCATGG + Intronic
953194517 3:40720016-40720038 ATTCTTCCCTGGGGGTGGGCTGG - Intergenic
953361838 3:42304069-42304091 CTTTTTTTCTTGGGGTGGGAAGG + Intergenic
955125411 3:56106159-56106181 CTTTTGCACTGGGGGTGGGTGGG + Intronic
955232472 3:57111177-57111199 CTTTTGTCCTGGGAGGGGAAGGG - Intronic
956339373 3:68204499-68204521 GTTGTGTCCTGAGGGAGGGAGGG + Intronic
956582398 3:70829120-70829142 ATTTGGCCATGGGGGTGGGAGGG + Intergenic
956609921 3:71112098-71112120 ATTGTCTCCTGGTGGTGGGTGGG + Intronic
957341374 3:78901869-78901891 ATTTACTCCTGGGGTAGGGAGGG + Intronic
959924394 3:111905228-111905250 ATTTTGTTCTGGGGATAGGTGGG + Intronic
961010640 3:123433448-123433470 ATTTTCTTTTGGGGATGGGACGG - Intronic
963107518 3:141659809-141659831 CTTTTCTCCTGGGATTGGGAGGG + Intergenic
963318195 3:143783708-143783730 ATTTACTTCTGGGGGTGGAAAGG + Intronic
963486164 3:145936531-145936553 CTTGTGTGCTGGGGGTGGGGAGG - Intergenic
964011220 3:151894298-151894320 ATTATGTCATGAGGGTGGGATGG + Intergenic
965641669 3:170835435-170835457 ATCTTGTGCTGGGGGCTGGAGGG + Intronic
965688746 3:171333144-171333166 AGTTGGTGTTGGGGGTGGGAGGG + Intronic
966013264 3:175108908-175108930 TTTTTCTCTTGGGGGTGGCATGG + Intronic
966225148 3:177590237-177590259 ATGTTGTCCTGGGAGTGGGTGGG + Intergenic
966438928 3:179922034-179922056 ATTATGTGTTGGGGGTGGGGGGG - Intronic
967354445 3:188552283-188552305 AGTGTGTGCTGGGGTTGGGAGGG + Intronic
968436120 4:590426-590448 ATTTTGGCCTGGAGGTGCAAGGG - Intergenic
968451845 4:679582-679604 GATTTCTCCTTGGGGTGGGAGGG + Intronic
969043754 4:4321467-4321489 ATCTTGAGCTGGGGGTGTGAGGG + Exonic
969113070 4:4855624-4855646 ATTTTGTCCCGGGGAGGGGGTGG - Intergenic
969578566 4:8050705-8050727 TTCCTGGCCTGGGGGTGGGAGGG - Intronic
969951142 4:10836927-10836949 CTTTTGGCCTGGAGGTGGGCTGG - Intergenic
970159018 4:13170636-13170658 ATCTTTTCCTGGGGCTGGGAAGG + Intergenic
970345641 4:15149930-15149952 AATCTGTCCTGGGGGTGGGGTGG - Intergenic
971321836 4:25611995-25612017 TTTTTGTGGTGGGGGCGGGATGG - Intergenic
972691497 4:41403194-41403216 AATTTCTCCTGGGGGTGGTGGGG + Intronic
975753919 4:77553037-77553059 ATTTTGGCTTGGGGGTGGAGTGG + Intronic
975989637 4:80244088-80244110 ATTTAGTTATGGGGGAGGGAGGG + Intergenic
976209165 4:82650147-82650169 ATTTTTTGATGGGAGTGGGAGGG + Intronic
976930159 4:90557087-90557109 ATTATTTCAAGGGGGTGGGAAGG - Intronic
977564437 4:98567116-98567138 ATTTTGTGCTGGGAGTAGGCAGG - Intronic
978379651 4:108113442-108113464 AAATTGTTGTGGGGGTGGGAGGG + Intronic
979231159 4:118350490-118350512 ATTTTTTTGTGGTGGTGGGAAGG + Intronic
980877274 4:138674459-138674481 ATGTTGTCCTGGGTGGGGAAGGG - Intergenic
980959486 4:139460789-139460811 GTTTGGTCCTGGGGCTGGCATGG + Intronic
981265526 4:142778636-142778658 AGTGTGTCTTGGGGGTTGGAAGG + Intronic
982658083 4:158173855-158173877 TTTTTGGAGTGGGGGTGGGAAGG - Intergenic
983088822 4:163479834-163479856 AATTTGACCTGAGGATGGGAAGG - Intergenic
983645178 4:169982300-169982322 AGTGTGTTCTGGGGGTGGGAGGG + Intergenic
984168437 4:176332056-176332078 TTTTTTTTGTGGGGGTGGGATGG + Exonic
984703142 4:182831784-182831806 ATTTTGTCCAGAGGTTGGGTGGG - Intergenic
985448173 4:190038803-190038825 AGATTCGCCTGGGGGTGGGAGGG - Intergenic
987428953 5:17807961-17807983 ATTTTTTCCTGGGGAGGTGAGGG + Intergenic
987458634 5:18178162-18178184 ATTTAGTCCTGGTGGAGGGCTGG + Intergenic
987511300 5:18843608-18843630 CTTTTTGCCAGGGGGTGGGAGGG - Intergenic
987559263 5:19497117-19497139 TTTTTGTCCTGGTGGGGGTAGGG - Intronic
988060528 5:26161798-26161820 ACTTTTTCTAGGGGGTGGGAAGG + Intergenic
988919641 5:35928617-35928639 AATGTCTCCTGGGGGTGGGGGGG - Intronic
991334447 5:65531161-65531183 ATATTTTTCTGGGGGAGGGAGGG - Intronic
992062052 5:73062132-73062154 ATTTTTTGCTGGTGGTGGGGTGG - Intronic
992071251 5:73151267-73151289 GTATTTTCCTAGGGGTGGGAAGG + Intergenic
993352334 5:86866056-86866078 ATCATGTCCTGGTGGTGGGATGG + Intergenic
995014002 5:107289758-107289780 AATTCCTCCTGGGGGTTGGAGGG + Intergenic
995154885 5:108898884-108898906 ATTTTGTGCTGGGAGTGTGAAGG - Intronic
995183886 5:109252348-109252370 CTGTTCTGCTGGGGGTGGGAGGG + Intergenic
996933806 5:128924627-128924649 CTTTTGTTCAGGTGGTGGGATGG + Intronic
997455442 5:134013942-134013964 CTTTTTTTCGGGGGGTGGGATGG - Intergenic
997741726 5:136260754-136260776 ACTGAGTCATGGGGGTGGGAGGG + Intronic
998440685 5:142159211-142159233 ATCTTGTCCTGTGGGTCTGAAGG - Intergenic
998558882 5:143152691-143152713 ATTGTGGCCTGGGCCTGGGAAGG - Intronic
999229660 5:150054217-150054239 GTATAGTCCTGAGGGTGGGAGGG + Exonic
999269768 5:150289960-150289982 GTGTGGGCCTGGGGGTGGGATGG + Intronic
1001329004 5:170749130-170749152 GTTGTGTCCTGGGTGTGTGAAGG + Intergenic
1002105882 5:176879295-176879317 CTTGTGTCCTGGAGGTGGGAGGG - Exonic
1002328964 5:178428660-178428682 ATTGTGTGCTGGGGCTGGGCTGG + Intronic
1002468528 5:179420743-179420765 ACCGTGTCCTGTGGGTGGGAGGG + Intergenic
1002929285 6:1622288-1622310 AGTCTCTCCTGGGTGTGGGAAGG + Intergenic
1004256715 6:14071259-14071281 CTTATGTGCTGGGGGTGGGGAGG + Intergenic
1004654346 6:17644355-17644377 ATTTTTACTTGGGGGTGAGATGG - Intronic
1005655961 6:27937769-27937791 ACTTTGTCCTGGCCCTGGGAGGG + Intergenic
1005965455 6:30723403-30723425 ATTCTGTCCTGGATGTGGTACGG + Exonic
1006089066 6:31617047-31617069 TTTTTTTCCTGGGTTTGGGAAGG + Intergenic
1006178635 6:32139705-32139727 AAATGTTCCTGGGGGTGGGATGG + Intergenic
1006582895 6:35086865-35086887 AGCCTGGCCTGGGGGTGGGAGGG + Intronic
1007112040 6:39318448-39318470 ATGGTTTCCTTGGGGTGGGATGG + Intronic
1007366361 6:41396860-41396882 ATTTTGTGGTGGGGGTGGGAGGG - Intergenic
1008520317 6:52356790-52356812 ATTTTATCCTGGGGGAGAGAGGG - Intergenic
1011946478 6:92910901-92910923 ATTTTGAATTGGTGGTGGGATGG + Intergenic
1012051360 6:94348836-94348858 ATATTGTCCTGGGAGTAGAATGG + Intergenic
1012182923 6:96177292-96177314 ATTTTACCTTGGGGGTGGGTAGG - Intronic
1012323585 6:97884619-97884641 TTTTAGACCTGGGGATGGGAGGG + Intergenic
1013392587 6:109701676-109701698 TTTCTGTGATGGGGGTGGGAGGG - Intronic
1014817040 6:125947472-125947494 ACTTTGCCTTGGGGGTGGCAAGG - Intergenic
1015420213 6:132998922-132998944 GTTTTGTCCTGGGGTGAGGATGG + Intergenic
1017129008 6:151092067-151092089 AATGTGTCTTGGGGGTGAGAAGG + Intronic
1018391925 6:163347284-163347306 TTTTTGGCCTGCGGGTGGGGTGG - Intergenic
1018698673 6:166410452-166410474 ATTTTGTTCTGGATATGGGAGGG + Intronic
1018955441 6:168406940-168406962 CATTTCTACTGGGGGTGGGAAGG + Intergenic
1019158741 6:170055747-170055769 ATCTTTTCCTGTTGGTGGGACGG - Intergenic
1020439487 7:8201996-8202018 ACTGTGTCCTGGGGGTAGGCAGG - Intronic
1020479180 7:8636672-8636694 ATTTTGCCATGGGCATGGGAAGG + Intronic
1021673566 7:23057829-23057851 ATTTTCTCCTGGATCTGGGAAGG - Intergenic
1022240198 7:28503880-28503902 CTTCTGCTCTGGGGGTGGGAGGG - Intronic
1024126516 7:46303083-46303105 ATATTTTTCAGGGGGTGGGATGG + Intergenic
1024395752 7:48864768-48864790 ATTTGGGGGTGGGGGTGGGAAGG + Intergenic
1024399482 7:48907508-48907530 ATTTGGGGGTGGGGGTGGGAAGG - Intergenic
1026228511 7:68463176-68463198 AGTGCGTCATGGGGGTGGGAGGG - Intergenic
1026742977 7:72990438-72990460 CTTCTGTGCTGGGGGTGGGATGG + Intergenic
1026802829 7:73410823-73410845 CTTCTGTGCAGGGGGTGGGATGG + Intergenic
1027029092 7:74875142-74875164 CTTCTGTGCAGGGGGTGGGATGG + Intergenic
1027100758 7:75374640-75374662 CTTCTGTGCAGGGGGTGGGATGG - Intergenic
1027242493 7:76341099-76341121 ATCTTGTACAGGGGCTGGGAGGG + Intronic
1027850074 7:83440293-83440315 TTCTTGTCCTGGAGGTGGTAGGG + Intronic
1028286903 7:89013393-89013415 ATTTTGGCCTGATGGTGGAAAGG + Intronic
1031983800 7:128149183-128149205 TGTTTCTCCTGGTGGTGGGAAGG + Intergenic
1032107832 7:129049788-129049810 ATATTTGCCTGGGGGTGGGGAGG + Intronic
1032617628 7:133492038-133492060 TTTTTGTCCTGCGGGTGATAAGG + Intronic
1034410640 7:150940060-150940082 ATTGAGTTTTGGGGGTGGGAGGG + Intergenic
1036120678 8:6013935-6013957 TTTTTTTCTTGGGGGTGGGGAGG - Intergenic
1036671561 8:10791914-10791936 ATGTTGTCCTGGGGGTCTCAGGG - Intronic
1038468421 8:27788671-27788693 ATTTTGTCTTGGGGGAGGGAAGG + Intronic
1038757155 8:30352348-30352370 ATTCTGTCCTGGATGTGGTACGG + Intergenic
1040590405 8:48787707-48787729 GTTTTGTCCTGGGTGTAAGAAGG + Intergenic
1041124175 8:54618331-54618353 ATTTTGTGCTGGGGCCAGGAGGG - Intronic
1041707270 8:60859825-60859847 ATTTTGTCCTGGAGGTAATAGGG + Intronic
1041834096 8:62192218-62192240 CTCTTGAGCTGGGGGTGGGATGG - Intergenic
1047758681 8:127938131-127938153 GTTTTTTCCTAGGGCTGGGATGG + Intergenic
1048825044 8:138416140-138416162 ATTTTGTCCTGGGGGATCAAGGG - Intronic
1049016641 8:139924665-139924687 CTTGGTTCCTGGGGGTGGGATGG - Intronic
1050302488 9:4273917-4273939 ATTATGGCCTGAGGGTGGAATGG - Intronic
1050612643 9:7369135-7369157 ATTTTTTACTGGGAGTGGAATGG + Intergenic
1051856297 9:21570529-21570551 ATTTTTTGGTGGAGGTGGGAGGG - Intergenic
1052142474 9:25004119-25004141 GATGTGTGCTGGGGGTGGGATGG + Intergenic
1053113793 9:35484610-35484632 AATGTGTCATGGGGGTGGGTGGG - Intergenic
1053409565 9:37906817-37906839 ATTTGGTACTGGGGGTGTGAAGG - Intronic
1054705927 9:68462120-68462142 ATTTTTTCCTGCGAGTGAGAAGG - Intronic
1054755001 9:68948701-68948723 TTTTTTTTCTGGGGGTGGGGAGG - Intronic
1055407632 9:75991279-75991301 ATTCTGTGCCAGGGGTGGGAGGG - Intronic
1055564054 9:77550076-77550098 CTTTTGCACTGTGGGTGGGAGGG + Intronic
1055906833 9:81304588-81304610 ATTTTGTCCTGGAGGCAGAAAGG + Intergenic
1057303599 9:93900121-93900143 ACTTTGTCCTGGGGGTACTAGGG - Intergenic
1057582943 9:96303584-96303606 ATGTCCTTCTGGGGGTGGGATGG + Intergenic
1058239625 9:102540710-102540732 TTTGTGTCCTGGGGGTGGCAGGG + Intergenic
1058781387 9:108339518-108339540 CTTTTGGGGTGGGGGTGGGAGGG + Intergenic
1059694792 9:116720892-116720914 AGATTGTCCTGGGATTGGGAGGG - Intronic
1060223938 9:121780264-121780286 AGCTTGTGCTGGGGGTGGGGTGG - Intronic
1060297276 9:122351271-122351293 GTTTTGTCCTGGGGGTAATAGGG - Intergenic
1060370054 9:123060296-123060318 ATGGTTACCTGGGGGTGGGAGGG - Intronic
1060815384 9:126632493-126632515 ATTTTATCCTGTGGGCAGGAGGG + Intronic
1187162632 X:16779028-16779050 ATTTTCTACTGGTGGTGGGGAGG - Intergenic
1187797554 X:23020958-23020980 ATTTTTTTCTGGGGGGAGGATGG + Intergenic
1187936507 X:24341375-24341397 ATTTTTTGCGGGGAGTGGGATGG + Intergenic
1188401722 X:29753737-29753759 TTTATGACATGGGGGTGGGAGGG + Intronic
1188538055 X:31219271-31219293 CTTCTGTCCTGGGGTAGGGAGGG - Intronic
1189688121 X:43587040-43587062 ATTTTGTCCTTGCTGTGGGTGGG - Intergenic
1189917226 X:45867732-45867754 ATTTTGTCCTTGGAGTGGCTTGG - Intergenic
1190303901 X:49071812-49071834 ATTATGGGCTGGGGGTGGGGTGG + Exonic
1192939336 X:75896435-75896457 ATTTTTTGGTGGGGTTGGGAAGG + Intergenic
1193130039 X:77910430-77910452 CTTTTGTCGTGGGGGCGGGGTGG + Intergenic
1194931449 X:99892677-99892699 ATTTTTGCCTGGGGCTGGGTAGG + Intergenic
1196192033 X:112804904-112804926 ATATGAGCCTGGGGGTGGGAGGG - Intronic
1196807921 X:119605530-119605552 CTATTGGCCTGGGGGTGGGGTGG - Intronic
1197356210 X:125439503-125439525 ACTTTGTGGTGGGGGTGGGGTGG + Intergenic
1197851837 X:130870502-130870524 ATTCTGTCCTGGTGGTAGAATGG - Intronic
1198415035 X:136411447-136411469 ATTTTGTCCTGCAAGGGGGAGGG - Intronic
1200612596 Y:5341871-5341893 ACTTGGACCTGGGGGTGGGGAGG + Intronic
1202585681 Y:26424204-26424226 TTTTTTTTCTGGGGGCGGGAGGG - Intergenic