ID: 1089507683

View in Genome Browser
Species Human (GRCh38)
Location 11:118974996-118975018
Sequence CTGGAGTTCTGGAGAGAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 437
Summary {0: 1, 1: 1, 2: 4, 3: 46, 4: 385}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089507677_1089507683 16 Left 1089507677 11:118974957-118974979 CCAAGTAGAAGCATTGAGTCTGC 0: 1
1: 0
2: 0
3: 6
4: 88
Right 1089507683 11:118974996-118975018 CTGGAGTTCTGGAGAGAAGTGGG 0: 1
1: 1
2: 4
3: 46
4: 385
1089507676_1089507683 26 Left 1089507676 11:118974947-118974969 CCTTAGACATCCAAGTAGAAGCA 0: 1
1: 1
2: 4
3: 17
4: 139
Right 1089507683 11:118974996-118975018 CTGGAGTTCTGGAGAGAAGTGGG 0: 1
1: 1
2: 4
3: 46
4: 385

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089507683 Original CRISPR CTGGAGTTCTGGAGAGAAGT GGG Intronic
900526265 1:3130274-3130296 GTGGGGTTCTGGGGAGAAGCTGG + Intronic
900548627 1:3242397-3242419 CTGGAGCTCTCGAGAGTAGAAGG - Intronic
900627131 1:3613512-3613534 CTGGAATTCAGCAGAGAAGCAGG - Intergenic
902921168 1:19666592-19666614 CTGGAGTTCAGAAGAAAGGTGGG - Intronic
903317074 1:22516387-22516409 CTGGAGTTCTGGGGAAAGGTGGG + Intronic
903518063 1:23925918-23925940 CAGGAATTCTGGAGTGAGGTGGG - Intergenic
904370920 1:30046907-30046929 CTGCAGTTCAGGAGAGAACACGG + Intergenic
904739821 1:32665196-32665218 CTGGAGTTATGGAAAAAATTAGG + Intronic
905295012 1:36948776-36948798 CTGGAGGGCTGGAGACAAGGAGG - Intronic
905751231 1:40466307-40466329 CTGGAGTTCGGGAGAGGTCTGGG - Intergenic
906614032 1:47223054-47223076 GTGGTGTTCTGGAGAGGAGCGGG - Intronic
907418221 1:54329112-54329134 CTGGACTTCTGGAAGGAAGGGGG + Intronic
907962298 1:59295135-59295157 GTGGAGGTCTGGAGGGCAGTGGG + Intergenic
908786924 1:67744356-67744378 CTGGAGTTGCGGACAGCAGTTGG - Intronic
909884619 1:80925368-80925390 GTGGAGATCTAGAGAGAAGATGG + Intergenic
910653772 1:89599431-89599453 GTGGAGAGCTGGACAGAAGTGGG - Intergenic
911143009 1:94525765-94525787 CTGGAGTTCAGAAAAGAGGTTGG + Intergenic
912705467 1:111908639-111908661 CTGGAACACGGGAGAGAAGTTGG - Intronic
912797145 1:112700223-112700245 CTGGAGTTCTGTAAAGAAAACGG + Exonic
912940909 1:114043837-114043859 CTGGAGCTCAGAAGAGAAGTTGG - Intergenic
913263193 1:117019691-117019713 CTGGAGATCAGAAGAGAAATTGG - Intronic
914876117 1:151513649-151513671 CTGGACTTCTGGCAGGAAGTGGG - Intronic
916446926 1:164881150-164881172 CCGGGAGTCTGGAGAGAAGTGGG + Intronic
916719140 1:167470275-167470297 CTGGATTTCAGGAGAGAACTGGG - Intronic
916876040 1:168970620-168970642 CTGAAGTTCTGTAGAAAGGTTGG - Intergenic
917483741 1:175435544-175435566 CTGGAATTCAAGGGAGAAGTTGG + Intronic
917535179 1:175869321-175869343 CTGAACTTCTGGGGAGAAGCAGG - Intergenic
917831579 1:178895580-178895602 CTAGAGTTCAGGAGACAAGAAGG + Intronic
917968416 1:180192752-180192774 CTGGAGTTCCAGGGAGAGGTGGG + Intronic
918045626 1:180939305-180939327 CTGAAGTTCTGGAGAGCAGATGG - Intronic
919771806 1:201165993-201166015 CTGAAGGTCTGGTGATAAGTCGG - Intronic
920038750 1:203082675-203082697 CAGGAGCCCTGTAGAGAAGTGGG - Intergenic
920053122 1:203175326-203175348 CTGGAGCTCTGCAGAGAGGGAGG - Exonic
920126538 1:203698172-203698194 CTGCAGATCTGGAGAAACGTAGG + Exonic
920189145 1:204181288-204181310 TTGCAGTTGGGGAGAGAAGTTGG + Intergenic
920497122 1:206463018-206463040 CTGTAGTTCCGGAGAGATGGTGG + Exonic
921384549 1:214555338-214555360 TTGGAGTAATGGAGAGAAGTGGG + Intergenic
921488512 1:215745178-215745200 CTTGAGTTTTGGAGTGAAGAAGG - Intronic
921536240 1:216352094-216352116 CTGGAGTTCAGGAAAGAGGCTGG + Intronic
922770990 1:228182796-228182818 CTGGAGGTGTGGATAGCAGTTGG + Intergenic
922894041 1:229087265-229087287 CTTAAGATCTGGAGTGAAGTGGG + Intergenic
922923730 1:229330319-229330341 CTGGAGCTCAGGAGAGAAGATGG + Intronic
922936524 1:229426963-229426985 CTGGAGCTGGGGAGAGAAGCAGG + Intergenic
923404074 1:233643241-233643263 CTGGATTTGGTGAGAGAAGTGGG + Intronic
923709624 1:236376508-236376530 CATGATTTCTGAAGAGAAGTTGG + Intronic
924721456 1:246626760-246626782 CTGGAGTTCAGAAAAGAAATAGG - Intronic
1062900602 10:1142418-1142440 CTGGGGATCTGCACAGAAGTTGG - Intergenic
1064561830 10:16601221-16601243 CTGAAGTTCTGGAGACATGGAGG - Intronic
1066253394 10:33655565-33655587 CTGGAGTTCTTGAGGAAAGGAGG - Intergenic
1069722704 10:70559960-70559982 CTGGGGGTCTGCAGAGAACTTGG - Intronic
1069888035 10:71636203-71636225 CTGGAGTCATGGAAAGCAGTTGG + Intronic
1070092322 10:73299984-73300006 CTGGGGTTTTGGAAAGAAATGGG + Intronic
1070394357 10:75999184-75999206 CTGGAAGTCTAGAGAGAATTAGG - Intronic
1070751176 10:78964912-78964934 AGGCTGTTCTGGAGAGAAGTAGG + Intergenic
1071057810 10:81531092-81531114 CTGGAGTTATGGACAGAAAAAGG - Intergenic
1072548830 10:96461504-96461526 TGGGAGTTGGGGAGAGAAGTTGG - Intronic
1073713997 10:106081083-106081105 TTGGAGTTCAGCAGAGCAGTGGG + Intergenic
1075055438 10:119214988-119215010 CTGCAGTTCTGGAGTGAAGACGG + Intronic
1075222895 10:120600286-120600308 ATGGAGATTTGGGGAGAAGTGGG + Intergenic
1075509976 10:123064230-123064252 CTGGGGTGCTGGGGAGAAGTTGG - Intergenic
1075970047 10:126644294-126644316 CTGGAGTTCTGCAGTGGAGGAGG - Intronic
1076230758 10:128818150-128818172 CTGGAGATTTGGAGAGGAGATGG - Intergenic
1077024407 11:432846-432868 CTGGAGGACTGGGGAGAAGCAGG + Intronic
1077643731 11:3904865-3904887 TTGGAGTTCCTGAGAGAGGTAGG + Intronic
1078239262 11:9515255-9515277 CTGGATACCTGGAGAGAAGTTGG + Intronic
1079196300 11:18330536-18330558 CTGAGGTTCTGGTGATAAGTGGG + Intronic
1080720317 11:34842085-34842107 TTGGAGTTCTGCTGAGATGTTGG + Intergenic
1080786031 11:35475891-35475913 CTGGATTTCTGTATAGAAATAGG - Intronic
1082698784 11:56402231-56402253 CTGGAGTTCTGGGTGGGAGTGGG - Intergenic
1082998632 11:59272434-59272456 CTGGAGTTGTATATAGAAGTGGG - Intergenic
1083410573 11:62489703-62489725 CTGGAGCTCGGAAGAGAAGCAGG + Intronic
1084012678 11:66361400-66361422 CTAGAGTCCTGGAGTGAGGTTGG - Intronic
1084161773 11:67353968-67353990 CTGGAGGTCTGAAGAGAGTTTGG + Intronic
1086106320 11:83151516-83151538 CTGGAGTGCTGGAGTGCAGGTGG + Intergenic
1088168565 11:106967927-106967949 CTAAAGTCCTGAAGAGAAGTAGG + Intronic
1088205429 11:107387096-107387118 CTGGAGTTCTGGGTAGATGCTGG - Intronic
1088474353 11:110219832-110219854 CTGAAGTTCAGGGGAGAATTTGG + Intronic
1089507683 11:118974996-118975018 CTGGAGTTCTGGAGAGAAGTGGG + Intronic
1089792175 11:120953227-120953249 GTGGGGGTCTGGGGAGAAGTGGG - Intronic
1089806918 11:121098580-121098602 CTGGCATTCAGGAGAGAAGGTGG + Intergenic
1089974688 11:122722311-122722333 CTGGAGTGCAGGAGAGAACCAGG - Intronic
1090201502 11:124861189-124861211 CTGGAAATCTGGAGACAACTGGG - Intergenic
1090528059 11:127559191-127559213 CTGGAGCTCCAGGGAGAAGTTGG + Intergenic
1090718212 11:129449352-129449374 ATGGAGTAATGGAGAGAAGCAGG + Intronic
1091035432 11:132228599-132228621 CATGAGTTCTGGGGAGAAGGTGG - Intronic
1091352669 11:134909769-134909791 CTGGAGCTCAGAAGACAAGTAGG - Intergenic
1094525567 12:31228737-31228759 CAGGAGTTCTGTGGAGAACTGGG - Intergenic
1095406968 12:41877391-41877413 GTGGGGTACTGGAGAGATGTTGG + Intergenic
1095918676 12:47506980-47507002 CTGGAGTTGTGGGGAGAGGTTGG + Intergenic
1096550608 12:52369568-52369590 CGGGAGTTGTGGAGAGAGGCAGG - Intergenic
1096576517 12:52556316-52556338 CAGGAGTTCAGAAGAGCAGTGGG - Intergenic
1096673527 12:53214228-53214250 CTGGAGTTCTGCAGAGGGGAGGG + Exonic
1096808519 12:54155304-54155326 CTAGAGCTCTGGAGGGAAGAGGG - Intergenic
1097141853 12:56908757-56908779 CCTGAGTTCTGGGGACAAGTGGG + Intergenic
1097216513 12:57418035-57418057 CTGGAGTGCTAGAGAGAGGCAGG - Intronic
1097642490 12:62199154-62199176 CTGGAGTACTGGGGATAAGTAGG + Intronic
1097768619 12:63553854-63553876 CAGGAGATCAGGAGAGGAGTTGG - Intergenic
1097784979 12:63748895-63748917 CAGGAGATCAGGAGAGGAGTTGG - Intergenic
1098081514 12:66790929-66790951 CTGGAGGACTGGAAAGAAGATGG + Intronic
1098336332 12:69408684-69408706 CTGCAGTTCTGGAGACTACTTGG - Intergenic
1100661715 12:96706920-96706942 TTGGAGTTCAGAAGAGAGGTTGG + Intronic
1101219228 12:102619050-102619072 CTGGAGCTGGGGTGAGAAGTGGG - Intergenic
1103190369 12:118996212-118996234 CAGGTGTTTTGGAGAGAACTAGG - Intronic
1103256526 12:119546246-119546268 CTGGTGTTGTGGAGGAAAGTTGG + Intergenic
1104283149 12:127396674-127396696 CTGGTGTCCTGGAGAGGAGCGGG + Intergenic
1105968415 13:25405315-25405337 ATGGAGTCCTGAAGAGAAATGGG + Intronic
1108525851 13:51285367-51285389 ATGAATTTCAGGAGAGAAGTAGG + Intergenic
1112143240 13:96669924-96669946 GTGGAGTTCAGGAGACAAATAGG + Intronic
1112430859 13:99349111-99349133 CTGGAGGTCTGAAGACAAGGAGG - Intronic
1112672670 13:101659090-101659112 CTGGAGAGCTGGAGTGCAGTGGG + Intronic
1113166544 13:107449659-107449681 TTGGAGTTCAGAAGAGAAATTGG + Intronic
1113722503 13:112570211-112570233 CTGGAGTTCTGGGAAGGACTGGG - Intronic
1114176630 14:20326734-20326756 CTGGATTTCTAGATAGAAGCTGG - Exonic
1114358797 14:21946432-21946454 CATGATTTCTGAAGAGAAGTTGG - Intergenic
1114572700 14:23684784-23684806 CTGGAGTTCAGGAAAGAGGGTGG + Intergenic
1115401002 14:32960258-32960280 AATGAGTTCTGGAGAGAAGCAGG + Intronic
1115772876 14:36684894-36684916 TTGGAGTTTTGGAGAAAATTTGG - Exonic
1115975238 14:38989979-38990001 CTGGAGCTCAGGAAAGAGGTAGG + Intergenic
1116478171 14:45365562-45365584 CCAGAGTTATGGGGAGAAGTAGG + Intergenic
1116484725 14:45433932-45433954 GTGGATTTCAAGAGAGAAGTGGG + Intergenic
1117435972 14:55715582-55715604 TTGGACGTCTGGAGGGAAGTGGG - Intergenic
1117702535 14:58427755-58427777 CGGGCGTTCTGGAGATACGTAGG + Intronic
1118033428 14:61840293-61840315 CTAGAGCTTGGGAGAGAAGTTGG + Intergenic
1118294070 14:64552587-64552609 CTGGAGGTCAGGAAAGGAGTTGG + Intronic
1118352411 14:64982620-64982642 CTGGAGTTCAGGAGAGATCCAGG + Intronic
1118440189 14:65805001-65805023 GTGGAGCTCAGGAGAGAAGTGGG - Intergenic
1118895519 14:69942561-69942583 CTGGAGATAAGGAGAGAAGCAGG - Intronic
1119983045 14:79103535-79103557 CTGGAGTTCGGGAGGGAAGTTGG + Intronic
1120863387 14:89275059-89275081 CTGGAGTCCTGGTGAGGATTTGG - Intronic
1122368399 14:101212875-101212897 CTGGATTCCTGGAAAGATGTTGG + Intergenic
1122971518 14:105154174-105154196 GTGGCGTTTTGGAGAGGAGTCGG - Intronic
1123699094 15:22901567-22901589 CTGCAGCTCTGGAAAGAAGCTGG - Intronic
1124177502 15:27440045-27440067 GTGGGAATCTGGAGAGAAGTGGG - Intronic
1126873052 15:53010154-53010176 CTGGAGTTCAGGAGAGAGGCTGG + Intergenic
1127488420 15:59439961-59439983 CTGGTGCTCGGGAGAGAAGGTGG - Intronic
1128050892 15:64663539-64663561 CTGGAGTTTAGGGGAGAGGTTGG + Intronic
1128529563 15:68434555-68434577 CTGGAGAACTGCAGAGAATTTGG + Intergenic
1128925106 15:71648192-71648214 CTGGTGTTGTTGAGAGAATTAGG + Intronic
1129505133 15:76075132-76075154 CTGAAGTTCTGGGGAGAAGATGG + Intronic
1129789965 15:78334482-78334504 CAGGAGTTCTGGGCAGAAGAGGG - Intergenic
1129872914 15:78952425-78952447 CAGGGTTTCTGGAGAGAAGAGGG - Intergenic
1129975748 15:79819910-79819932 CTGGAGTTCTAAAGAAAGGTAGG - Intergenic
1130264065 15:82382862-82382884 GTGGATTTGTGGAGAAAAGTAGG + Intergenic
1130820384 15:87489101-87489123 CTGGAGTTCTGGCCAGAGATTGG + Intergenic
1130988214 15:88858521-88858543 CTGGATTTCTGGACCTAAGTGGG + Exonic
1131149877 15:90040699-90040721 CTGGAGTTGGGGAGCGAGGTGGG - Intronic
1131158747 15:90090840-90090862 CTGGGGCTTTGGAGAGAGGTTGG + Intronic
1132663665 16:1072392-1072414 CTGGGGTTGTGGAGATAAGTGGG - Intergenic
1132970485 16:2685889-2685911 GTGGGGGTCTGGAGAGGAGTTGG + Intronic
1132978424 16:2721586-2721608 CTGGGGGTCTGGAGGGAAGGAGG + Intergenic
1133025786 16:2988426-2988448 CTGGGGTTCTGGAGACAAGGAGG + Intergenic
1133106702 16:3515306-3515328 CTTGAGCTCTGGAGAGAGCTGGG + Intronic
1133398056 16:5464232-5464254 CTGGTGCTCAGGAGAGCAGTTGG + Intergenic
1135020817 16:18961664-18961686 CTGGAGTTCTAGAGAGAGGATGG - Intergenic
1136143546 16:28302186-28302208 CTGGAAAACTGGAGAGAAGGAGG + Intronic
1137491643 16:48938004-48938026 CTGGAGATGTGGAGAGAGGGAGG + Intergenic
1137733955 16:50710680-50710702 CTGGAGGTCTGGGCAGATGTGGG + Exonic
1138443140 16:57047045-57047067 CTGGAGGCCTAGAGAGAGGTGGG - Intronic
1138738799 16:59282530-59282552 TTGGGTTTCTGAAGAGAAGTTGG - Intergenic
1140962980 16:79935002-79935024 CTTGAATTTTGGAGGGAAGTGGG + Intergenic
1141952216 16:87346343-87346365 CTGGAGATCAGGAGAAAAGGCGG + Intronic
1142694031 17:1623594-1623616 CTGGAGGAGAGGAGAGAAGTGGG - Intronic
1143168134 17:4909307-4909329 CTTGATTTGTGGACAGAAGTAGG + Intergenic
1148645548 17:49217970-49217992 CTGGGGTTCTGGAGGGAAAGGGG - Intronic
1148910404 17:50939545-50939567 CTGGAGTTCAGGGGAGAGGGTGG + Intergenic
1149242040 17:54662485-54662507 CTGGAGAAATGGACAGAAGTAGG - Intergenic
1149306084 17:55347726-55347748 CTGGGGGGCTGGAGAGGAGTGGG - Intergenic
1151144343 17:72027025-72027047 CAAGAGTTCTGCAGAGAAGAAGG - Intergenic
1152662539 17:81549436-81549458 CTGGACTCCAGGAAAGAAGTTGG + Intronic
1153140868 18:1971208-1971230 GTGGAGGTCTGGATAAAAGTGGG - Intergenic
1153338384 18:3948472-3948494 CTGCAGTGCTGGAGAGAGGCAGG - Intronic
1154395925 18:13988569-13988591 ATGGAGACCTGGGGAGAAGTGGG + Intergenic
1158561649 18:58519070-58519092 CTAGGTTTCTGGAGAGAACTGGG + Intronic
1159558211 18:69967040-69967062 CTGGAAATCAGAAGAGAAGTAGG + Intergenic
1159774651 18:72589429-72589451 CTGGAGTTTGGGATAGAGGTGGG + Intronic
1159840201 18:73390407-73390429 TTGGTGTTCTGGTGAGAAGTGGG - Intergenic
1159888292 18:73931322-73931344 CTGGAGAGCTGGAGAGAAAATGG - Intergenic
1163505238 19:17701875-17701897 CTGGAGCTCTGGGGAGATGCAGG + Intergenic
1165448602 19:35869793-35869815 CTGGAGTACTGCAGACAGGTGGG + Exonic
1165560908 19:36678800-36678822 CTGGAGTGCTGGAGTGCAGTGGG - Intergenic
1165947369 19:39452261-39452283 CTTGAGTTCTGGAAAAAAGTGGG + Intronic
1167369889 19:49074146-49074168 CTGGGGGTGTGGAGAGAGGTAGG + Intergenic
1167477737 19:49710638-49710660 CTGGAGGTCTGGACAGAGATAGG + Intronic
1167890978 19:52539050-52539072 CGGGAGTGGGGGAGAGAAGTAGG + Intronic
926108638 2:10168196-10168218 CTGCAGTTGGGGAGAGAGGTTGG - Intronic
926202789 2:10813350-10813372 CTGGGGTTCTCCAGAGAAGGAGG - Intronic
926297595 2:11579874-11579896 CTGGAGTCCAGGAGAGCAGTCGG - Intronic
926764746 2:16314489-16314511 CTGGAGTTCAGAAGAGAGGTTGG + Intergenic
927820241 2:26258037-26258059 CTAGAGTTCTGGGAACAAGTTGG - Intronic
928200854 2:29246814-29246836 CTGGAGGTGGGGAGAGCAGTTGG - Intronic
928335237 2:30392254-30392276 CTGGTGTTCTAGAGAGAAGGAGG + Intergenic
928782677 2:34844061-34844083 CTCAAGTGCTGGAGAGAACTAGG + Intergenic
930765969 2:55085412-55085434 CTGGAGACCTGGAGAGGAGTGGG + Intronic
930851086 2:55961290-55961312 CTGTAGATCTGGAAAGAAGTTGG + Intergenic
931131465 2:59341159-59341181 CTGGAGATCTGGAAAGAGGGTGG + Intergenic
931396315 2:61890894-61890916 CTGGTCCTCTGAAGAGAAGTCGG - Intronic
931669182 2:64631238-64631260 CTGGAGCTCAGGAGAGAGGCAGG + Intergenic
932571273 2:72939741-72939763 CTGGAGCTCAGGAGACAGGTAGG - Intergenic
932604519 2:73156327-73156349 CTGGAGCTCTGGGGAAAGGTTGG - Intronic
932910268 2:75799231-75799253 TTGCAGTTCTGGAGAGATGTGGG + Intergenic
933010764 2:77059864-77059886 CTGCTGCTCTTGAGAGAAGTTGG - Intronic
934619440 2:95795087-95795109 CTGGAGCTCAGAAGAGAGGTTGG + Intergenic
934641450 2:96029470-96029492 CTGGAGCTCAGAAGAGAGGTTGG - Intronic
934753802 2:96811186-96811208 CTGGAAGCCTGGAGAGAAGGTGG + Exonic
935200191 2:100849749-100849771 CTGGAAAACTGGAGAGAGGTTGG + Intronic
936023005 2:109009409-109009431 CTGGACTTCTGAAGAAAATTTGG + Intergenic
937002737 2:118482999-118483021 CTGGGGTTCTGGAAGGAAATGGG + Intergenic
937707842 2:124941759-124941781 CTGAAGTTCTGAAGTGATGTGGG + Intergenic
938772006 2:134508744-134508766 CTGGAGTTCAGGAGAGTTGAGGG - Intronic
939504885 2:143033013-143033035 CTGGTGTTCTGCTAAGAAGTTGG + Intronic
939908738 2:147952718-147952740 CTGAACTTCTTGAGAGCAGTCGG - Intronic
940494788 2:154413134-154413156 CTAGAGCTCAGGAGAGAGGTTGG - Intronic
940538921 2:154985315-154985337 CTGGAGTTCTGAAGAAAATGAGG - Intergenic
940701738 2:157053215-157053237 CTGAAGAGCTGGAGAGAAGAGGG + Intergenic
942003908 2:171678635-171678657 CTGGAGTTCAAGAGAGATGCTGG - Intergenic
942371522 2:175290767-175290789 CTAGAGTTCAGGAGAAAGGTAGG - Intergenic
943404071 2:187457263-187457285 CTGGAGTTCAAGACAGTAGTGGG + Intergenic
943794959 2:191980693-191980715 CTGGAGGTCTGGAGAGAAGAGGG - Intronic
945519966 2:210814211-210814233 CAGGAGCAATGGAGAGAAGTAGG + Intergenic
945670435 2:212795891-212795913 CTGGAGATCTGAACAGAATTGGG - Intergenic
946292496 2:218755815-218755837 CTGGAGTTCTGTGGCGAGGTGGG + Intergenic
946658623 2:221976048-221976070 CTGGTGTTCAGGAGAGAGTTTGG - Intergenic
947545061 2:231004686-231004708 CTGGAGTTCTGGAGGCAGGCAGG + Intronic
947828842 2:233124944-233124966 CTGGGGTTCTGAAGACAACTAGG - Intronic
949010867 2:241677620-241677642 CTGGAGTCTGGGAGAGAGGTAGG + Intronic
1169275174 20:4228877-4228899 CTGGAGACGTGGAGAGAAGAAGG - Intronic
1169489468 20:6058865-6058887 CTGGAGTTCTGGGGGTAAATGGG - Intergenic
1171348976 20:24488391-24488413 GTGGAGCACTGAAGAGAAGTGGG - Intronic
1172583415 20:36065654-36065676 CTGGACAGCTGGAGAGAAGGTGG - Intergenic
1172650501 20:36498669-36498691 TTGGCCTTGTGGAGAGAAGTAGG - Intronic
1173672075 20:44805814-44805836 CTGGGGGTGTGGAGAGAAATCGG + Intronic
1173827271 20:46055952-46055974 CTGGGGTTCTGGAGAGGAGGTGG + Intronic
1174041780 20:47705316-47705338 CTGGCGTTCTGCAGAGGAGGAGG + Intronic
1174100597 20:48123688-48123710 CTGGAGATCTGGACAGGAGCTGG - Intergenic
1174148992 20:48472880-48472902 CTGGAGACCTGGAGAGGAGATGG - Intergenic
1174149300 20:48474902-48474924 CTGGAGAACTGGAGAGGAGATGG - Intergenic
1174149537 20:48476414-48476436 CTGGAGACCTGGGGAGAAGCTGG - Intergenic
1174765147 20:53246558-53246580 GGTGAGTTATGGAGAGAAGTTGG - Intronic
1175166699 20:57049095-57049117 CTGGAGGTCTGGAGAGGGGCAGG + Intergenic
1177088672 21:16739342-16739364 CTGCACTTCTGGAGTAAAGTCGG + Intergenic
1177149516 21:17440897-17440919 CTGGGGTGCTGGAGAGAAGTAGG - Intronic
1177410276 21:20721018-20721040 CCTGACTTCTGGAGAGAAGGAGG + Intergenic
1178565155 21:33677233-33677255 CTGCAGTTCTTGGGAGAAGTAGG - Intronic
1179108614 21:38425744-38425766 TTGGAGTTCTGCAGAGAACTTGG + Intronic
1180634979 22:17257078-17257100 CTGGAGTGGTGGAAAGAACTGGG - Intergenic
1180991730 22:19941328-19941350 CTAGGGGTCTGGGGAGAAGTTGG + Intronic
1182143827 22:27984571-27984593 TTGGAGTTCAGGGGAGAGGTTGG - Intronic
1182190328 22:28453427-28453449 CTGGAGCTCAGTAGAGAAGTGGG - Intronic
1182307440 22:29380393-29380415 CGGGGGTTCTGGGGAGAGGTTGG - Intronic
1182919948 22:34070071-34070093 CTGGAGCCCGGGAGAGAAGCTGG - Intergenic
1182971644 22:34584607-34584629 CAGGAGTTCTGGGGAGGGGTAGG + Intergenic
1183342453 22:37289112-37289134 CTGGTCTTCTGGAGAAAAGATGG + Intronic
1184085021 22:42256159-42256181 CTGGAGTGCTGGGGAGAACTAGG - Intronic
1184434462 22:44461819-44461841 CTGGAGCTCAGGAGAGATGCTGG - Intergenic
949158883 3:857827-857849 CTGGAGACCTGCAGAGAAGCCGG - Intergenic
949159397 3:861464-861486 CTGGAGATCTGGGGAGGAGCTGG - Intergenic
950040380 3:9916056-9916078 CTGGAGTTCTGGAGAGGAAGTGG - Exonic
950571411 3:13802489-13802511 CTGGAGTTCTGGAAGGAAGCAGG + Intergenic
951984104 3:28598694-28598716 GTGGCGTTCTGAAGAGGAGTGGG + Intergenic
952414431 3:33077503-33077525 ACAGAGTTCTGGAGTGAAGTGGG - Intronic
954248780 3:49352545-49352567 CAGGCATCCTGGAGAGAAGTTGG + Intergenic
954454080 3:50587646-50587668 CTGGAGTTCTGCAGACATGCGGG + Intergenic
954576910 3:51681368-51681390 CTGGAGTGATGGAGAGAGATGGG + Intronic
957374518 3:79338825-79338847 GTGGAGTTCAGGTGAGAAGTAGG - Intronic
960898804 3:122533411-122533433 CTGCAGGTCAGGAGAGAGGTAGG + Intronic
961328432 3:126125209-126125231 CAGAAGTCCTGGAGAGAAGCAGG - Intronic
961638859 3:128352216-128352238 CTGAAGTTCTCCAGAGATGTAGG + Intronic
963973899 3:151459725-151459747 CTGCATTTCAGGAGAGAATTAGG - Intergenic
965716876 3:171614223-171614245 CTGGAGTGCTGCTGAAAAGTGGG + Intronic
966934381 3:184696201-184696223 GTGGAGTTCTGGAGAGATGCTGG - Intergenic
967320957 3:188194598-188194620 CTGTAGTTCTTGAGGGAAGAAGG + Intronic
967711224 3:192710717-192710739 CTGGGATTGTGGAGAGCAGTTGG - Intronic
968984902 4:3869831-3869853 CTGGAGTTGTGGCGAGGACTAGG - Intergenic
969042729 4:4313489-4313511 CTAGATTTCAGGAGAGAAGGAGG + Intronic
969476980 4:7427413-7427435 CTGAAGCTCAGGAGTGAAGTCGG - Intronic
969875703 4:10134194-10134216 CTGGAGTTCTGAAGCTAAGCGGG + Intergenic
970243564 4:14034637-14034659 AGGGGGTTCTGGAGAGATGTTGG + Intergenic
971423879 4:26497817-26497839 CTGAAGTGCTGGAGTGCAGTGGG + Intergenic
971428169 4:26536305-26536327 GTGGAGTGCAGGAGAAAAGTTGG - Intergenic
971872196 4:32256923-32256945 CTGGAGTTCTTCAGAGAAAGAGG - Intergenic
972389882 4:38604587-38604609 CTAGAGTTCAGGAGGGAAGATGG - Intergenic
972664744 4:41154149-41154171 CTGGAGAACTGGGGAGAAATTGG - Intronic
972669712 4:41203704-41203726 CTGGAGTACTGGGGAGAATTGGG - Intronic
975421353 4:74167700-74167722 CTGAAGATCTGGAGAGAACATGG + Intronic
975983731 4:80184913-80184935 TTAGGGTTTTGGAGAGAAGTGGG - Intronic
978764776 4:112392849-112392871 CTAGAGTTAGGGAGAGGAGTTGG - Intronic
978928141 4:114275608-114275630 CTGCAGTTTGGGAAAGAAGTGGG - Intergenic
981409377 4:144410835-144410857 CTGAAGTTTTGGAGGGAAGAGGG - Intergenic
981730021 4:147887329-147887351 CTGGAGCAGTGGAGAGAAGATGG - Intronic
981830988 4:149001666-149001688 CTGGAGTTCTGGAGTTCAGGGGG - Intergenic
982442571 4:155454098-155454120 CTGTAGTGCTGGAGTGGAGTAGG + Intergenic
983558910 4:169082238-169082260 CTGGAGTTAGAGAGAGAAGCAGG - Intergenic
984758570 4:183345023-183345045 GTGGAGAGGTGGAGAGAAGTGGG + Intergenic
985232221 4:187831718-187831740 ATGGAGGTCTGGGGAGATGTTGG - Intergenic
985893531 5:2735089-2735111 TTGGAGCTCTGGAGTGCAGTAGG - Intergenic
986591742 5:9377739-9377761 CTAGAGTCCTGGAGATGAGTTGG + Intronic
987876926 5:23691174-23691196 CTGGAGTTCTGGGTGGACGTGGG + Intergenic
988065594 5:26226584-26226606 CTGGAGACCTGGGGAGGAGTGGG - Intergenic
988628778 5:32906577-32906599 CAGGAGTTCAGGAGAGAAGGTGG + Intergenic
988866624 5:35342290-35342312 CTGGATTTCCAGAGAGATGTTGG + Intergenic
989173642 5:38498441-38498463 CTGGAGCTCAGGGGAGAGGTTGG - Intronic
989413236 5:41144176-41144198 CTGGACGTATGGGGAGAAGTAGG - Intronic
989530950 5:42507783-42507805 CTAAAGTTCTGGAGAGACATAGG + Intronic
990417121 5:55597213-55597235 CAGGAGTCCTGGAGAGGAGAGGG + Intergenic
990597235 5:57323924-57323946 CTGGAGTTCTGGAGGTTAGAAGG - Intergenic
990831946 5:59969188-59969210 GTGGACTTGTGAAGAGAAGTGGG - Intronic
991217546 5:64172778-64172800 ATGGAGCACTTGAGAGAAGTAGG + Intronic
991509671 5:67362886-67362908 CTGGAGTTTGGAGGAGAAGTTGG - Intergenic
993738893 5:91511781-91511803 TTGGAGATGTGGATAGAAGTAGG + Intergenic
994607360 5:101985863-101985885 CGGAAGTACTGGAGAGTAGTTGG - Intergenic
995851795 5:116553987-116554009 CTGTATTCCTGGAGAGGAGTGGG + Intronic
995910743 5:117183615-117183637 CTGGTGTTTTGGAGGGATGTGGG + Intergenic
997061277 5:130506284-130506306 GGGGAGTTTTGGAGAGATGTTGG - Intergenic
997481241 5:134186207-134186229 CAGGAGTGCAGGGGAGAAGTTGG + Intronic
997534584 5:134608838-134608860 CTGAAGCTCTAGAGAGAATTAGG + Intronic
998746719 5:145268491-145268513 CTGGAGTTCAGAGGAGGAGTGGG - Intergenic
999054301 5:148557255-148557277 CTGGGGAGATGGAGAGAAGTGGG + Intronic
999305332 5:150515816-150515838 CGGGAGTTCTGGAGTGCAGGCGG + Intronic
999322042 5:150621496-150621518 CTGGAGATCAGGAGGGAAGAAGG + Intronic
999744110 5:154578529-154578551 CTGGAGTTTTGGGGTGGAGTAGG - Intergenic
999924937 5:156364834-156364856 CTACAGTTCTGGAGAGAAAATGG - Intronic
1000533535 5:162453231-162453253 CTGGAGATCTGGAGGGCAGAGGG - Intergenic
1001090330 5:168735383-168735405 CTAGAGTCCTGGAGTGATGTGGG + Intronic
1002837450 6:876895-876917 CTGAAGTTCTGCAGAGCAGACGG + Intergenic
1003110781 6:3250543-3250565 CTGGAGCTCAGGCGAGAGGTTGG + Intronic
1003272225 6:4617346-4617368 CTACAGTTCTTGAGAGAAGGAGG - Intergenic
1003277545 6:4665266-4665288 CTAGAGCTCAGAAGAGAAGTTGG - Intergenic
1004962664 6:20808679-20808701 CTGGGTTTCAGGAGAGAAGATGG + Intronic
1005707470 6:28469663-28469685 CTGGAGTTCCGGGGAGACGTGGG - Intergenic
1005942355 6:30570173-30570195 CTGGAGCTCGGGGCAGAAGTTGG + Intergenic
1007248528 6:40479828-40479850 CTTGCGTGCTGGAGAGAAGGAGG - Intronic
1009451952 6:63811609-63811631 CTGGAGCTCTGGAAAAAAGCAGG - Intronic
1009873147 6:69473132-69473154 CTAGAGTTCTGGATAGGCGTGGG + Intergenic
1010344691 6:74798317-74798339 CTGGAGTTCTGGGGAGGACTAGG + Intergenic
1010655813 6:78509334-78509356 CTGAAGTTCTCGGGAGAACTAGG + Intergenic
1010949792 6:82022172-82022194 ATGGATTTATGGAGAGAAATTGG + Intergenic
1011249921 6:85360295-85360317 CTGAGGAGCTGGAGAGAAGTTGG + Intergenic
1011659719 6:89583851-89583873 CTAGAGTTGAGGAGAGAAGCAGG - Intronic
1012587792 6:100945336-100945358 CTAGAGCTCTGGAAACAAGTGGG + Intergenic
1013050882 6:106533843-106533865 CTGGAGTTCAGGGGAGAGGCTGG + Intronic
1013545061 6:111148643-111148665 CTGTAGTTCTTTACAGAAGTTGG + Intronic
1014138790 6:117917734-117917756 GTGGAATTCTGGGGAGAAGTCGG + Intronic
1014259853 6:119203839-119203861 CTGGAGTTCAGGGGACAGGTTGG + Intronic
1014567685 6:122970285-122970307 CTGGAGTTCAGGAAAGATGAGGG - Intergenic
1015151927 6:130049758-130049780 CTGGAGCTCGGGGGAGAGGTCGG - Exonic
1016015180 6:139176763-139176785 CTGCATATCAGGAGAGAAGTTGG + Intronic
1017220546 6:151961104-151961126 CTGGAGTTTAGGAGAGAGGCTGG + Intronic
1017510750 6:155112616-155112638 CTGGAGTTCAGGAGAGAAGTGGG - Intronic
1017537347 6:155363119-155363141 CTGGAGTTCTGGGCAGGCGTGGG + Intergenic
1017705077 6:157114816-157114838 CTGCACCTCTAGAGAGAAGTAGG - Intronic
1017819157 6:158037330-158037352 CTGGAGTCCTGGAGAGACACAGG - Intronic
1018923500 6:168191465-168191487 CTGGGCTTGTGGAGAGAAATGGG + Intergenic
1019102291 6:169641225-169641247 CTGGAGCTCGGGAGAGGAGGGGG - Intronic
1019117349 6:169775631-169775653 CTGAAGCTCAGGAGAGAAGTAGG + Intronic
1019861491 7:3662537-3662559 CTGGAGGTCCAGAGAGAAGAAGG + Intronic
1020880316 7:13753849-13753871 CTGAAGTTCAGGTGAGGAGTGGG - Intergenic
1022147388 7:27558644-27558666 CTGGAGTGCTGGAGTGAATATGG - Intronic
1022171797 7:27838607-27838629 CTTGGGTACTGGAGAGAAGAGGG - Intronic
1022470497 7:30679167-30679189 CTGGACTTCTGGGGACAGGTTGG - Intronic
1022729620 7:33010221-33010243 CTGTGGAACTGGAGAGAAGTGGG - Intergenic
1023591339 7:41783635-41783657 CTGTAGATGTGGAGAGAAGACGG + Intergenic
1026339615 7:69424149-69424171 CTGGGGTGCTGGGGAGAAATGGG + Intergenic
1026896493 7:74012888-74012910 CTGGAGTGCAGGAGGGAAGCTGG + Intergenic
1027890500 7:83967355-83967377 CTGGAGCTGGGGAGAGAAGGGGG - Intronic
1028967823 7:96822214-96822236 TTGGACTTCTGGAGATAAGGAGG - Intergenic
1029210463 7:98904104-98904126 CAGGAGTACTGGAAAGAGGTTGG - Intronic
1030108864 7:106009553-106009575 GTGGAGTTCTTGAGAGCAGGTGG + Intronic
1031069926 7:117150727-117150749 CTGGAGTTCAACAGAGAAGAGGG - Intronic
1032809283 7:135394226-135394248 GAGGAGTTCTGAAGAGATGTGGG + Exonic
1034828629 7:154289703-154289725 CTGAAGTTGTGCAGAGAAGGTGG - Intronic
1035006099 7:155662330-155662352 CTGCTGTGCTGGAGAGAAATGGG - Intronic
1035034346 7:155885378-155885400 CTGGAGTCCTGGAAAGCCGTAGG + Intergenic
1035173517 7:157033964-157033986 GTGGAGATCAGGAGAGAAGCAGG + Intergenic
1036102568 8:5802844-5802866 CTAGAGCTCTGGAAACAAGTGGG - Intergenic
1036260454 8:7235748-7235770 CTGGAGTTCTGGATGGGCGTGGG + Intergenic
1036306161 8:7603774-7603796 CTGGAGTTCTGGATGGGCGTGGG - Intergenic
1036312491 8:7694304-7694326 CTGGAGTTCTGGATGGGCGTGGG + Intergenic
1036357006 8:8051759-8051781 CTGGAGTTCTGGATGGGCGTGGG - Intergenic
1037606488 8:20442090-20442112 CTGGAGTTCAGGGGAGGAGAAGG + Intergenic
1038024725 8:23578183-23578205 CTGGAGTTCAGGAGAAGAATCGG - Intergenic
1038453804 8:27658364-27658386 CAGGACTTCTGGAAGGAAGTTGG + Intronic
1039061279 8:33573953-33573975 CTGGAGTTCTGGGTGGATGTGGG + Intergenic
1039890361 8:41681768-41681790 CTTGTGTTCTGGAGAGAAGGTGG - Intronic
1040610175 8:48976367-48976389 CTGGAGCTCTGGAGGGGATTAGG - Intergenic
1040756695 8:50783832-50783854 CTGAAGTTCTGGAGCCAAGATGG - Intronic
1041758666 8:61340336-61340358 CTGGAGGACTGGGGAGATGTTGG - Intronic
1041919946 8:63169554-63169576 CCGAAGTTCTGGATAGAACTTGG - Intronic
1042482790 8:69322958-69322980 CTGGAGACCTGGGGAGGAGTGGG + Intergenic
1043973832 8:86563352-86563374 ATGGGGCACTGGAGAGAAGTGGG - Intronic
1045082919 8:98648067-98648089 CTGGAGTTGTAGAGAAAGGTAGG - Intronic
1045412634 8:101933821-101933843 CTGGAGTTCAGGACAGTGGTAGG + Intronic
1045611455 8:103847691-103847713 CTGGACATCTGGTGATAAGTTGG - Intronic
1046728816 8:117703449-117703471 CTGCAGTTCTGGAAGGAAGGTGG + Intergenic
1047195457 8:122717114-122717136 CTGGATTTTTAGAGAGAAGTCGG - Intergenic
1047768842 8:128014031-128014053 CTGTTGTTCTGGTGAGCAGTGGG + Intergenic
1047804316 8:128343507-128343529 CAGGAAATCTGGAGAGAAATAGG + Intergenic
1048294966 8:133207277-133207299 CTGGACTTCAGGGGAGAAGCAGG + Intronic
1048497200 8:134945248-134945270 CTGGAGATTTGCAGACAAGTTGG - Intergenic
1048505837 8:135020519-135020541 CAGGAGTGTTGGAGGGAAGTGGG - Intergenic
1049001263 8:139826813-139826835 CTGGGTTTCTGCAGAGAGGTTGG + Intronic
1049188579 8:141272790-141272812 CTGGTGTTGTGGAGGGAAGGGGG - Intronic
1049778341 8:144416375-144416397 CTGGGGTCCTGGGGAGAAGAGGG + Intronic
1050301559 9:4264016-4264038 CTGGAGCTCTGGAGTGAAGTGGG - Intronic
1053052684 9:34975028-34975050 CTGGAGGTGTGGAGAGCAGTTGG - Intronic
1054821947 9:69531534-69531556 CTGGAGTGCTGGAGAGGGGAAGG - Intronic
1055266182 9:74498175-74498197 CGGGAGTTCTGGAGGGACGCGGG + Intronic
1055378309 9:75675725-75675747 CATGATTTCTGAAGAGAAGTGGG - Intergenic
1055394105 9:75855124-75855146 CTGCAATTCTGGAGAAAAGAGGG + Intergenic
1055669498 9:78588670-78588692 TGGGAGTTCTGGTGAGAGGTTGG + Intergenic
1057734557 9:97643528-97643550 CTGGAGCTCAGGAGAAAGGTTGG - Intronic
1058432256 9:104929485-104929507 CTGGAGGTGGGAAGAGAAGTAGG - Intergenic
1059155478 9:111985104-111985126 CTGAAGTTCTGCACAGATGTTGG - Intergenic
1060594397 9:124839757-124839779 CTGAACTTCTGGAAAGAAATGGG + Intergenic
1061196380 9:129109359-129109381 CAGGAGTCCTGGAGAGAAACAGG - Intronic
1061319595 9:129819880-129819902 CTGGAGTGCTGGAGTGCAGTGGG - Intronic
1061972499 9:134052629-134052651 CTTGGGGTCTGGAGAGAGGTTGG - Intronic
1062352118 9:136144316-136144338 CTGCAGGTCTGGAGAGAGGCTGG + Intergenic
1062486265 9:136777885-136777907 CTGGAGACCTGGGGAGAAGCTGG - Intergenic
1186477171 X:9866587-9866609 CAGGAGTTCTGCAGAGATGTAGG + Intronic
1187776139 X:22760175-22760197 CTGGAGTTCTTAAAAGAAGAGGG + Intergenic
1188060611 X:25596417-25596439 GTGGAGTCATGGAGAGAAGCTGG + Intergenic
1189292582 X:39896560-39896582 CTGGAGTTCTGGAGAGTTCCCGG + Intergenic
1189326381 X:40114238-40114260 CTGTAGTTCTGGTGAGGATTGGG + Intronic
1189350667 X:40273342-40273364 TTGGAGACCTGGGGAGAAGTTGG - Intergenic
1189892031 X:45612826-45612848 CTGGAGTTGTGGAGACAGGCTGG - Intergenic
1190062795 X:47221882-47221904 CTGGATTTGAGGAGAGAAATGGG - Intronic
1190442757 X:50492243-50492265 TTGGAGCTCTGGGGAGAAGCTGG + Intergenic
1190715942 X:53103661-53103683 GAGGATTTCAGGAGAGAAGTAGG - Intergenic
1191128502 X:56983510-56983532 CTGAGGTTTTGGAAAGAAGTGGG + Intronic
1191773398 X:64786060-64786082 CTAGAGTTCTGGGAACAAGTGGG - Intergenic
1192354160 X:70384429-70384451 CTAGAGTTCAAGGGAGAAGTTGG + Intronic
1192369239 X:70499692-70499714 CTGGAGATTGGAAGAGAAGTAGG + Intronic
1193699349 X:84743232-84743254 CTGGAGTTCTAGAGTGAGTTTGG - Intergenic
1198656723 X:138922611-138922633 GTGGTGTTCTTGATAGAAGTGGG - Intronic
1199030469 X:142992979-142993001 CTGAAGTTCTCCTGAGAAGTGGG + Intergenic
1199392977 X:147303075-147303097 CTAGAGTTCAGGAAAGAAGCAGG - Intergenic
1199500765 X:148503320-148503342 CTGGACTTCCAAAGAGAAGTGGG - Intronic