ID: 1089515329

View in Genome Browser
Species Human (GRCh38)
Location 11:119028412-119028434
Sequence TGCTGGTGATGAACCCTGCA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 376
Summary {0: 1, 1: 0, 2: 0, 3: 41, 4: 334}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089515322_1089515329 19 Left 1089515322 11:119028370-119028392 CCCCACTGACAAACTTGCTGATA 0: 1
1: 0
2: 1
3: 17
4: 176
Right 1089515329 11:119028412-119028434 TGCTGGTGATGAACCCTGCAGGG 0: 1
1: 0
2: 0
3: 41
4: 334
1089515323_1089515329 18 Left 1089515323 11:119028371-119028393 CCCACTGACAAACTTGCTGATAG 0: 1
1: 0
2: 0
3: 7
4: 104
Right 1089515329 11:119028412-119028434 TGCTGGTGATGAACCCTGCAGGG 0: 1
1: 0
2: 0
3: 41
4: 334
1089515324_1089515329 17 Left 1089515324 11:119028372-119028394 CCACTGACAAACTTGCTGATAGC 0: 1
1: 0
2: 0
3: 7
4: 90
Right 1089515329 11:119028412-119028434 TGCTGGTGATGAACCCTGCAGGG 0: 1
1: 0
2: 0
3: 41
4: 334

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089515329 Original CRISPR TGCTGGTGATGAACCCTGCA GGG Exonic
900578835 1:3397665-3397687 TGCTGGTGCTGGAGCCTGGAGGG + Intronic
900639224 1:3680916-3680938 TGCTGGTGATGAATGCTCCAGGG - Intronic
904129205 1:28263086-28263108 TGCTGGGGATGAGACTTGCAGGG - Intronic
906827088 1:48993193-48993215 AGCAGGTGATGAATCCTGCCAGG + Intronic
907261623 1:53222506-53222528 AGCAGGTGATGAATCCTGCCAGG - Intergenic
907628775 1:56058870-56058892 GGATGGTGATGAACGCTACAAGG - Intergenic
908143769 1:61216029-61216051 TGATGGCTATGAACCTTGCATGG + Intronic
908397607 1:63740647-63740669 AGCAGGTGATGAATCCTGCCAGG + Intergenic
908767581 1:67568488-67568510 TCCTGGGGCTGCACCCTGCAAGG - Intergenic
910620534 1:89248612-89248634 AGCAGGTGATGAATCCTGCAAGG - Intergenic
910639790 1:89447052-89447074 AGCAGGTGATGAATCCTGCCAGG + Intergenic
910716422 1:90236152-90236174 AGCAGGTGATGAATCCTGCCAGG + Intergenic
912277994 1:108281055-108281077 AGCTGGTGATGACCCCTGGCAGG + Intergenic
912290232 1:108413302-108413324 AGCTGGTGATGACCCCTGGCAGG - Intronic
912316395 1:108670845-108670867 AGCAGGTGATGAATCCTGCCAGG - Intergenic
912899298 1:113630663-113630685 GGCAGGTGATGAAACCTGCCAGG + Intronic
913091381 1:115478965-115478987 TGCTGGTTAGGCTCCCTGCAGGG + Intergenic
913388819 1:118288269-118288291 TGCTTGTGATGAACTCCACAAGG + Intergenic
915005326 1:152630069-152630091 AGCAGGTGATGAATCCTGCCAGG - Intergenic
916882194 1:169029991-169030013 TGCTGGTGATAAATCCATCATGG - Intergenic
917300592 1:173570258-173570280 AGCAGGTGATGAATCCTGCCAGG + Intronic
917306221 1:173628064-173628086 AGCAGGTGATGAATCCTGCCAGG - Intronic
917373112 1:174317353-174317375 AGCAGGTGATGAACGCTGCTGGG + Intronic
917608051 1:176656192-176656214 TGCTGGAGATGAACTCTAAATGG + Intronic
919455869 1:197818857-197818879 AGCAGGTGATGAATCCTGCTAGG - Intergenic
919514939 1:198511124-198511146 AGCAGGTGATGAATCCTGCCAGG + Intergenic
919799889 1:201347591-201347613 TGCAACTGATGAGCCCTGCAGGG + Intergenic
921823098 1:219640376-219640398 AGCAGGTGATGAATCCTGCCAGG - Intergenic
922361637 1:224828144-224828166 AGCTTGGGCTGAACCCTGCAGGG + Intergenic
922388574 1:225114194-225114216 AGCAGGTGATGAATCCTGCTAGG + Intronic
922811922 1:228421012-228421034 AGCAGGTGATGAACCCTCCATGG - Intergenic
924193754 1:241583338-241583360 AGCAGGTGGTGAACCCTGCCAGG + Intronic
924490833 1:244535968-244535990 AGCTGGTGATGAATCCTGCCAGG + Intronic
1063054168 10:2484954-2484976 TGCTTGTGAGAAACGCTGCAGGG - Intergenic
1064020427 10:11804781-11804803 CGCAGGTGATGAAACCTGCACGG - Intergenic
1065921812 10:30399568-30399590 AGCAGGTGATGAATCCTGCCAGG - Intergenic
1066475751 10:35746126-35746148 TGCTGTTAATGAACTCTGCAGGG - Intergenic
1066694785 10:38068142-38068164 TGCTGGTCATTGTCCCTGCATGG - Intergenic
1067032633 10:42888617-42888639 AGCAGGTGATGAATCCTGCCAGG + Intergenic
1067084732 10:43231761-43231783 TGCTGGGGCTGAGCCCTGCCAGG + Intronic
1067324467 10:45253784-45253806 AGCAGGTGATGAACCCTGACAGG - Intergenic
1069806047 10:71125690-71125712 TGTTGGGGCTGAACTCTGCAGGG - Intergenic
1070059416 10:72967776-72967798 AGCAGGTGATGAATCCTGCCAGG + Intergenic
1071465504 10:85936015-85936037 TGCAGATGATGGACCCTGAAAGG - Intronic
1072923822 10:99598775-99598797 TCCTGGAGATGAGACCTGCAAGG + Intergenic
1075514613 10:123099074-123099096 CCCTGGTGGTGAACCTTGCAGGG + Intergenic
1079352300 11:19702005-19702027 TGCCAGAAATGAACCCTGCAGGG - Intronic
1081879376 11:46434939-46434961 TGCTGGGGATGAAAGCTGCCAGG + Exonic
1084570948 11:69959549-69959571 AGCTGGGGATGAAGCCTGCCAGG - Intergenic
1084763878 11:71294888-71294910 AGTTGGTGATGAATCCTGCCAGG + Intergenic
1084972321 11:72778631-72778653 AGCTGGGGAGGCACCCTGCAGGG + Intronic
1085044115 11:73343421-73343443 TGCCGGTGAGGAACCCTGGCAGG + Intronic
1086339971 11:85838718-85838740 TGCTGGAGATGAGCCCTGGTGGG - Intergenic
1087032046 11:93715691-93715713 AGCAGGTGATGAATCCTGCCAGG + Intronic
1087691062 11:101320999-101321021 AGCAGGTGATGAATCCTGCCAGG + Intergenic
1088274783 11:108073848-108073870 TGCTGGTGATGAGCTGTGGAGGG - Intronic
1089177187 11:116557448-116557470 TGCTGGAGCTGGAGCCTGCAGGG - Intergenic
1089515329 11:119028412-119028434 TGCTGGTGATGAACCCTGCAGGG + Exonic
1090111191 11:123911089-123911111 AGCAGGTGATGAATCCTGCCAGG - Intergenic
1090248298 11:125233439-125233461 TGCTGGTGGTGGACTCTGCTTGG + Intronic
1091021105 11:132100721-132100743 CGCTGGTAGTGAACCCTGGAAGG - Intronic
1092497614 12:9012414-9012436 AGCAGGTGATGAATCCTGCCTGG - Intergenic
1094658216 12:32441353-32441375 TGCTGGTGATGAATGCTGCCAGG + Intronic
1094741657 12:33296460-33296482 AGCAGGTGATGAATCCTGCCAGG - Intergenic
1095239084 12:39835712-39835734 TATTGGTGATCCACCCTGCAGGG - Intronic
1097552341 12:61090526-61090548 AGCAGGTGATGAATCCTGCCAGG + Intergenic
1098959113 12:76719725-76719747 AGCAGGTGATGAACCCCGCCAGG - Intergenic
1099024483 12:77448180-77448202 AGCAGGTGATGAATCCTGCTAGG - Intergenic
1099869227 12:88325507-88325529 TGCTGGCCGTGAAGCCTGCAAGG - Intergenic
1100819987 12:98421628-98421650 TGCTGGTTAGCCACCCTGCAAGG - Intergenic
1100946379 12:99788407-99788429 AGCAGGTGATGAATCCTGCCAGG - Intronic
1101026237 12:100609368-100609390 AGCAGGTGATGAATCCTGCCAGG + Intronic
1101434294 12:104651892-104651914 TGCAGTTGGAGAACCCTGCAAGG - Intronic
1101559729 12:105845078-105845100 TGCTGGGGATGCAGCCAGCAGGG - Intergenic
1101607454 12:106258463-106258485 GGCAGGTGATGAATCCTGCCAGG - Intronic
1101997975 12:109538684-109538706 TGCTGCTGATGATCCCAGCAGGG + Intergenic
1102386885 12:112517380-112517402 TGCAGGTGCTGCAGCCTGCAGGG + Intergenic
1104816142 12:131646590-131646612 TGCTGGGGAGGAACCCTTGAGGG - Intergenic
1104880160 12:132065175-132065197 TGCTGCTGAGGGACCCTGCAGGG + Intronic
1104888968 12:132130641-132130663 TGGCGGTGATGATCCCTGGAGGG + Intronic
1105273517 13:18900297-18900319 TGCTGGTGATGAAGCTGGCCAGG - Intergenic
1106229754 13:27812818-27812840 TGCTGTAGATGAACCCTAGAGGG + Intergenic
1106449791 13:29870051-29870073 TGCTTGTGATGAGTCCTGAAGGG + Intergenic
1106546629 13:30736647-30736669 TGCTGGTGATGTAGCCTTCTGGG + Intronic
1106858985 13:33884532-33884554 TGCTGGAGATGAACTGTGTAAGG + Intronic
1106895964 13:34302622-34302644 TGCCAGTGATGAATCCTGCCAGG - Intergenic
1109402902 13:61858098-61858120 AGCTGGTGATGAATCCTGCCAGG + Intergenic
1110418687 13:75280057-75280079 TGCTTGTGATGTTCCCTGAAAGG + Intergenic
1110525205 13:76528064-76528086 TTCTGGAGGTGAACACTGCAGGG - Intergenic
1112053823 13:95671450-95671472 AGCAGGTGATGAATCCTGCCAGG + Intergenic
1112684610 13:101810223-101810245 TACTGGTGGTGAAAACTGCAGGG - Intronic
1113253908 13:108486273-108486295 AGCAGGTGATGAATCCTGCCAGG - Intergenic
1113762933 13:112862790-112862812 AGGTGGTGATGGACCCTGCTGGG - Intronic
1113762980 13:112863060-112863082 AGGTGGTGATGGACCCTGCTGGG - Intronic
1114248038 14:20933265-20933287 AGCAGGTGATGAATCCTGGAAGG - Intergenic
1115706618 14:36005840-36005862 TACTGGTGTTGAATCATGCAGGG + Intergenic
1116157624 14:41228110-41228132 TGCTGATGCTGAAGGCTGCAAGG - Intergenic
1116669064 14:47817737-47817759 TGCTGTTGATGAAGCATGGAGGG - Intergenic
1118539072 14:66802663-66802685 TGCAGTTGATGAATCCTGCCAGG + Intronic
1120100094 14:80435042-80435064 AGCAGGTGATGAACTCTGCCAGG - Intergenic
1121343031 14:93116164-93116186 TGGGGGTGCTGAACCCTGCTGGG - Intronic
1122501014 14:102199561-102199583 TTCTGGTGAGGAACACTGAAAGG - Intronic
1124653276 15:31488135-31488157 AGGTGGTGATGAGCCCTGGAAGG + Intronic
1125044523 15:35230716-35230738 AGCAGGTGATGAATCCTGCCAGG + Intronic
1125564140 15:40662348-40662370 TGATGGTGATGAAGTCTGGATGG + Exonic
1126053352 15:44707438-44707460 AGCTGGTGAGGAATCCTGCCAGG + Intronic
1126373382 15:47970432-47970454 TCCTGGTGATGAGCCGTGAAAGG + Intergenic
1126716653 15:51525182-51525204 AGCAGGTGATGAATCCTGCCAGG - Intronic
1127034090 15:54895775-54895797 AGCAGGTGATGAATCCTGCCAGG + Intergenic
1127971556 15:63966137-63966159 AGCAGGTGATGAATCCTGCCAGG + Intronic
1128901079 15:71423402-71423424 AGCAGGTGATGAATCCTGCCAGG + Intronic
1129030648 15:72615416-72615438 AGCAGGTGATGAATCCTGCCAGG + Intergenic
1129477490 15:75795931-75795953 AGCAGGTGATGAATCCTGCCAGG + Intergenic
1129835556 15:78703207-78703229 AGCAGGTGATGAATCCTGCCAGG + Intronic
1130159505 15:81384715-81384737 TGCTGGCGTTGAAGGCTGCAGGG + Intergenic
1130983491 15:88829016-88829038 TGCTGGAGATAAACCCTTCAAGG - Intronic
1131323543 15:91420976-91420998 AGCAGGTGATGAATCCTGCCAGG + Intergenic
1132899051 16:2243545-2243567 TGTGGGTGTTGAACCCTGCGGGG - Intronic
1133414878 16:5598737-5598759 TGCAGGTCTTGACCCCTGCAGGG + Intergenic
1134677785 16:16102681-16102703 TGCTGGTGACGGACAGTGCAGGG + Exonic
1135030662 16:19035844-19035866 TGCTGGTGAGGACCCCACCACGG - Intronic
1136034590 16:27529572-27529594 TGCTGTTGGTCACCCCTGCAGGG - Intronic
1137587949 16:49675428-49675450 TGCTGGTTATCACCCCAGCAGGG - Intronic
1141485112 16:84333769-84333791 AGCAGGTGATGAATCCTGCCAGG - Intergenic
1142582349 17:949862-949884 TGCTGGGGCTGAACAATGCATGG - Intronic
1143534317 17:7526985-7527007 TGCAGGTTAGGAACCCTGTATGG + Intergenic
1143642928 17:8209936-8209958 AGCTGGTGAGGACCTCTGCAGGG - Intronic
1143874736 17:9983065-9983087 TGATGGTGATGACCTCTGAATGG - Intronic
1144225026 17:13136869-13136891 AGCTGGTGATGAACCAGGCTGGG + Intergenic
1144456952 17:15426635-15426657 TGATGATGATGACGCCTGCATGG + Intergenic
1145069171 17:19788504-19788526 AGCAGGTGATGAATCCTGCCAGG - Intronic
1145244866 17:21262117-21262139 TGTGGGGGATGAACCCTGGAGGG + Intergenic
1146649928 17:34600486-34600508 TGCTCTTAATGAACCCAGCAGGG + Intronic
1147963734 17:44181840-44181862 GGCTGGAGATGAACCTTGGAAGG - Intergenic
1148845928 17:50529799-50529821 TGATGGGAATGCACCCTGCATGG - Intronic
1149441751 17:56680018-56680040 TGCTGCTTATGAACCCAGGAAGG - Intergenic
1150755735 17:67910899-67910921 TGACAGTGATAAACCCTGCAAGG + Exonic
1151890279 17:76947419-76947441 CCCTGGAGTTGAACCCTGCAGGG + Intronic
1152241046 17:79161339-79161361 TGCTGCCAATGAACCCTTCATGG + Intronic
1152572153 17:81125602-81125624 TGCTGGCTTTGAACCCTGCCTGG + Intronic
1152885048 17:82844852-82844874 TGCAGGTGATGCACCTGGCACGG - Intronic
1153119186 18:1700623-1700645 TGATGCTGATGAACCCTGGATGG - Intergenic
1154202885 18:12311193-12311215 TCCTTGTGATGAACCCAGCTAGG - Intronic
1154465274 18:14637862-14637884 TGCTGGTGATGAAGCTGGCCTGG - Intergenic
1155782097 18:29849700-29849722 AGCTGGTGATGAATGCTGCCAGG + Intergenic
1155854999 18:30822070-30822092 TGATGTTGAGGAACCTTGCAAGG - Intergenic
1156155791 18:34300595-34300617 AGCAGGTGATGAATCCTGCCAGG - Intergenic
1158431253 18:57389525-57389547 AGCTGGTGATTAATCCTGCCAGG - Intergenic
1159130795 18:64278260-64278282 AGCAGGTGATGAATCCTGCCAGG + Intergenic
1160138427 18:76296004-76296026 CGCAGGTGATGAATCCTGCCAGG + Intergenic
1160973177 19:1779058-1779080 TGGAGGTGTTGATCCCTGCATGG - Exonic
1162495207 19:11019583-11019605 TGCTGCTGGGGATCCCTGCAAGG - Exonic
1162513293 19:11132745-11132767 GGCTGCTGATGCACCATGCATGG - Intronic
1165186888 19:34030477-34030499 TGCTGTTGATGAGCGCTGGAAGG - Intergenic
1167313248 19:48749693-48749715 TGCCTGTGAAGAACCCTGCAGGG - Exonic
925496743 2:4459242-4459264 TGGTGCTAATGAACCCTACAGGG - Intergenic
925506359 2:4569300-4569322 AGCAGGTGATGAATCCTGCCAGG + Intergenic
926308713 2:11659172-11659194 TGCTGGTGATGAAACATTTATGG - Intronic
926755016 2:16227425-16227447 TGCTAATGCTGATCCCTGCAGGG + Intergenic
927570299 2:24153400-24153422 AGCAGGTGATGAATCCTGCCAGG + Intronic
927680937 2:25138536-25138558 TGTTGGTGCTAAATCCTGCAGGG + Intronic
928293539 2:30061206-30061228 AGCAGGTGATGAATCCTGCAAGG - Intergenic
929099971 2:38302124-38302146 AGCACGTGATGAACCCTGCCAGG - Intronic
930473154 2:51846149-51846171 TGCTGGTTATTAACCTTGCAAGG - Intergenic
930547913 2:52793216-52793238 TGCTGCTGATTAACCCTGTAGGG - Intergenic
931572240 2:63680980-63681002 AGCAGGTGATGAATCCTGCCAGG - Intronic
932196827 2:69791213-69791235 TGCAGGTCAGGAACCCTGTATGG + Intronic
932648820 2:73532934-73532956 AGCAGGTGATGAATCCTGCCAGG + Intronic
935356617 2:102207448-102207470 AGCAGGTGATGAATGCTGCAAGG + Intronic
935685369 2:105678192-105678214 TGCTGGCGTTGAACCATCCAAGG + Intergenic
936489574 2:112958573-112958595 GGCTGGTGATGACCTCAGCAAGG - Intergenic
936940418 2:117878689-117878711 AGCAGGTGATGAATCCTGCCAGG + Intergenic
937313615 2:120917134-120917156 TTCTGGTGATGAACCCCAGAAGG - Intronic
938182226 2:129193381-129193403 TGATGGTGAGAAACCCTACATGG - Intergenic
938244784 2:129768106-129768128 TGCTGGTGTTGACCCCTGGCCGG + Intergenic
938752379 2:134345045-134345067 TACTGGTAATGAACCCAGGATGG - Exonic
942035688 2:172008525-172008547 AGATGGTACTGAACCCTGCACGG + Intronic
942294897 2:174507742-174507764 AGCAGGTGATGAATCCTGCCAGG - Intergenic
943237262 2:185338248-185338270 AGCAGGTGATGAATCCTGCCAGG + Intergenic
944046144 2:195414003-195414025 AGCAGGTGATGAATCCTGCCAGG - Intergenic
944095958 2:195968318-195968340 AGCAGGTGATGAATCCTGCCAGG + Intronic
944318466 2:198308556-198308578 TGCTGGTGATGATCTGTCCAAGG + Intronic
945898730 2:215514557-215514579 TGTGGGTAATGAACCCTGGATGG - Intergenic
946312592 2:218891197-218891219 GCCTGGGGATGAACCCTGCCTGG - Intronic
947130941 2:226924220-226924242 AGCAGGTGATGAATCCTGCTAGG + Intronic
948774646 2:240277655-240277677 AGCAGGTGATGAATCCTGCCAGG - Intergenic
1171154730 20:22861564-22861586 AGGTGGCTATGAACCCTGCAAGG - Intergenic
1173142899 20:40499718-40499740 TACTGGTGATCAATACTGCAGGG - Intergenic
1175754392 20:61520295-61520317 TGCTGGTGCTGGACCCTGAGAGG + Intronic
1176072172 20:63232954-63232976 TGCTGGTTCTGAATCTTGCAGGG + Intergenic
1176381888 21:6117828-6117850 TGCTGGTGGTGGACCCCGCCAGG + Exonic
1176809266 21:13520524-13520546 TGCTGGTGATGAAGCTGGCCTGG + Intergenic
1179324872 21:40332532-40332554 TGCTGGGGATCAACACTGCCAGG - Intronic
1179605359 21:42512699-42512721 TCCTGGGGCTGAACCCTGCGTGG + Intronic
1179741584 21:43420411-43420433 TGCTGGTGGTGGACCCCGCCAGG - Exonic
1179898492 21:44376800-44376822 AGCTGGTGAGGAACCCTCCAGGG - Intronic
1179937443 21:44614304-44614326 TGCTGGTGATGCAAAGTGCACGG - Intronic
1180214965 21:46318051-46318073 TGCTGCTGATGAGTCCAGCATGG + Exonic
1181406035 22:22685750-22685772 GGCTGGTGATGCCCCATGCAGGG - Intergenic
1181627526 22:24131773-24131795 TGCAGGTGATGGACCAGGCACGG + Intronic
1182280455 22:29215201-29215223 TGCTGTTGAAGCACCCTGGAGGG + Intronic
1182846432 22:33434867-33434889 TGCTGGAGATGGACCTTGAAAGG - Intronic
1183166049 22:36148271-36148293 TGCTTGTGATGGGCCGTGCAGGG + Intronic
1185232976 22:49693923-49693945 TGCTTATGATGACACCTGCATGG - Intergenic
950172055 3:10845507-10845529 TGCTGGAGATAAAACCTCCAAGG + Intronic
950801109 3:15552451-15552473 AGCAGGTGATGAATCCTGCCAGG + Intergenic
950959600 3:17091924-17091946 TGTTGGTGCTGAACCCAGCCCGG + Intergenic
951392889 3:22129370-22129392 AGCGGGTGATGAATCCTGCCAGG + Intronic
952725725 3:36582405-36582427 AGCAGGTGGTGAATCCTGCAAGG - Intergenic
954522679 3:51243114-51243136 TGTTGGTCCTGAACTCTGCAGGG - Intronic
956343470 3:68251705-68251727 TGCTTGTGAAGAACACAGCATGG + Intronic
956689187 3:71860486-71860508 TGCTTGTGAGGAACCCAGCTGGG - Intergenic
957965819 3:87321561-87321583 AGCAGGTGATGAATCTTGCAAGG - Intergenic
958083385 3:88775074-88775096 TGTTGGTGATGAATTCTGCCAGG - Intergenic
958876658 3:99624608-99624630 GGCAGGTGATGAATCCTGCCAGG - Intergenic
959586881 3:108033241-108033263 TGCAGGTGATTAACTATGCAAGG + Intergenic
959650346 3:108745002-108745024 TGGTGATGATGTGCCCTGCATGG + Intronic
960067296 3:113387479-113387501 AGCAGGTGATGAATCCTGCCAGG - Intronic
960207338 3:114918573-114918595 AGCAGGTGATGAATCCTGCCAGG + Intronic
961076355 3:123986604-123986626 TGCTGGTTCTGTACCCTCCAAGG + Intronic
961651086 3:128417005-128417027 TGCTGGTCAGGAACCCTGCTGGG - Intergenic
962699047 3:137979151-137979173 AGCAGGTGATGAATCCTGCCAGG + Intergenic
963020497 3:140868871-140868893 TGTAGGTGATGAATCCTGCCAGG + Intergenic
963363379 3:144304456-144304478 TGCAGTTGAGGAACCATGCAGGG - Intergenic
964999961 3:162940724-162940746 AGCAGGTGATGAATCCTGCCAGG - Intergenic
965099543 3:164278403-164278425 AGCAGGTGATGAATCCTGCCAGG - Intergenic
965322295 3:167265287-167265309 AGCAGGTGATGAATCCTGCCAGG + Intronic
965554545 3:170005674-170005696 TGATGGTGAGGAACGATGCAGGG - Intergenic
965844490 3:172946145-172946167 AGCAAGTGATGAACCCTGCTAGG - Intronic
966948101 3:184791716-184791738 TGCTGGTGATGATCCCAGGCAGG + Intergenic
967998776 3:195186840-195186862 TGCTGGTGATAACCTCTCCACGG + Intronic
968673797 4:1866173-1866195 TGCTTTTGATGGACCCTGCCTGG + Intergenic
970140359 4:12975434-12975456 TACTGGGTATGAACCCTGGATGG + Intergenic
970963329 4:21898576-21898598 AGCAGGTGATGAATCCTGCCAGG - Intronic
972083300 4:35181908-35181930 TGTTGGACATGAACTCTGCAGGG + Intergenic
975019934 4:69474093-69474115 TGCAGGTGCGAAACCCTGCAGGG + Intergenic
975095673 4:70453851-70453873 AGCAGGTGATGAATCCTGCTAGG + Intronic
976030057 4:80741393-80741415 AGCGGGTGATGAATGCTGCAAGG + Intronic
976041065 4:80885657-80885679 AGCAGGTGATGAATCCTTCAAGG - Intronic
976082851 4:81375491-81375513 AGCAGGTGATGAACACTGCCAGG + Intergenic
976762797 4:88568671-88568693 AGCAGGTGATGAATCCTGCTTGG + Intronic
977026815 4:91830562-91830584 AGCAGGTGATGAATCCTGCCAGG + Intergenic
977971700 4:103220163-103220185 TTCTGGTGTAGAATCCTGCAGGG - Intergenic
978291649 4:107149068-107149090 TGGTGGTGTTGATCCCTGTATGG - Intronic
979156024 4:117392027-117392049 AGCAGGTGATGAATCCTGCCTGG - Intergenic
979184618 4:117772654-117772676 AGCAGGTGATGAATCCTGCCAGG - Intergenic
979565093 4:122145871-122145893 AGCAGGTGATGAATCCTGCCAGG + Intergenic
981518380 4:145634763-145634785 AGCAGGTGATGAATCCTGCCAGG + Intronic
981975540 4:150723498-150723520 TGCAGGTGATGAATCCTACCAGG - Intronic
982899546 4:160981003-160981025 GGCAGGTGATGAATCCTGCCAGG + Intergenic
986631189 5:9775646-9775668 AGCAGGTGATGAATCCTGCCAGG + Intergenic
986657610 5:10030793-10030815 AGCAGGTGATGAATACTGCAAGG + Intergenic
988272291 5:29032602-29032624 TGCAGGTGCTGTACCCTCCACGG - Intergenic
988324873 5:29751125-29751147 TGGTAGTGATGAACACAGCAAGG - Intergenic
988608539 5:32703562-32703584 TGCAGGTGATAAATCCTGCCAGG + Intronic
989672583 5:43936101-43936123 AGCAGGTGATAAACCCTGCCAGG - Intergenic
989746887 5:44839699-44839721 TGCAGGGGCTGCACCCTGCAGGG + Intergenic
990818802 5:59814576-59814598 TATTGGTCATGAACCTTGCAGGG + Intronic
991395316 5:66198723-66198745 AGCAGGTGATGAATCCTGCCAGG + Intergenic
993279350 5:85905347-85905369 AGCAGGTGATGAAACCTGCCAGG - Intergenic
993981236 5:94545649-94545671 AGCAGGTGATGAATCCTGCCAGG - Intronic
994217883 5:97159337-97159359 AGCAGGTGATGAATCCTGCCTGG + Intronic
994343946 5:98663394-98663416 AGCTTGTGGTGAACACTGCAAGG - Intergenic
994659985 5:102641795-102641817 AGCAGGTGATGAATCCTGCCAGG - Intergenic
995146933 5:108797079-108797101 AGCAGGTGATGAAGCCTGCCGGG + Intronic
995268658 5:110195149-110195171 TGCAGGTGATGAATCCTGCCAGG + Intergenic
996579795 5:125018526-125018548 AACAGGTGATGAACCCTGCCTGG + Intergenic
997003016 5:129784675-129784697 AGCAGGTGATGAATCCTGCCAGG - Intergenic
997186209 5:131884473-131884495 AGCAGGTGATGAAACCTGCCAGG - Intronic
997861025 5:137416258-137416280 TGCTGGTGATGAATTCTGTAAGG - Intronic
999280616 5:150362928-150362950 TGCTGGGTTTGAACTCTGCAGGG - Intronic
1002110331 5:176905160-176905182 TGCTGGTGGTGAAAACTGCAGGG + Exonic
1003792830 6:9566394-9566416 GGCTGGTGTTTAATCCTGCAAGG + Intergenic
1004252282 6:14032579-14032601 TGCAGGTGATGCCCACTGCATGG + Intergenic
1004252288 6:14032618-14032640 TGCAGGTGATGCCCCCTGCATGG + Intergenic
1004252297 6:14032657-14032679 TGCAGGTGATGCCCCCTGCATGG + Intergenic
1004252307 6:14032696-14032718 TGCAGGTGATGCCCCCTGCATGG + Intergenic
1004252316 6:14032735-14032757 TGCAGGTGATGCCCCCTGCATGG + Intergenic
1004252332 6:14032811-14032833 TGCAGGTGATGCCCCCTGCATGG + Intergenic
1004252341 6:14032850-14032872 TGCAGGTGATGCCCCCTGCATGG + Intergenic
1004252357 6:14032926-14032948 TGCAGGTGATGCCCCCTGCATGG + Intergenic
1004252366 6:14032965-14032987 TGCAGGTGATGTCCCCTGCATGG + Intergenic
1004252374 6:14033004-14033026 TGCAGGTGATGCCCCCTGCATGG + Intergenic
1005157088 6:22819438-22819460 AGCAGGTGATGAATCCTGCCAGG + Intergenic
1010644737 6:78373364-78373386 AGCAGGTGATGAATCCTGCCAGG - Intergenic
1011340974 6:86313804-86313826 TGCAGGTGATGAATCTTGCCAGG - Intergenic
1013567605 6:111383033-111383055 AGCAAGTGATGAACCCTGCCAGG - Intronic
1014794692 6:125710904-125710926 AGCAGGTGATGAATCCTGCCAGG - Intergenic
1015154783 6:130080548-130080570 TCCTGGTTATGTACCCTGGAAGG + Intronic
1016541521 6:145170899-145170921 AGCAGGTGATGAATCCTGCCAGG - Intergenic
1017318720 6:153062929-153062951 AGCAGGTGATGAATCCTGCCAGG - Intronic
1018849523 6:167577028-167577050 AGATGGTGAGGAACCCTGCCTGG + Intergenic
1021046117 7:15925025-15925047 AGCAGGTGATGAATCCTGCCAGG - Intergenic
1021092320 7:16498278-16498300 TGCTGGTCAAGAACTCTGAAAGG + Intronic
1021203601 7:17753411-17753433 AGCAGGTGATGAATCCTGCCAGG + Intergenic
1025718174 7:63983188-63983210 AGCAGGTGATGAATCCTGCCAGG - Intergenic
1026934105 7:74242238-74242260 TGTTGTTGATGTCCCCTGCACGG - Intronic
1027905501 7:84175507-84175529 TCCTGGTGGTGAACCCTACAAGG - Intronic
1028033512 7:85949671-85949693 TGCAGGTGGTGAATCCTGCTAGG + Intergenic
1028929567 7:96397832-96397854 AGCAGGTGATGAATCCTGCCAGG + Intergenic
1030391303 7:108931629-108931651 AGCAGGTAATGAACCCTGCCAGG + Intergenic
1030723597 7:112898592-112898614 AGCAGGTAATGAATCCTGCAGGG - Intronic
1032138814 7:129307817-129307839 AGCAGGTGATGAATCCTGCCAGG + Intronic
1034842499 7:154412331-154412353 TGCTGGAGATTAGCCCTGCTGGG - Intronic
1035062731 7:156081161-156081183 TGTTGGTGATGAACCCTGTTTGG + Intergenic
1035084546 7:156247119-156247141 AGCAGGTGATGAATCCTGCCAGG + Intergenic
1035564979 8:635392-635414 TAGTGGTGATGAGCCCTGCGGGG - Intronic
1036037004 8:5030581-5030603 TGTTGGTGATTATACCTGCATGG - Intergenic
1037034101 8:14144413-14144435 AGCAGGTTATGAACTCTGCAAGG - Intronic
1039260470 8:35765755-35765777 GACTGGTGATGAAGCCAGCATGG - Intronic
1042980235 8:74518622-74518644 TGCAGGTGATGAATCCTGCCAGG - Intergenic
1043760607 8:84063303-84063325 AGCAGGTGATGAATCCTGCCAGG + Intergenic
1045041337 8:98227462-98227484 AGCAGGTGATGAATCCTGCCAGG + Intronic
1045062464 8:98421875-98421897 GGCTGGTGAAGAGCCCTCCAAGG + Intronic
1045172561 8:99687070-99687092 AGCAGGTGATGAATCCTGCAAGG + Intronic
1045602445 8:103733138-103733160 TGCAGGTGATGATTCCTGCCAGG + Intronic
1045994893 8:108351505-108351527 GGCAGGTGATGAATCCTGCCAGG - Intronic
1046384121 8:113486720-113486742 AGCAGGTGATGAATCCTGCCAGG + Intergenic
1046482701 8:114843545-114843567 TCCTGGGGATGAAGCCTCCAAGG - Intergenic
1047213848 8:122861470-122861492 TACTGGTCATGCACCCTGCATGG + Intronic
1048784990 8:138041010-138041032 TGCTGGTGCTGAGTCCTGCTGGG - Intergenic
1049400944 8:142426953-142426975 TGCTGGTGAGGTACCATGCTTGG + Intergenic
1051718771 9:20013163-20013185 TGATTGTAATGAAGCCTGCATGG + Intergenic
1051920514 9:22258832-22258854 TGTTGGTCCTGAACTCTGCAGGG + Intergenic
1052204941 9:25827901-25827923 AGCAGGTGATGAATCCTGCCAGG + Intergenic
1053204408 9:36173995-36174017 AGCAGGTGATGAATCCTGCCTGG - Intergenic
1058342703 9:103918413-103918435 TGGTGCTGATGAAACCTGAAGGG - Intergenic
1058522837 9:105828849-105828871 AGCAGGTGATGAATCCTGCCAGG + Intergenic
1058748598 9:108016675-108016697 TGCTGTTGATGAGCCCAGCTTGG + Intergenic
1059461535 9:114433827-114433849 TGCTGTGGATGGACCCGGCAAGG + Intronic
1060010666 9:120040549-120040571 TGCTGGATATCAACCTTGCACGG - Intergenic
1061908782 9:133712082-133712104 TACTGGTGAGGCACCCAGCATGG - Intronic
1062405886 9:136396109-136396131 TGCTGGTGATGCACACGACAGGG - Intronic
1062651942 9:137582358-137582380 TGCTGGAGATGAACACTGAGGGG + Exonic
1185485126 X:476306-476328 TGCTGGTGATTAAACCAGCCCGG - Intergenic
1185701962 X:2237448-2237470 TGCTGGACATGAGCCCTGAATGG + Intronic
1189770085 X:44416889-44416911 AGCAGGTGATGAATCCTGCCAGG + Intergenic
1189837301 X:45038981-45039003 TGGTGGGTATGAACTCTGCATGG - Intronic
1189890070 X:45591817-45591839 AGCAGGTGATGAAGCCTGCCAGG + Intergenic
1191197130 X:57736617-57736639 AGCAGGTGATGAATCCTGCCAGG - Intergenic
1191834142 X:65446057-65446079 TGCAGGTGATGAATCCTGCCAGG + Intronic
1192684439 X:73288900-73288922 TGTTGGTCATGAACTCTGCAGGG + Intergenic
1192839205 X:74836495-74836517 AGCAGGTGATGAATCCTGCCAGG + Intronic
1193016374 X:76738504-76738526 TGCAGGTGATGAATGCTGCCAGG - Intergenic
1193664561 X:84300017-84300039 AGCTGGTGATGAAACCTGCCAGG - Intergenic
1193739636 X:85202736-85202758 TTCTGGTGATGAGCCATGGAGGG + Intergenic
1193758408 X:85436699-85436721 TGCAGAGGCTGAACCCTGCAAGG + Intergenic
1193989231 X:88285328-88285350 AGCTGGTTTTGAATCCTGCAAGG - Intergenic
1194095735 X:89636584-89636606 AGCTGCTGATGAATCCTGCCAGG - Intergenic
1194201324 X:90956717-90956739 TGCTAGGGATGGAGCCTGCAGGG - Intergenic
1194344936 X:92751449-92751471 TGTTGGTCCTGAACTCTGCATGG - Intergenic
1194396718 X:93395441-93395463 AGCAGGTGATGAATCCTGCCAGG + Intergenic
1194451852 X:94053158-94053180 TGCTGAAAATAAACCCTGCATGG + Intergenic
1194493270 X:94577811-94577833 AGCAGGTGATGAAACCTGCTGGG - Intergenic
1194692946 X:97009640-97009662 AGCAGGTGATGAATCCTGCCAGG + Intronic
1194937653 X:99970540-99970562 TGCAGGTGATGAATCCTTCCAGG + Intergenic
1195014687 X:100766544-100766566 AGCAGGTGATGAAGCCTGCCAGG + Intergenic
1195122973 X:101775277-101775299 AGCAGGTGATGAATGCTGCAAGG + Intergenic
1195783068 X:108485516-108485538 TGCAGGTGATGGATCCTGCCAGG + Intronic
1195823305 X:108970345-108970367 AGCAGGTGATGAATCCTGCCAGG - Intergenic
1195824966 X:108989975-108989997 AGCAGGTGATGAACCCTGCCAGG + Intergenic
1195849166 X:109264512-109264534 AGCTGGTGCTGAATCCTGCCAGG + Intergenic
1196576684 X:117326224-117326246 AGCAGGTGATGAATCCTGCAAGG + Intergenic
1197404308 X:126030289-126030311 TGTTGGTCCTGAACTCTGCAGGG - Intergenic
1197429418 X:126342325-126342347 AGCAGGTGATGAATCCTGCAAGG - Intergenic
1197487613 X:127073888-127073910 TGCAGATGATGAATCCTGCCAGG + Intergenic
1197491977 X:127128961-127128983 AGCAGGTGATGAATGCTGCAAGG - Intergenic
1197602647 X:128548278-128548300 AGCAGGTGATGAATCCTGCCAGG + Intergenic
1197677599 X:129347072-129347094 GGCTGGTGATTAATCCTGCCAGG - Intergenic
1199032219 X:143013808-143013830 AGCAGGTGATGAATCCTGCCAGG - Intergenic
1199173538 X:144758362-144758384 AGCAGGTGATGAATCCTGCCAGG - Intergenic
1199173579 X:144758626-144758648 AGCAGGTGATGAATACTGCAAGG - Intergenic
1199274610 X:145926421-145926443 AACAGGTGATGAATCCTGCAAGG - Intergenic
1200448737 Y:3297956-3297978 AGCTGCTGATGAATCCTGCCAGG - Intergenic
1200547168 Y:4532173-4532195 TGCTAGGGATGGAGCCTGCAGGG - Intergenic
1200653277 Y:5868091-5868113 TGTTGGTCCTGAACTCTGCATGG - Intergenic