ID: 1089515330

View in Genome Browser
Species Human (GRCh38)
Location 11:119028425-119028447
Sequence TAAGTGTAATGTTCCCTGCA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 171}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089515330_1089515344 27 Left 1089515330 11:119028425-119028447 CCCTGCAGGGAACATTACACTTA 0: 1
1: 0
2: 1
3: 13
4: 171
Right 1089515344 11:119028475-119028497 GGAGCAATGAAAGAAGGCATGGG 0: 1
1: 0
2: 1
3: 27
4: 367
1089515330_1089515339 -5 Left 1089515330 11:119028425-119028447 CCCTGCAGGGAACATTACACTTA 0: 1
1: 0
2: 1
3: 13
4: 171
Right 1089515339 11:119028443-119028465 ACTTAGGGGTTAGGGACCAGGGG 0: 1
1: 0
2: 0
3: 9
4: 137
1089515330_1089515338 -6 Left 1089515330 11:119028425-119028447 CCCTGCAGGGAACATTACACTTA 0: 1
1: 0
2: 1
3: 13
4: 171
Right 1089515338 11:119028442-119028464 CACTTAGGGGTTAGGGACCAGGG 0: 1
1: 0
2: 0
3: 11
4: 153
1089515330_1089515345 28 Left 1089515330 11:119028425-119028447 CCCTGCAGGGAACATTACACTTA 0: 1
1: 0
2: 1
3: 13
4: 171
Right 1089515345 11:119028476-119028498 GAGCAATGAAAGAAGGCATGGGG 0: 1
1: 0
2: 2
3: 38
4: 400
1089515330_1089515342 21 Left 1089515330 11:119028425-119028447 CCCTGCAGGGAACATTACACTTA 0: 1
1: 0
2: 1
3: 13
4: 171
Right 1089515342 11:119028469-119028491 AACACAGGAGCAATGAAAGAAGG 0: 1
1: 0
2: 2
3: 47
4: 447
1089515330_1089515337 -7 Left 1089515330 11:119028425-119028447 CCCTGCAGGGAACATTACACTTA 0: 1
1: 0
2: 1
3: 13
4: 171
Right 1089515337 11:119028441-119028463 ACACTTAGGGGTTAGGGACCAGG 0: 1
1: 0
2: 0
3: 10
4: 87
1089515330_1089515340 6 Left 1089515330 11:119028425-119028447 CCCTGCAGGGAACATTACACTTA 0: 1
1: 0
2: 1
3: 13
4: 171
Right 1089515340 11:119028454-119028476 AGGGACCAGGGGAGAAACACAGG 0: 1
1: 0
2: 4
3: 35
4: 321
1089515330_1089515343 26 Left 1089515330 11:119028425-119028447 CCCTGCAGGGAACATTACACTTA 0: 1
1: 0
2: 1
3: 13
4: 171
Right 1089515343 11:119028474-119028496 AGGAGCAATGAAAGAAGGCATGG 0: 1
1: 0
2: 5
3: 74
4: 1021

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089515330 Original CRISPR TAAGTGTAATGTTCCCTGCA GGG (reversed) Exonic
901431840 1:9220714-9220736 TCAGTGTTATGTTCCAGGCAGGG + Intergenic
901602601 1:10433443-10433465 TAAGGGCAAAGTTCCCTGCCCGG + Intronic
904909530 1:33923566-33923588 TAGGTGTAATGATCCATTCAGGG + Intronic
909344390 1:74569096-74569118 TGAGTGTAATGTGGCCAGCATGG + Exonic
910214162 1:84825473-84825495 TGAATTTAATGTTCTCTGCAAGG + Intronic
911765149 1:101665184-101665206 TAAATGTAATTTTCTCAGCAAGG - Intergenic
912479328 1:109967782-109967804 TAAGTATGATGTTAGCTGCAGGG - Intergenic
914700579 1:150129138-150129160 TATGTGTAATGTTCTGTGCACGG + Intronic
914786700 1:150839640-150839662 TCACTGTGATTTTCCCTGCATGG + Exonic
916316803 1:163457974-163457996 AATGTGTAAGGTTCCCTGCTGGG + Intergenic
918539831 1:185618920-185618942 TAAGTATGATGTTCACTGTAGGG - Intergenic
921658673 1:217772730-217772752 TAAGTGCCATGTACCCTGCTAGG + Intronic
922085534 1:222343413-222343435 TAACTGTACTTTTCTCTGCATGG + Intergenic
922418844 1:225446087-225446109 GAAGTGAAATGCTCCCTGCCTGG - Intergenic
922707365 1:227796458-227796480 TACCTGCAATGTGCCCTGCATGG + Intergenic
923677951 1:236096812-236096834 TAAGTTTAATTTTCTCAGCAAGG + Intergenic
924656555 1:245977821-245977843 AAAGTAGTATGTTCCCTGCATGG - Intronic
1064448328 10:15417533-15417555 TAAGTCTAATGTTACCTGTAGGG - Intergenic
1066548588 10:36529596-36529618 TAAGTATGATGTTAGCTGCAGGG - Intergenic
1074727025 10:116321557-116321579 TAAGTGTAAAATTCTCTGCTGGG - Intergenic
1075285641 10:121183516-121183538 CAAGCCTAATGTTCCCTACATGG + Intergenic
1075935337 10:126336032-126336054 TAAATGTAATGTATCCTGGATGG + Intronic
1077705218 11:4478610-4478632 CAAGTGTAATTTGCCCTGCTAGG + Intergenic
1078403799 11:11050260-11050282 TAAGTATAATGTTAGCTGTAGGG + Intergenic
1079119149 11:17667880-17667902 TAAGTGTGATGTTTCCTTTAGGG - Intergenic
1081004597 11:37719187-37719209 TAAATGTAATGTACCCTAGATGG + Intergenic
1081723891 11:45311988-45312010 TAAGTATAATGTTTGCTGTAGGG + Intergenic
1084633113 11:70369106-70369128 TAAGTATGATGTTCACTGTAGGG + Intronic
1085759419 11:79228947-79228969 TAAATGTAATGTGTCCTGCATGG - Intronic
1087577620 11:100009741-100009763 TAGATGTAATGTTCCCTGAAAGG + Intronic
1087648353 11:100834391-100834413 TAAGTCTAATTTACACTGCATGG - Intronic
1087846281 11:102977264-102977286 GAGGTGTAATGTTCCCTGTAAGG + Intergenic
1087927978 11:103942257-103942279 TAATTGAAATGTTCCCTAAAAGG - Intronic
1089194328 11:116684385-116684407 TAAGTATGATGTTAGCTGCAGGG - Intergenic
1089515330 11:119028425-119028447 TAAGTGTAATGTTCCCTGCAGGG - Exonic
1089998302 11:122929628-122929650 CATGTGTAATGTCCCTTGCACGG - Intronic
1090880939 11:130830960-130830982 TATTTTGAATGTTCCCTGCAAGG + Intergenic
1091905087 12:4179205-4179227 TAATTATAATGTGCCCTGCGTGG - Intergenic
1091998265 12:5012467-5012489 TTTGTGTCATGTTCCCTTCAAGG - Intergenic
1092633992 12:10420146-10420168 TAAATGTAATGTTCCATGAGTGG + Intronic
1093720283 12:22434337-22434359 TAACTGTGATGTTATCTGCATGG - Intronic
1095901324 12:47331597-47331619 TAAGTATGATGTTAGCTGCAGGG + Intergenic
1099430508 12:82579191-82579213 TAAGTGTGGTGTTCCATGTAAGG - Intergenic
1100344910 12:93719074-93719096 TAAGTATGATGTTAGCTGCAGGG + Intronic
1100683374 12:96955844-96955866 TAAGTTTAATGTTAGCTGCTGGG - Intergenic
1101651633 12:106682439-106682461 AAACTGTACTATTCCCTGCATGG + Intronic
1105584689 13:21733054-21733076 TAGGTGCAATTTGCCCTGCATGG + Intergenic
1108701442 13:52947739-52947761 TAACTGGAGAGTTCCCTGCAGGG + Intergenic
1108837329 13:54567937-54567959 TAAGTGTAAGGAGCCCTTCATGG + Intergenic
1110248041 13:73349691-73349713 TAATTGTGATGTTACCTGTAGGG - Intergenic
1110698670 13:78521321-78521343 TAAGTGTCATATTACCTGCTTGG + Intergenic
1111334973 13:86808812-86808834 TAAGTGCAATGTACACTGCTCGG + Intergenic
1113298333 13:108987083-108987105 TAACTGCAATGTTCCTCGCAAGG + Intronic
1114941769 14:27621966-27621988 TAAGTATAATGTTAGCTGTAAGG - Intergenic
1121351744 14:93178916-93178938 TAAATGTAATGTGTCCTGGAAGG - Intergenic
1122266274 14:100548396-100548418 GAAGTCGACTGTTCCCTGCAGGG + Intronic
1122455912 14:101851126-101851148 CAAGTGTATTCTTCCATGCAAGG - Intronic
1125430428 15:39588220-39588242 TAAGTGTGAGGTCCGCTGCAAGG + Intronic
1127704453 15:61533270-61533292 GAAGTGAAATGATCCATGCAAGG - Intergenic
1127823344 15:62680680-62680702 TAAGTATAATGTACACTGCTTGG - Intronic
1134877024 16:17709673-17709695 TTTGTGTGATGTTCCCTGAAAGG - Intergenic
1136102224 16:28004495-28004517 TAAGTGTAAGCTACCCTGCCCGG - Intronic
1136452681 16:30362740-30362762 TAAACTTAATGTTCCCTGCCGGG + Intronic
1137755457 16:50898636-50898658 AAAGCATAAAGTTCCCTGCAGGG - Intergenic
1138946297 16:61854378-61854400 TAAGAGTAATGTTTGCTCCAGGG + Intronic
1148199253 17:45738912-45738934 TAAGTATAATGTTAGCTGTAGGG + Intergenic
1149362028 17:55905159-55905181 TAAATGTAATGTATCCTGAATGG + Intergenic
1150465722 17:65391152-65391174 TTGGTGTGATGTTCCCTGCTTGG + Intergenic
1150760887 17:67959986-67960008 TAAGAGTAATGTTTCATCCATGG + Intronic
1150922613 17:69499253-69499275 TAAGCAGAATGTTCCCTGGATGG - Intronic
1151681229 17:75623941-75623963 CGAGTGCAGTGTTCCCTGCAGGG - Intergenic
1152548540 17:81016926-81016948 TAAGTGTGATGTTATCTGTAGGG - Intergenic
1155589992 18:27416464-27416486 TAAGTATGATGTTCACTGCAGGG - Intergenic
1155780527 18:29826899-29826921 CAAGAGTCATGTTCCCTCCAGGG - Intergenic
1156226984 18:35118990-35119012 CAACTGGCATGTTCCCTGCAGGG + Intronic
1156380094 18:36551027-36551049 TAAGTATGATGTTATCTGCAGGG + Intronic
1165457417 19:35921120-35921142 AAAGTGTACTGTCCCCTGAAAGG - Intergenic
926936507 2:18091191-18091213 TAAGTGCCATGTTCCTTGCCTGG - Intronic
927200301 2:20574067-20574089 GAAGTGTCATGTTCACAGCAGGG + Intronic
927727638 2:25439060-25439082 TAAATGTAATGTATCCTGGATGG + Intronic
928206651 2:29289393-29289415 TCAATGTAATTTACCCTGCATGG + Intronic
928915218 2:36463398-36463420 GAAAGGTAATGTTCCCAGCAGGG - Intronic
930441069 2:51406671-51406693 TCAGGGTAATGTTGGCTGCATGG + Intergenic
930445273 2:51463167-51463189 TAAGTTTAATGTCCCTGGCATGG + Intergenic
931315896 2:61131082-61131104 TAAGTGTAATGTTAGCTGTGGGG - Intronic
933838782 2:86268030-86268052 TAAGTCTAATGTTAGCTGTAGGG - Intronic
937332405 2:121039809-121039831 GAAGTGGAAGGTTCCATGCATGG - Intergenic
938572944 2:132577985-132578007 TAAGTGTAACGTTAACTGTAGGG + Intronic
941603761 2:167569774-167569796 TAAGTGTAATGGTAGCTGTAAGG + Intergenic
942985225 2:182132967-182132989 TAAGTGAAATGTTCTATACAAGG - Intergenic
944139438 2:196439117-196439139 TAATTTTAATGTACCATGCAAGG + Intronic
947153151 2:227134988-227135010 GACATGTAATTTTCCCTGCAAGG + Intronic
948014662 2:234678231-234678253 TAAAGGTAATGTTACATGCAAGG + Intergenic
1170085372 20:12525722-12525744 TAACTTTAACGTGCCCTGCATGG + Intergenic
1170961002 20:21025952-21025974 TAAGTGGAATGTTCCCCAGATGG - Intergenic
1171860122 20:30392409-30392431 TCAATGTAATGTTTCCTGAACGG - Intronic
1173593925 20:44247095-44247117 TCAGTGTCAGGCTCCCTGCAAGG - Intronic
1173767134 20:45622844-45622866 TAAATGTGATGTTCACTGCTAGG + Intronic
1176740850 21:10600677-10600699 TAAGTGTACAGCTCCCTGAAGGG + Intronic
1176895910 21:14378184-14378206 CAAGGGTACTGTTACCTGCAAGG + Exonic
1177544783 21:22542820-22542842 TAAGAGAACTGTCCCCTGCACGG - Intergenic
1178158354 21:29881479-29881501 TAAGTGTCTTATTCCATGCAAGG + Intronic
1184641582 22:45875351-45875373 TAAGTGTGATTTTATCTGCAGGG - Intergenic
952203234 3:31152254-31152276 TGGGTGAAATGTTCCCTCCATGG + Intergenic
955109617 3:55935403-55935425 CAGGTTTAGTGTTCCCTGCATGG + Intronic
956134564 3:66086354-66086376 TTGGTGTATTGTACCCTGCATGG + Intergenic
956947719 3:74242638-74242660 TAAATGTATTTTTCCCTCCAGGG + Intergenic
957585200 3:82123914-82123936 TATGGGTAATATGCCCTGCAAGG + Intergenic
961032660 3:123620089-123620111 TTATTTTAATATTCCCTGCAAGG - Intronic
961090622 3:124108109-124108131 TAAGTGGAGCCTTCCCTGCAAGG - Intronic
961341816 3:126228745-126228767 TAAATGTAATGTATCCTGGATGG - Intergenic
961651245 3:128417701-128417723 TAAGTGAGTTGTTCCATGCAGGG + Intergenic
963012435 3:140784835-140784857 TAAGTATAATGTTAACTGTAAGG - Intergenic
963725743 3:148919294-148919316 TAAGTATAATGTTAGCTGTAAGG - Intergenic
963779329 3:149471558-149471580 TAAGTGTATTGTTACATGCATGG - Intergenic
965650943 3:170932802-170932824 TAAGTGTAATGTTCACTGTTGGG - Intergenic
966559599 3:181305275-181305297 TACGTGAAATGTTCCCAGTAGGG - Intergenic
966965578 3:184989221-184989243 TAAGTATGATGTTAGCTGCAAGG + Intronic
967357282 3:188586370-188586392 TGCTTGTACTGTTCCCTGCAGGG - Intronic
967603043 3:191412314-191412336 TAAGTGCAATGTACACTGCTTGG - Intergenic
972425862 4:38932059-38932081 TAAGTGTAATGTTGCCAGGAAGG - Intronic
973286094 4:48418273-48418295 TAAGTATAATGTTAACTGTAGGG + Intronic
977659730 4:99569340-99569362 TAAATGTAATGTACCCTGGATGG + Intronic
980591055 4:134890091-134890113 TAAATGTAGTTTACCCTGCAGGG + Intergenic
981366137 4:143905725-143905747 TAAGTACAATTTTCACTGCAAGG + Intergenic
981376252 4:144019505-144019527 TAAGTACAATTTTCACTGCAAGG + Intergenic
981386765 4:144140853-144140875 TAAGTAAAATTTTCACTGCAAGG + Intergenic
981794330 4:148578958-148578980 TAAGTATAATATTCACTGTAGGG - Intergenic
982259075 4:153478275-153478297 TAAGTGTAATGTTCTGTGATTGG + Intronic
983368320 4:166824851-166824873 TTAGTGTAATTTTCCCTGCAAGG - Intronic
984160822 4:176250104-176250126 TAAGTGAAATATCACCTGCAAGG + Intronic
984577645 4:181470460-181470482 TCATTGAAATGTACCCTGCAAGG + Intergenic
987164748 5:15185567-15185589 TAAGTTTATTCTCCCCTGCAAGG + Intergenic
988496670 5:31751347-31751369 TAATTGCAAGGTCCCCTGCAAGG - Intronic
989549428 5:42716356-42716378 TAAGTGAAATGTTTAGTGCAGGG + Intronic
990966011 5:61448923-61448945 TAGTTGTAATGCTGCCTGCAAGG + Intronic
993862020 5:93147810-93147832 TAAATATAATGAGCCCTGCATGG + Intergenic
996485949 5:124034334-124034356 TAATTGTGATGTACCCTGTATGG + Intergenic
998190001 5:140015606-140015628 TAAGTATCCTGTTTCCTGCATGG + Intronic
1001825656 5:174743090-174743112 TGAGTGCAATGTTCACTGCTTGG + Intergenic
1002323926 5:178393160-178393182 TAAGGCTAATGCTCCCTGCCAGG - Intronic
1003313522 6:4990046-4990068 TAAGTGTGATGTTAGCTGTAGGG + Intergenic
1003995391 6:11535659-11535681 TATCTGTAATGTTCTGTGCAAGG - Intergenic
1005228226 6:23668163-23668185 TAAGTATAATGTTGGCTGCAGGG + Intergenic
1005833120 6:29686790-29686812 TAAATGTAATGTATCCTGGATGG - Intergenic
1010647384 6:78407075-78407097 TAATTGTAATGTTACGTGAAAGG + Intergenic
1014961008 6:127684763-127684785 TAAGTATAATGTTAACTGTAGGG + Intergenic
1017370371 6:153698661-153698683 TAAATGTGCTGTTCTCTGCAAGG - Intergenic
1017700015 6:157059993-157060015 GAAGTGTATTGTTCCTGGCAGGG + Intronic
1018863246 6:167727574-167727596 TAAGTGTGATGTTAGCTGTAGGG - Intergenic
1019826182 7:3286226-3286248 CAATTGTAACGTTCTCTGCAAGG + Intergenic
1022627866 7:32056619-32056641 TAAATGTAATGATGACTGCAGGG + Intronic
1022852762 7:34282248-34282270 TATGTGTAATTGGCCCTGCAGGG - Intergenic
1027391358 7:77706700-77706722 TAAGTTTATTGTTACCTGTATGG + Intronic
1028926655 7:96364616-96364638 TAAGTATAATGTTAGCTGTAGGG + Intergenic
1029900766 7:104036743-104036765 TAAGTTTGAGGATCCCTGCAGGG + Intergenic
1030174738 7:106640421-106640443 TGTGTGTAATGTTACCTGAAAGG - Intergenic
1030278775 7:107747868-107747890 TGACTGTAATATTTCCTGCAGGG + Intronic
1034024457 7:147684378-147684400 AAAGTGTAAAGTTCCTTGTAGGG - Intronic
1034380745 7:150690138-150690160 TAACTCTCATGTTCCTTGCAGGG + Intronic
1035992961 8:4512319-4512341 TAAGTAAAATGTTAGCTGCAGGG - Intronic
1036138856 8:6187790-6187812 TATGGGTAGTGTTCCCTGCAGGG - Intergenic
1037508738 8:19560110-19560132 TAAGTAGAATGTAACCTGCACGG + Intronic
1038363348 8:26905525-26905547 TAATTGTAATATTACCTGCAGGG - Intergenic
1040420305 8:47233438-47233460 TAAGTATAATGTTAGCTGTAGGG - Intergenic
1040909205 8:52501457-52501479 TAAGTCTTGTCTTCCCTGCATGG + Intergenic
1041459075 8:58091803-58091825 CATGTGAAATGATCCCTGCATGG + Intronic
1048131099 8:131698498-131698520 TAAATGTAATGTGGCCTGCCTGG + Intergenic
1048642618 8:136381032-136381054 TAAGTATAATGGTACCTGTAAGG - Intergenic
1049006855 8:139861135-139861157 TAAATGTAATTTTCTCAGCAAGG + Intronic
1050008075 9:1155807-1155829 CAAGTGCTATGTTCCCTGCCAGG - Intergenic
1051345816 9:16150242-16150264 TAAGTGTAAAGCTCCCTACCAGG + Intergenic
1056092750 9:83220062-83220084 GCAGTGTAATGTTCCCCTCAAGG - Intergenic
1058361038 9:104146225-104146247 GAAGTGTAATGTTAGCTGTAAGG + Intergenic
1060249365 9:121972641-121972663 TCAGGGTAATATTTCCTGCAGGG + Intronic
1062368188 9:136222017-136222039 TTTGTGAAAGGTTCCCTGCAAGG - Intronic
1062704359 9:137927726-137927748 TAAGTATAATGTTAGCTGTACGG + Intronic
1186683372 X:11898970-11898992 TGAATGTTATGTTCACTGCAGGG - Intergenic
1189741996 X:44128427-44128449 TAAGTGTGATGTTAGCTGTAGGG + Intergenic
1189840934 X:45076909-45076931 TAATTGTAATGTTTCCTAAAGGG - Intronic
1192548535 X:72033998-72034020 TAAGTTTAATGTTAGCTGTAGGG + Intergenic
1194113057 X:89860581-89860603 TAAGTGTAATATTAGCTGCGGGG + Intergenic
1194426346 X:93743044-93743066 TAATTATAATGTTGACTGCATGG + Intergenic
1195633204 X:107082125-107082147 TAAGTATAATGTTAGCTGTAGGG + Intronic
1195658205 X:107353308-107353330 GAAGTGTGATGTGCTCTGCACGG + Intergenic
1200465708 Y:3515411-3515433 TAAGTGTAATATTAGCTGCTGGG + Intergenic