ID: 1089516508

View in Genome Browser
Species Human (GRCh38)
Location 11:119035705-119035727
Sequence CAGGTACATGCCACCACACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 164463
Summary {0: 125, 1: 3157, 2: 14600, 3: 46047, 4: 100534}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089516508_1089516518 22 Left 1089516508 11:119035705-119035727 CCAGGTGTGGTGGCATGTACCTG 0: 125
1: 3157
2: 14600
3: 46047
4: 100534
Right 1089516518 11:119035750-119035772 TGAGGTGGCAGGATTGCTTGAGG 0: 13
1: 943
2: 2962
3: 8299
4: 19338
1089516508_1089516514 4 Left 1089516508 11:119035705-119035727 CCAGGTGTGGTGGCATGTACCTG 0: 125
1: 3157
2: 14600
3: 46047
4: 100534
Right 1089516514 11:119035732-119035754 CCCAGCTAATTGGGAGACTGAGG 0: 22
1: 4502
2: 104896
3: 221760
4: 352081
1089516508_1089516520 30 Left 1089516508 11:119035705-119035727 CCAGGTGTGGTGGCATGTACCTG 0: 125
1: 3157
2: 14600
3: 46047
4: 100534
Right 1089516520 11:119035758-119035780 CAGGATTGCTTGAGGCAGGAAGG No data
1089516508_1089516516 7 Left 1089516508 11:119035705-119035727 CCAGGTGTGGTGGCATGTACCTG 0: 125
1: 3157
2: 14600
3: 46047
4: 100534
Right 1089516516 11:119035735-119035757 AGCTAATTGGGAGACTGAGGTGG No data
1089516508_1089516510 -6 Left 1089516508 11:119035705-119035727 CCAGGTGTGGTGGCATGTACCTG 0: 125
1: 3157
2: 14600
3: 46047
4: 100534
Right 1089516510 11:119035722-119035744 TACCTGTGGTCCCAGCTAATTGG 0: 3
1: 390
2: 9014
3: 81367
4: 203139
1089516508_1089516517 11 Left 1089516508 11:119035705-119035727 CCAGGTGTGGTGGCATGTACCTG 0: 125
1: 3157
2: 14600
3: 46047
4: 100534
Right 1089516517 11:119035739-119035761 AATTGGGAGACTGAGGTGGCAGG No data
1089516508_1089516519 26 Left 1089516508 11:119035705-119035727 CCAGGTGTGGTGGCATGTACCTG 0: 125
1: 3157
2: 14600
3: 46047
4: 100534
Right 1089516519 11:119035754-119035776 GTGGCAGGATTGCTTGAGGCAGG 0: 3
1: 142
2: 3132
3: 8556
4: 17476
1089516508_1089516511 -5 Left 1089516508 11:119035705-119035727 CCAGGTGTGGTGGCATGTACCTG 0: 125
1: 3157
2: 14600
3: 46047
4: 100534
Right 1089516511 11:119035723-119035745 ACCTGTGGTCCCAGCTAATTGGG 0: 12
1: 2037
2: 24022
3: 114359
4: 255464

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089516508 Original CRISPR CAGGTACATGCCACCACACC TGG (reversed) Intergenic
Too many off-targets to display for this crispr