ID: 1089516512

View in Genome Browser
Species Human (GRCh38)
Location 11:119035724-119035746
Sequence TCCCAATTAGCTGGGACCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 475646
Summary {0: 28, 1: 4683, 2: 54889, 3: 172316, 4: 243730}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089516512_1089516519 7 Left 1089516512 11:119035724-119035746 CCTGTGGTCCCAGCTAATTGGGA 0: 28
1: 4683
2: 54889
3: 172316
4: 243730
Right 1089516519 11:119035754-119035776 GTGGCAGGATTGCTTGAGGCAGG 0: 3
1: 142
2: 3132
3: 8556
4: 17476
1089516512_1089516520 11 Left 1089516512 11:119035724-119035746 CCTGTGGTCCCAGCTAATTGGGA 0: 28
1: 4683
2: 54889
3: 172316
4: 243730
Right 1089516520 11:119035758-119035780 CAGGATTGCTTGAGGCAGGAAGG No data
1089516512_1089516517 -8 Left 1089516512 11:119035724-119035746 CCTGTGGTCCCAGCTAATTGGGA 0: 28
1: 4683
2: 54889
3: 172316
4: 243730
Right 1089516517 11:119035739-119035761 AATTGGGAGACTGAGGTGGCAGG No data
1089516512_1089516518 3 Left 1089516512 11:119035724-119035746 CCTGTGGTCCCAGCTAATTGGGA 0: 28
1: 4683
2: 54889
3: 172316
4: 243730
Right 1089516518 11:119035750-119035772 TGAGGTGGCAGGATTGCTTGAGG 0: 13
1: 943
2: 2962
3: 8299
4: 19338
1089516512_1089516521 17 Left 1089516512 11:119035724-119035746 CCTGTGGTCCCAGCTAATTGGGA 0: 28
1: 4683
2: 54889
3: 172316
4: 243730
Right 1089516521 11:119035764-119035786 TGCTTGAGGCAGGAAGGTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089516512 Original CRISPR TCCCAATTAGCTGGGACCAC AGG (reversed) Intergenic
Too many off-targets to display for this crispr