ID: 1089516515

View in Genome Browser
Species Human (GRCh38)
Location 11:119035733-119035755
Sequence ACCTCAGTCTCCCAATTAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 425035
Summary {0: 7, 1: 902, 2: 19412, 3: 128996, 4: 275718}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089516515_1089516518 -6 Left 1089516515 11:119035733-119035755 CCAGCTAATTGGGAGACTGAGGT 0: 7
1: 902
2: 19412
3: 128996
4: 275718
Right 1089516518 11:119035750-119035772 TGAGGTGGCAGGATTGCTTGAGG 0: 13
1: 943
2: 2962
3: 8299
4: 19338
1089516515_1089516519 -2 Left 1089516515 11:119035733-119035755 CCAGCTAATTGGGAGACTGAGGT 0: 7
1: 902
2: 19412
3: 128996
4: 275718
Right 1089516519 11:119035754-119035776 GTGGCAGGATTGCTTGAGGCAGG 0: 3
1: 142
2: 3132
3: 8556
4: 17476
1089516515_1089516521 8 Left 1089516515 11:119035733-119035755 CCAGCTAATTGGGAGACTGAGGT 0: 7
1: 902
2: 19412
3: 128996
4: 275718
Right 1089516521 11:119035764-119035786 TGCTTGAGGCAGGAAGGTCAAGG No data
1089516515_1089516520 2 Left 1089516515 11:119035733-119035755 CCAGCTAATTGGGAGACTGAGGT 0: 7
1: 902
2: 19412
3: 128996
4: 275718
Right 1089516520 11:119035758-119035780 CAGGATTGCTTGAGGCAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089516515 Original CRISPR ACCTCAGTCTCCCAATTAGC TGG (reversed) Intergenic
Too many off-targets to display for this crispr