ID: 1089516517

View in Genome Browser
Species Human (GRCh38)
Location 11:119035739-119035761
Sequence AATTGGGAGACTGAGGTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089516512_1089516517 -8 Left 1089516512 11:119035724-119035746 CCTGTGGTCCCAGCTAATTGGGA 0: 28
1: 4683
2: 54889
3: 172316
4: 243730
Right 1089516517 11:119035739-119035761 AATTGGGAGACTGAGGTGGCAGG No data
1089516508_1089516517 11 Left 1089516508 11:119035705-119035727 CCAGGTGTGGTGGCATGTACCTG 0: 125
1: 3157
2: 14600
3: 46047
4: 100534
Right 1089516517 11:119035739-119035761 AATTGGGAGACTGAGGTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089516517 Original CRISPR AATTGGGAGACTGAGGTGGC AGG Intergenic
No off target data available for this crispr