ID: 1089516520

View in Genome Browser
Species Human (GRCh38)
Location 11:119035758-119035780
Sequence CAGGATTGCTTGAGGCAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089516513_1089516520 3 Left 1089516513 11:119035732-119035754 CCCAGCTAATTGGGAGACTGAGG 0: 23
1: 4785
2: 109370
3: 225137
4: 361355
Right 1089516520 11:119035758-119035780 CAGGATTGCTTGAGGCAGGAAGG No data
1089516508_1089516520 30 Left 1089516508 11:119035705-119035727 CCAGGTGTGGTGGCATGTACCTG 0: 125
1: 3157
2: 14600
3: 46047
4: 100534
Right 1089516520 11:119035758-119035780 CAGGATTGCTTGAGGCAGGAAGG No data
1089516515_1089516520 2 Left 1089516515 11:119035733-119035755 CCAGCTAATTGGGAGACTGAGGT 0: 7
1: 902
2: 19412
3: 128996
4: 275718
Right 1089516520 11:119035758-119035780 CAGGATTGCTTGAGGCAGGAAGG No data
1089516512_1089516520 11 Left 1089516512 11:119035724-119035746 CCTGTGGTCCCAGCTAATTGGGA 0: 28
1: 4683
2: 54889
3: 172316
4: 243730
Right 1089516520 11:119035758-119035780 CAGGATTGCTTGAGGCAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089516520 Original CRISPR CAGGATTGCTTGAGGCAGGA AGG Intergenic
No off target data available for this crispr