ID: 1089518435

View in Genome Browser
Species Human (GRCh38)
Location 11:119048352-119048374
Sequence CGGGCTGGTACAGCTTGTCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 69}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089518426_1089518435 23 Left 1089518426 11:119048306-119048328 CCAGAGATCTCCTCACGCTGCTC 0: 1
1: 0
2: 2
3: 9
4: 148
Right 1089518435 11:119048352-119048374 CGGGCTGGTACAGCTTGTCCTGG 0: 1
1: 0
2: 0
3: 7
4: 69
1089518425_1089518435 24 Left 1089518425 11:119048305-119048327 CCCAGAGATCTCCTCACGCTGCT 0: 1
1: 0
2: 2
3: 11
4: 131
Right 1089518435 11:119048352-119048374 CGGGCTGGTACAGCTTGTCCTGG 0: 1
1: 0
2: 0
3: 7
4: 69
1089518428_1089518435 13 Left 1089518428 11:119048316-119048338 CCTCACGCTGCTCCTCTGTGGAC 0: 1
1: 0
2: 0
3: 22
4: 244
Right 1089518435 11:119048352-119048374 CGGGCTGGTACAGCTTGTCCTGG 0: 1
1: 0
2: 0
3: 7
4: 69
1089518430_1089518435 1 Left 1089518430 11:119048328-119048350 CCTCTGTGGACACTTCCTGGTAC 0: 1
1: 0
2: 2
3: 20
4: 195
Right 1089518435 11:119048352-119048374 CGGGCTGGTACAGCTTGTCCTGG 0: 1
1: 0
2: 0
3: 7
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089518435 Original CRISPR CGGGCTGGTACAGCTTGTCC TGG Exonic
902023563 1:13365832-13365854 CGGGCTGGTCCAGAATGGCCAGG - Intergenic
902675808 1:18007897-18007919 CTGGCAGGTTCAACTTGTCCTGG - Intergenic
903247214 1:22025005-22025027 GGGGTTGATACAGCCTGTCCGGG - Intergenic
910537302 1:88313108-88313130 CAGGCTGGCACTGCTTCTCCTGG + Intergenic
915599195 1:156912197-156912219 GGGGCAGGTACAGCTTTTCCTGG - Intronic
920086418 1:203421140-203421162 CGGGCAGGTACAGCTGCTCAAGG - Intergenic
1068954047 10:62805623-62805645 CGATCTGGTGCAGGTTGTCCCGG - Exonic
1069540665 10:69291558-69291580 CAAGCTTGTACAGCTGGTCCTGG + Intronic
1076413672 10:130269857-130269879 ACTGCTGGAACAGCTTGTCCAGG + Intergenic
1081652181 11:44831830-44831852 CTGTCTGGGACAGCTGGTCCAGG + Intronic
1083764798 11:64836647-64836669 CAGGATCATACAGCTTGTCCAGG + Intronic
1088434571 11:109796753-109796775 TGTGTTGGTACAGCTTGGCCAGG - Intergenic
1089379233 11:118015708-118015730 CGCGCTGGTACCACTTGGCCAGG + Intergenic
1089518435 11:119048352-119048374 CGGGCTGGTACAGCTTGTCCTGG + Exonic
1092778773 12:11966355-11966377 GGTGCTGATACAGCTGGTCCAGG - Intergenic
1096597079 12:52702786-52702808 CGTGCTGTTTCAGCTTGACCTGG - Intronic
1097373231 12:58809705-58809727 AGGGCTGGTACAGAGTGGCCTGG - Intronic
1108596777 13:51956265-51956287 AGGGCTGGTGCAGCTGGCCCTGG - Intronic
1121005559 14:90488624-90488646 AGGGCTGGGAGAGCTTGTCTTGG + Intergenic
1122268155 14:100556373-100556395 GGAGCTGGTACACCATGTCCTGG + Intronic
1126663906 15:51058150-51058172 CGGTCTGGTTCAGCTTCTTCCGG + Exonic
1127436361 15:58962320-58962342 CCTGCTGGTACAGCTTGTCTTGG - Intronic
1128335361 15:66782252-66782274 CAGACTGGAAGAGCTTGTCCAGG - Exonic
1129228705 15:74184647-74184669 CGGGCAGGTGCAGCTTCCCCAGG + Intronic
1131128305 15:89875309-89875331 GGGGCTAGTCCATCTTGTCCTGG - Intronic
1136570391 16:31093384-31093406 CGGGCTGGTGGAGCATGTGCTGG - Exonic
1137767505 16:50989391-50989413 CTGGCTGGGGCAGCTTGTCTTGG + Intergenic
1142379690 16:89724231-89724253 TGGGCTGGTGCAGCTGCTCCTGG + Intronic
1142743043 17:1941778-1941800 CCAGCTGGGACAGCTGGTCCAGG - Intronic
1143675782 17:8431313-8431335 TGGACTGGTACAGCTCGTTCAGG - Intronic
1144306146 17:13971105-13971127 CGGGCAGTGGCAGCTTGTCCAGG + Intergenic
1145846586 17:28043180-28043202 GGGGCTGCTGCAGCTGGTCCAGG - Exonic
1147935293 17:44007372-44007394 GGCCCTGGTCCAGCTTGTCCAGG - Exonic
1149450303 17:56744937-56744959 TGGGCTGGTGCAGCATGTCCAGG + Intergenic
1149650534 17:58273480-58273502 TGGGCTGGTACCGATTGTCCAGG + Exonic
1151958314 17:77391808-77391830 GGGGCTGGTTCAGCTGGTGCTGG + Intronic
1160034492 18:75287675-75287697 CGGGCTTGGACACCTTGCCCAGG - Exonic
1166648280 19:44549159-44549181 GGGGCTGGTGCAGCTTCTCTGGG + Intergenic
1168414951 19:56161767-56161789 GGGGCAGGTACAGCCTGTGCCGG + Intergenic
935634816 2:105242275-105242297 TGCGCGGGTTCAGCTTGTCCTGG - Exonic
935719879 2:105970667-105970689 CAGCCTGGTACAGCTGGGCCAGG + Intergenic
937439600 2:121904807-121904829 GGGGCTGGTTCAGCTTGGCAAGG + Intergenic
938281317 2:130065527-130065549 CTGGCTGGTCCACCTTGTCCTGG + Intergenic
938281423 2:130066167-130066189 CTGGCTGGTCCACCTGGTCCTGG + Intergenic
942038853 2:172037947-172037969 GGGGCTGGTACAGCTATTACAGG + Intronic
945627552 2:212229670-212229692 AGGGCTGTTACAGCTTATCCAGG + Intronic
948488578 2:238296995-238297017 CGGGCTGGAGCAGTTTTTCCAGG + Intergenic
1175956301 20:62611275-62611297 CGGGCTGATCCAGCTGGTTCTGG + Intergenic
1180235376 21:46456251-46456273 CTGGGTGGTACAGCTTGTTATGG + Intergenic
1180919630 22:19514755-19514777 GGCCATGGTACAGCTTGTCCAGG - Exonic
1182299651 22:29330446-29330468 GGGACTGGTAGAGCATGTCCTGG + Exonic
1184388644 22:44190597-44190619 CGGGCTGGAAGCGCTTGGCCAGG - Exonic
1184900589 22:47444246-47444268 TGGGCTGGCCCAGCTGGTCCGGG - Intergenic
1185319720 22:50195010-50195032 CGGCCTGCTGCAGCTTCTCCAGG - Exonic
950571175 3:13800980-13801002 GGGGCTGGACCAGCTGGTCCAGG + Intergenic
961365998 3:126399814-126399836 GAGGCTGGTACAGCTGCTCCAGG - Intronic
969230744 4:5828506-5828528 CGCGCTGGTACAGGTGCTCCGGG + Exonic
983646939 4:170001201-170001223 CTGGCTGACACAGCTTGTCATGG + Intronic
989295155 5:39817068-39817090 CCGGCCGGTACAGCTTGTTTAGG - Intergenic
995650373 5:114362238-114362260 AGGGCGGGCACGGCTTGTCCTGG - Exonic
1004075576 6:12341451-12341473 AGGGCAGATACAGCTTCTCCAGG - Intergenic
1005809712 6:29506468-29506490 CGGGCTGGAACACCTAGCCCAGG + Intergenic
1013365540 6:109434926-109434948 AGGGCTAGCAGAGCTTGTCCAGG - Intronic
1022649081 7:32258564-32258586 ATGGCTGGTACAGATTGTGCTGG - Intronic
1022963152 7:35449446-35449468 AGGGCTGGGTCAGATTGTCCAGG - Intergenic
1023019349 7:35996734-35996756 CTGGCTGGTACAGCTATTGCTGG - Intergenic
1023866884 7:44242580-44242602 TCTGCTGGTACAGCTTGTGCTGG + Exonic
1035373005 7:158391342-158391364 GGGCCTGGTGCAGCTTGGCCAGG - Intronic
1044569429 8:93700662-93700684 CGGGCTGTTACCGGTTTTCCAGG - Exonic
1044818368 8:96136388-96136410 TGACCTGGTACAGTTTGTCCTGG - Intergenic
1045883016 8:107063612-107063634 CTGGCTTGTACAGCTTCTGCAGG + Intergenic
1049719579 8:144109465-144109487 CGCGCCGGGACAGCTTGTCCTGG - Exonic
1049719786 8:144110498-144110520 CGGCCTGGTGCAGTTTGGCCTGG + Exonic
1053354104 9:37432023-37432045 AGGCCTGGTACAGGTCGTCCTGG - Exonic
1060150536 9:121285482-121285504 AAGGCTGGTACAGCATGGCCAGG + Intronic
1187044688 X:15635113-15635135 CTGGCTGGTACAGGTTTTCAAGG + Intronic
1198628024 X:138601527-138601549 AGGGCTGGTACAGCTACTCAAGG - Intergenic