ID: 1089521100

View in Genome Browser
Species Human (GRCh38)
Location 11:119064186-119064208
Sequence ATGCGGTTATTGACGAAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089521098_1089521100 22 Left 1089521098 11:119064141-119064163 CCGTGTCTCAAAAAACAAAACAA 0: 314
1: 786
2: 17465
3: 25805
4: 51577
Right 1089521100 11:119064186-119064208 ATGCGGTTATTGACGAAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089521100 Original CRISPR ATGCGGTTATTGACGAAAAC TGG Intergenic
No off target data available for this crispr