ID: 1089524867

View in Genome Browser
Species Human (GRCh38)
Location 11:119090266-119090288
Sequence GTATCCTTTTAGAAGAGTGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 328
Summary {0: 1, 1: 0, 2: 4, 3: 44, 4: 279}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089524866_1089524867 1 Left 1089524866 11:119090242-119090264 CCGCATCTGGAGTTCAGGAGTAT 0: 1
1: 0
2: 0
3: 18
4: 272
Right 1089524867 11:119090266-119090288 GTATCCTTTTAGAAGAGTGACGG 0: 1
1: 0
2: 4
3: 44
4: 279
1089524861_1089524867 21 Left 1089524861 11:119090222-119090244 CCCAGCTGCAGAGAAAGTTCCCG 0: 1
1: 1
2: 0
3: 5
4: 126
Right 1089524867 11:119090266-119090288 GTATCCTTTTAGAAGAGTGACGG 0: 1
1: 0
2: 4
3: 44
4: 279
1089524862_1089524867 20 Left 1089524862 11:119090223-119090245 CCAGCTGCAGAGAAAGTTCCCGC 0: 1
1: 0
2: 2
3: 4
4: 99
Right 1089524867 11:119090266-119090288 GTATCCTTTTAGAAGAGTGACGG 0: 1
1: 0
2: 4
3: 44
4: 279
1089524865_1089524867 2 Left 1089524865 11:119090241-119090263 CCCGCATCTGGAGTTCAGGAGTA 0: 1
1: 0
2: 0
3: 7
4: 125
Right 1089524867 11:119090266-119090288 GTATCCTTTTAGAAGAGTGACGG 0: 1
1: 0
2: 4
3: 44
4: 279

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089524867 Original CRISPR GTATCCTTTTAGAAGAGTGA CGG Intronic
903725075 1:25435751-25435773 GTATTGTTTTAGAGGAGTGTTGG + Intronic
905573811 1:39027242-39027264 GTATTTTTTTAGTAGAGAGAGGG + Intronic
906707462 1:47905259-47905281 GGATCCTTTGAGAAAAATGAAGG - Intronic
907211830 1:52830334-52830356 ATGTCCTGGTAGAAGAGTGAAGG + Intergenic
909209977 1:72810700-72810722 ATGTCCTTCTAGAAGACTGAAGG + Intergenic
909529726 1:76668792-76668814 GTATCAATTTATAATAGTGATGG + Intergenic
909713636 1:78680472-78680494 GGATTCTCTAAGAAGAGTGAAGG - Intergenic
910324155 1:85985352-85985374 TGATGCTTTTGGAAGAGTGATGG + Intronic
910681624 1:89871449-89871471 GTATATTTTTAGGAGAGGGAAGG - Intronic
910809643 1:91223092-91223114 ATCCCCTTTTAGAAGAGTGAAGG - Intergenic
911009022 1:93259988-93260010 CTATCTTTTTAAAAAAGTGATGG + Intronic
911819384 1:102397968-102397990 GAGTCCTTTCAAAAGAGTGATGG + Intergenic
912180465 1:107212983-107213005 TTCTACTTTTAGAAGAGTGGTGG + Intronic
912462026 1:109841135-109841157 GTATTTTTTTAGAAGAGACAGGG - Intergenic
915438104 1:155924744-155924766 TTATACTTTTAGGAGAGTCAGGG + Intronic
915783334 1:158578945-158578967 AAATGCTTTTAGAAGAATGATGG - Exonic
916820239 1:168391217-168391239 GTATTTTTTTAGAAGAGATAGGG + Intergenic
918385326 1:184001424-184001446 GTATATTTTTAAAAGATTGAGGG - Intronic
918465314 1:184815818-184815840 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
919547880 1:198946349-198946371 TTATCCTTTCTTAAGAGTGATGG + Intergenic
920901310 1:210112856-210112878 GTAGTCTTTTGCAAGAGTGAGGG + Intronic
920913842 1:210242017-210242039 GCATCTATTTACAAGAGTGATGG + Exonic
922158347 1:223058325-223058347 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
922759018 1:228113558-228113580 ATGTCCTTTTAGAAAAGTGAAGG + Intergenic
924798079 1:247307399-247307421 ATATACTTTTAGAAGATGGATGG - Intronic
1063685085 10:8229258-8229280 GTAGCCTTATAACAGAGTGAAGG - Intergenic
1063941873 10:11138629-11138651 GTTTACTTTTAGAAGACTGGGGG + Intronic
1064123009 10:12635537-12635559 GGATTCCTTTAGAAGAGAGAAGG + Intronic
1064598283 10:16968164-16968186 GTTTCCTTTTAAAACACTGATGG - Intronic
1067360628 10:45574878-45574900 TAGTCCTTTTGGAAGAGTGAGGG - Intronic
1071949677 10:90688358-90688380 GTCTCCTTTTATCAGACTGAGGG + Intergenic
1073996856 10:109325303-109325325 GTATCCTTTTAGAACAGATATGG - Intergenic
1074499997 10:114014593-114014615 GGATGGGTTTAGAAGAGTGATGG + Intergenic
1075839653 10:125489866-125489888 TCAGCCTGTTAGAAGAGTGAAGG - Intergenic
1078311813 11:10251260-10251282 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1078587172 11:12601887-12601909 GTCTCCTTTTAGAAGTTTAATGG - Intergenic
1078749248 11:14144209-14144231 ATACCCTTTTAGAAGATGGAAGG - Intronic
1079370115 11:19845416-19845438 GTATCCTGTTAGGAGGGTAATGG + Intronic
1080005023 11:27397602-27397624 CTTTCCTGTTAGGAGAGTGAGGG - Intronic
1080006705 11:27415813-27415835 GTATCCATTTAAAATAATGAGGG + Intronic
1082698362 11:56398723-56398745 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1083011851 11:59408939-59408961 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1083329107 11:61889067-61889089 GTATTTTTTTAGAAGAGACAGGG + Intronic
1084184741 11:67465508-67465530 GTCCCCAGTTAGAAGAGTGATGG + Intronic
1084897812 11:72287614-72287636 TTATCCTTGTAAAAGATTGATGG - Intergenic
1085215868 11:74830887-74830909 GTACCATTTTAGTAGAATGAAGG + Intronic
1085479843 11:76812207-76812229 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1086133372 11:83422771-83422793 CAGTCCTTTTGGAAGAGTGAGGG - Intergenic
1087226903 11:95611422-95611444 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1087524702 11:99295517-99295539 ATGTCCTTCTAGAAGACTGAAGG + Intronic
1088029484 11:105228916-105228938 GTATTTTCTTGGAAGAGTGATGG + Intergenic
1088103815 11:106183577-106183599 ATGCCCTTTTAGAAGAGTGAAGG - Intergenic
1089524867 11:119090266-119090288 GTATCCTTTTAGAAGAGTGACGG + Intronic
1089524870 11:119090287-119090309 GGATCCTTTTGGAAGAGTGACGG + Intronic
1090292885 11:125561329-125561351 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1092390589 12:8074132-8074154 GTATTCTTTTAGTAGAGACAGGG + Intergenic
1093225643 12:16479998-16480020 GTTTCCTTCTAGAAGTGTTATGG - Intronic
1093273579 12:17096383-17096405 GTATCTTTATAGCAGTGTGATGG + Intergenic
1093327468 12:17795386-17795408 GTACACTTTTAGTAGAGAGAGGG - Intergenic
1093358773 12:18199450-18199472 TAGTCCTTTTACAAGAGTGAGGG - Intronic
1093410468 12:18859171-18859193 GTAAACTTTAAGAAGAGTAAGGG - Intergenic
1095315129 12:40751186-40751208 GAATTATTTCAGAAGAGTGATGG + Intronic
1096415512 12:51408847-51408869 TTTTCCTTTTAGAACAGAGAAGG + Intronic
1096536187 12:52276528-52276550 TTATCCTTGTAGAAGAGAAAAGG + Intronic
1097254578 12:57663910-57663932 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1097554996 12:61125638-61125660 GTATCCTCTTAGAAGAGAGATGG - Intergenic
1098294417 12:68989988-68990010 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1098388583 12:69944871-69944893 GTATAATTTTAAAAAAGTGATGG + Intronic
1098502563 12:71210505-71210527 GTGTCCTTCTAGAAGAATAAAGG - Intronic
1099330743 12:81282778-81282800 GTACCCTTTTAAAAGAGGTAAGG + Intronic
1099409178 12:82303523-82303545 GTATGCTTCCAGAAGAGGGAGGG + Intronic
1101183629 12:102249656-102249678 GTATCCTTGAGGAAGGGTGAAGG - Intergenic
1101189409 12:102315861-102315883 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1103285720 12:119799661-119799683 GTATGCTTTTGGAAGAGTTGGGG - Intronic
1104668620 12:130665628-130665650 GGACCATTTTTGAAGAGTGAAGG - Intronic
1104687700 12:130799318-130799340 GTTTCCTTTTAGAAGTCTGTTGG - Intronic
1106624385 13:31405578-31405600 ATGGACTTTTAGAAGAGTGAAGG - Intergenic
1106735448 13:32584471-32584493 GCATCATTTTATAAGAGAGAGGG + Intergenic
1106745374 13:32698925-32698947 GTATTCTTTTAGTAGAGACAGGG + Intronic
1107255476 13:38421082-38421104 CTACCCATCTAGAAGAGTGAAGG + Intergenic
1108068504 13:46603643-46603665 GTATCCAATTAGAAAAGTGAAGG - Intronic
1109387996 13:61657661-61657683 GTATGCTTTTAAAAAAGGGAGGG - Intergenic
1111500227 13:89109231-89109253 TTATCCTTTTAGAAGAAAGAGGG - Intergenic
1111541929 13:89680012-89680034 GTAGCATTTTAGAAGAGTTTAGG + Intergenic
1113086914 13:106578008-106578030 GTATCCTGTAAGAAGAGAAAAGG + Intergenic
1113256199 13:108508850-108508872 GTGTCTTTTTGGGAGAGTGAGGG + Intergenic
1114865499 14:26589554-26589576 GTATCTTTTTAGAATATTGATGG - Intronic
1116576586 14:46583054-46583076 GATCCCTTTTAGAAGAGTGAAGG + Intergenic
1116679307 14:47945556-47945578 ATGTCTTTCTAGAAGAGTGAAGG - Intergenic
1116725624 14:48558391-48558413 ATACCCTTATAGAAGAGTGAAGG + Intergenic
1116858052 14:49971124-49971146 GTGTCTTTGGAGAAGAGTGATGG + Intergenic
1119454933 14:74746755-74746777 GTATTTTTTTAGTAGAGTCAGGG + Intergenic
1119655079 14:76411509-76411531 GTACCCCTTTATGAGAGTGAGGG + Intronic
1121268139 14:92617970-92617992 ATGCCCTTCTAGAAGAGTGAAGG + Intronic
1122721517 14:103725037-103725059 GCATTCTTTTAACAGAGTGAGGG - Intronic
1123769233 15:23512012-23512034 GTATTCTGTTATAACAGTGAGGG - Intergenic
1124222530 15:27862873-27862895 GTATACATTTAAAAGAATGACGG - Intronic
1125630813 15:41145586-41145608 CCTTTCTTTTAGAAGAGTGAAGG + Intergenic
1127446447 15:59067830-59067852 GTTTATTTTTAGATGAGTGAAGG - Intronic
1127580852 15:60338222-60338244 GTATTCTTTTAGTAGAGACAGGG + Intergenic
1128297753 15:66539180-66539202 GTAACCATTTAAAGGAGTGAGGG - Intronic
1128602050 15:69003774-69003796 TTGTCCATCTAGAAGAGTGAAGG + Intronic
1129244953 15:74273639-74273661 TTATCCTTTTAGTAGAGACAGGG + Intronic
1129260280 15:74362982-74363004 ATGCCCTTTCAGAAGAGTGAAGG - Intronic
1131484892 15:92812009-92812031 ATATCAATTTAGAAGAGTGAGGG - Intergenic
1131776768 15:95810602-95810624 GTATCCATTAAGAAGAATAAGGG - Intergenic
1132823550 16:1890452-1890474 CTAATGTTTTAGAAGAGTGATGG - Intergenic
1135019367 16:18950604-18950626 GTATTTTTTTAGTAGAGAGAAGG - Intergenic
1135626962 16:24003811-24003833 GTATGTTATAAGAAGAGTGAAGG + Intronic
1137513987 16:49126513-49126535 GTTTTCTATTAGATGAGTGAGGG - Intergenic
1138687182 16:58735627-58735649 GTATTTTTTTAGTAGAGAGAGGG - Intergenic
1140314216 16:73878917-73878939 TTATCTTTTTTGAACAGTGAAGG - Intergenic
1142638466 17:1271618-1271640 CGATGCTTTTAGGAGAGTGAGGG + Intergenic
1143548011 17:7611365-7611387 TTATCCTTTAAGAAAACTGACGG + Intronic
1144426679 17:15149489-15149511 ATGCCCTTTTAGAAGAGTGAAGG - Intergenic
1147297469 17:39495615-39495637 GTATTTTTTTAGTAGAGTCAGGG - Intronic
1147801131 17:43089138-43089160 GTATTTTTTTAGTAGAGAGAGGG - Intronic
1148368711 17:47077114-47077136 GTATTTTTTTAGTAGAGAGAGGG - Intergenic
1150112004 17:62509727-62509749 GTATCCTTTTAAAGGCTTGATGG + Intronic
1151487725 17:74411968-74411990 GCATCTTTTTGGCAGAGTGAAGG + Intergenic
1153313924 18:3703575-3703597 GTTTCTTTTTAGAAGACGGAGGG + Intronic
1153881650 18:9426461-9426483 TTGTACTTTTAGAAGAGTCAGGG - Intergenic
1154365682 18:13706581-13706603 TTGCCCTTCTAGAAGAGTGAAGG - Intronic
1155652407 18:28157869-28157891 GTATACTTTTAGAAGAGTTTGGG - Intronic
1156923830 18:42554494-42554516 TAATCCTTTTGCAAGAGTGAGGG + Intergenic
1159767255 18:72505257-72505279 ATATCCTTTCAGAAGAGAGGGGG - Intergenic
1160923275 19:1530469-1530491 GTATTCTTTTAGTAGAGACAGGG + Intronic
1162130773 19:8525023-8525045 GTATCGTTTTAGTAGAGACAGGG - Intronic
1162229779 19:9256542-9256564 ACATCCTTCTAGAATAGTGATGG - Intergenic
1162920981 19:13902748-13902770 GTATTTTTTTAGTAGAGTCAGGG - Intronic
1163209214 19:15828456-15828478 GTTTCCTTTTAGATGACGGAGGG + Intergenic
1163923418 19:20315102-20315124 GTCTCTTTTTAGAAGACAGATGG + Intergenic
1163961671 19:20702044-20702066 GTCTCTTTTTAGAAGAAAGATGG + Intronic
1163973526 19:20825483-20825505 GTCTCTTTTTAGAAGACAGATGG + Intronic
1164461337 19:28451388-28451410 ATGCCCTTTTAGAAAAGTGAAGG - Intergenic
1165380924 19:35479554-35479576 GTATGCTTTTAGAGGAGGGAGGG - Intergenic
1166187607 19:41151683-41151705 GTATTTTTTTAGAAGAGACAGGG - Intergenic
1167742290 19:51330981-51331003 GGATCCTTTTGGAAAGGTGAGGG - Intergenic
925947761 2:8881355-8881377 ATATCATCTTAGAAGAGTGTGGG + Intronic
926522055 2:13927706-13927728 ATGTCCATCTAGAAGAGTGAAGG - Intergenic
927841730 2:26449345-26449367 GTATTCTTTTAGGATAGTGAGGG + Intronic
930399359 2:50863482-50863504 GTTTGATTTTAGCAGAGTGAAGG + Intronic
930498514 2:52179855-52179877 GATGCCTTTCAGAAGAGTGAAGG - Intergenic
933077739 2:77950907-77950929 GTGCCCTTCTAGAAGAGTGAAGG + Intergenic
934161192 2:89251239-89251261 GTATTTTTTTAGTAGAGTCAAGG + Intergenic
934206085 2:89931190-89931212 GTATTTTTTTAGTAGAGTCAAGG - Intergenic
934591695 2:95557786-95557808 GTATTTTTTTAGTAGAGAGAGGG + Intergenic
936698891 2:114986243-114986265 GTATGCTTTTAGAAGTTTGTGGG - Intronic
936700882 2:115009769-115009791 GTATAATTTTAAAAAAGTGATGG + Intronic
938597092 2:132798922-132798944 GTATCTTTTTGGTAGAATGATGG - Intronic
939905864 2:147913755-147913777 GTTTCTGTTTAGCAGAGTGACGG - Intronic
940110712 2:150149581-150149603 GTATTCTTTTATCAGAGAGAAGG - Intergenic
940569296 2:155409914-155409936 ACGCCCTTTTAGAAGAGTGAAGG - Intergenic
940933990 2:159470064-159470086 TTATCCTTTCAGAATAGTGTTGG - Intronic
941251826 2:163174802-163174824 GTCTCCTTTTAAAAGAGTTAAGG + Intergenic
944699136 2:202230602-202230624 GTTTCTTTTTAAAAGAGTCATGG - Intronic
945585481 2:211656374-211656396 TCATCCTTTTAGGAGAGAGAAGG - Intronic
945983241 2:216333043-216333065 GTTTTCTTCTAGAAGAGTTATGG - Intronic
946083573 2:217149129-217149151 GTATCATATTAGAATAGTGGAGG + Intergenic
946727697 2:222677404-222677426 GTAGCTTTTTAGTAGAGTCAGGG - Intronic
946799044 2:223389997-223390019 GTATACATTTAGAAAAGGGAAGG - Intergenic
1169360329 20:4943278-4943300 GTATCCTTTTGGAGAAGTGTGGG - Intronic
1170742136 20:19067385-19067407 GTATGTTTTTAGAAGAGGCATGG - Intergenic
1171220328 20:23391135-23391157 GTATCTTTTTAGTAGAGACAGGG - Intronic
1171721762 20:28570300-28570322 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1171756299 20:29113199-29113221 AAGTCCTTCTAGAAGAGTGAAGG + Intergenic
1171785953 20:29464694-29464716 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1171862288 20:30412278-30412300 AAGTCCTTCTAGAAGAGTGAAGG + Intergenic
1172995427 20:39066798-39066820 TTTTCCTTTTGGATGAGTGATGG + Intergenic
1174185169 20:48701384-48701406 GTATTTTTTTAGAAGAGACAGGG + Intronic
1175055913 20:56198012-56198034 GTTTCCTTCTAGTTGAGTGAGGG + Intergenic
1175146634 20:56901451-56901473 GGATCCTTTTAAAAGAAAGAGGG + Intergenic
1177534067 21:22401693-22401715 ATGCCCTTTTAGAAGAGTGAAGG - Intergenic
1177634201 21:23766154-23766176 GTATCCTTTTGGTGGAGTGCTGG - Intergenic
1178838260 21:36116606-36116628 GTATTCTTTTGGTAGAGTCAGGG + Intergenic
1179055794 21:37932895-37932917 TTATCCTTTCAGAAAAGAGAGGG + Intergenic
1180295318 22:10928987-10929009 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1180413354 22:12637057-12637079 AAGTCCTTCTAGAAGAGTGAAGG + Intergenic
1180973881 22:19833689-19833711 GTATTTTTTTAGTAGAGTCAGGG - Intronic
1182322105 22:29484465-29484487 GTATCTTTTTAGTAGAGACAGGG - Intronic
1182898564 22:33878855-33878877 ATATGGTTTTAAAAGAGTGAGGG + Intronic
1183643423 22:39107351-39107373 ATGTCCTTCTAGAAGAGTAAAGG - Intergenic
1183803714 22:40190737-40190759 TTCTCCTTTTCGAAGAGTGCTGG + Intronic
949962609 3:9325620-9325642 ATGTCCTTCTAGACGAGTGAAGG + Intronic
950199825 3:11034983-11035005 GTATGTTTCTAGAAGAGGGAGGG + Intronic
950879227 3:16309062-16309084 GTATCCTTTTAGAAATTTTATGG + Intronic
951187212 3:19727649-19727671 ATGTCCTTGTGGAAGAGTGAAGG - Intergenic
951250336 3:20386953-20386975 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
951520018 3:23602670-23602692 GTATCCTTCTAGAGCTGTGAAGG - Intergenic
951746554 3:25984419-25984441 CTAACCTTTTAGAATACTGAAGG - Intergenic
951762472 3:26161754-26161776 TTGTCCTTTTGCAAGAGTGAGGG + Intergenic
952168164 3:30774729-30774751 GTTTCATTTTAGGAGAGTAAAGG + Intronic
953157781 3:40390628-40390650 GTATGTTTTTAGAATAGTAAGGG + Intronic
953366610 3:42350934-42350956 GTATCCTTTAAGTAGAGACAGGG + Intergenic
953834152 3:46328700-46328722 CAATCCTTTTGCAAGAGTGAGGG + Intergenic
954723696 3:52588728-52588750 GTATCTTTTTAGTAGAGACAGGG + Intronic
955576802 3:60374009-60374031 GTATCTTTTTAAAAAAGTAATGG + Intronic
959433239 3:106281520-106281542 GTATCCATTTATAAAAGAGATGG - Intergenic
959575108 3:107925586-107925608 CTTTCCTATTTGAAGAGTGAAGG - Intergenic
961110375 3:124278427-124278449 GTACCCTGTTTGAAGAATGAAGG + Intronic
961437917 3:126932125-126932147 GTCTTCTTTTAGAGGAGAGAGGG + Intronic
961792018 3:129383106-129383128 GTATTTTTTTAGTAGAGTCAGGG - Intergenic
963223281 3:142834155-142834177 GTGTGGTTTTAAAAGAGTGATGG - Intronic
963576623 3:147068406-147068428 ATGTCCTTTTAGAAGAGGGAAGG - Intergenic
963596567 3:147335151-147335173 GTAACCTGTTAGAGGAGTAAAGG - Intergenic
963959258 3:151290063-151290085 GTATTCTTTTAGTAGAGACAGGG + Intronic
964016039 3:151948063-151948085 ATAGCCTATGAGAAGAGTGAGGG + Intergenic
964815301 3:160710993-160711015 GGACACTTTTAAAAGAGTGATGG - Intergenic
964990707 3:162808321-162808343 GTATCCTTATAGAGGAGAGGTGG - Intergenic
965096069 3:164227733-164227755 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
965489850 3:169322562-169322584 GTTTCCTCTTTGAGGAGTGAAGG + Intronic
966024507 3:175259494-175259516 GGATACTTTTAAAAGAGTAATGG + Intronic
966062196 3:175771666-175771688 GTCTCCTTGTAAAAGAGAGATGG - Intronic
966375583 3:179292056-179292078 GTATTCTTTTAGTAGAGACAGGG - Intergenic
966488199 3:180495688-180495710 GTATCTTTTTAGAAATATGAAGG + Intergenic
966536207 3:181037152-181037174 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
967734495 3:192937788-192937810 GTATTTTCTTAGAAGACTGAGGG - Intergenic
971338813 4:25748920-25748942 CTATTCTTTCAGAAGAGTGTTGG - Intronic
971915720 4:32867742-32867764 GTATACTTTTAGTAGAGACAGGG + Intergenic
972819190 4:42680004-42680026 ATGTCCTGCTAGAAGAGTGAAGG - Intergenic
973186209 4:47332231-47332253 GTAGCCATTTAGAAGAGAAAGGG - Intronic
974189795 4:58489830-58489852 ATGCCGTTTTAGAAGAGTGAAGG + Intergenic
974516526 4:62920620-62920642 GTATCTTTTTAAAAATGTGAAGG - Intergenic
974788827 4:66658601-66658623 GCATCATTTTAGAAAAGTGGAGG - Intergenic
975140879 4:70917106-70917128 ATGCCCTTTTAGAACAGTGAAGG + Intronic
976291834 4:83426736-83426758 GTATTCTTTTAGAAGAGACGGGG + Intronic
978950729 4:114555918-114555940 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
980937018 4:139235247-139235269 ATGCCCTTTTAGAAGAGTGAAGG + Intergenic
981201305 4:141982806-141982828 ATATCCTTTTAGAAGATTGAAGG - Intergenic
982102454 4:151981245-151981267 GTATTCTTTTAGTAGAGACAGGG + Intergenic
982648135 4:158049709-158049731 GAATACTTTTAGAAAAATGATGG - Intergenic
983560509 4:169097025-169097047 GTTTCCTTGGAGAAGAGGGAGGG - Intronic
987841845 5:23232450-23232472 GATGCCTTTTAGAAGAGTGAAGG + Intergenic
989230557 5:39081617-39081639 GTATCCTTTTCGATAAGTTATGG - Intergenic
989336791 5:40327096-40327118 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
990290870 5:54350119-54350141 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
990647643 5:57862393-57862415 GTATTCTGTTAGAAGCATGATGG + Intergenic
992660776 5:78958574-78958596 ATATTCTTTTATAAAAGTGATGG - Intronic
993388286 5:87286174-87286196 GTATTTTTTTAGTAGAGTCAGGG + Intronic
995081144 5:108051934-108051956 GTATTTTTTTAGAAGAGACAGGG - Intronic
995227199 5:109714196-109714218 ATATCCTTTTGCAAGAGGGAAGG + Intronic
996487935 5:124058536-124058558 GTATCCTTATAAAAGAGGAAAGG - Intergenic
996511072 5:124316564-124316586 GTATTTTTTTAGTAGAGGGAGGG - Intergenic
997324030 5:133004662-133004684 GTATCTTTTTAGTAGAGACAGGG + Intronic
998547976 5:143048019-143048041 GTATCTTTTTAGTAGAGTCAAGG + Intronic
1002589571 5:180280484-180280506 GTAACGTTTTAGGACAGTGAAGG + Exonic
1002989814 6:2228218-2228240 GGATCCTTTTAGATCAGTGGTGG - Intronic
1003350137 6:5308917-5308939 GTATCATTATAGAAGAGGCAAGG + Intronic
1003483131 6:6551601-6551623 GTATCCTTTCAAAACAGTGTTGG - Intergenic
1003914857 6:10777232-10777254 GTATTCTTTTAGTAGAGACAGGG - Intronic
1005029506 6:21495600-21495622 GTATCTTTTTAGCAGAGACAGGG + Intergenic
1005328458 6:24724909-24724931 GGCTCTTTTTAGAAAAGTGAAGG - Intergenic
1005630957 6:27707594-27707616 GAATACATTTAGAGGAGTGATGG - Intergenic
1005639408 6:27781807-27781829 ATGCCTTTTTAGAAGAGTGAAGG - Intergenic
1006819790 6:36883716-36883738 ATGTCTTTCTAGAAGAGTGAAGG - Intronic
1008261594 6:49372173-49372195 GTATTCTTTTAGTAGAGACAGGG + Intergenic
1010038194 6:71350978-71351000 CTTTCCTTGTAGAAGAGTTAGGG - Intergenic
1011123734 6:83983861-83983883 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1011153247 6:84299077-84299099 GTGCCCATTCAGAAGAGTGAAGG - Intergenic
1012327901 6:97946319-97946341 GAATGATTTTAGTAGAGTGATGG + Intergenic
1012693197 6:102342785-102342807 ATATCCTTTAAAAAAAGTGAAGG - Intergenic
1013094309 6:106930359-106930381 GGATCCTTTTAGAAAAGAGAAGG - Intergenic
1013946837 6:115731622-115731644 GTATCCTTATAAAAGACAGATGG + Intergenic
1015613753 6:135053645-135053667 GTATGCTTTAACTAGAGTGAGGG - Intronic
1016002130 6:139052425-139052447 CTATCCTTTAATAAAAGTGATGG - Intergenic
1016086280 6:139919367-139919389 TTGTACTTTTAGAAGAGAGATGG + Intergenic
1017349905 6:153427775-153427797 GTATCCTCTGAAAAGAGTGTTGG + Intergenic
1018361812 6:163078326-163078348 GTATCCTTTTAGTAGAGAAAGGG - Intronic
1020161580 7:5776724-5776746 GTATTTTTTTAGTAGAGTCAGGG - Intronic
1020647225 7:10829519-10829541 ATGGCCTTCTAGAAGAGTGAAGG - Intergenic
1022257782 7:28676606-28676628 ACATCCTTTTGGGAGAGTGATGG + Intronic
1022434281 7:30364983-30365005 GTATCCTTATAGAAGCTTGAGGG - Intronic
1023192689 7:37599666-37599688 GTTTCCTTTTAGAGTATTGAGGG + Intergenic
1024853434 7:53747745-53747767 CTATCCTCATAGAAGAGTTAGGG - Intergenic
1025784947 7:64635709-64635731 GTGTCTTCTTAGTAGAGTGATGG - Intergenic
1026435165 7:70390324-70390346 GTGTCTTTTTAGAAAGGTGATGG + Intronic
1026646050 7:72169863-72169885 GTATCTTTTTAGTAGAGACAGGG + Intronic
1027707634 7:81554292-81554314 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1028042604 7:86073912-86073934 GAATCCTTCTATAAGAGTGAGGG - Intergenic
1028957463 7:96709812-96709834 GTTTCCTTGAGGAAGAGTGAGGG - Exonic
1029018771 7:97342051-97342073 GTATCTTTTTAGTAGAGACAGGG + Intergenic
1029810797 7:103046421-103046443 ATGTCCTTCTAGAAGAGTGAAGG + Intronic
1030971691 7:116065092-116065114 GTCTCCTTTTCGAAGAGTAGTGG - Intronic
1031085498 7:117298158-117298180 GTGGCCAGTTAGAAGAGTGAGGG + Intronic
1031161200 7:118170701-118170723 GTATCCAATAAGTAGAGTGATGG - Intergenic
1031742511 7:125452683-125452705 GTATCCTCCTAGAACAGTGAAGG + Intergenic
1032041199 7:128563637-128563659 GTATCCTTTTAAAGGCTTGATGG + Intergenic
1032477303 7:132220747-132220769 AGATCCCTTTAGAAGAATGATGG - Intronic
1033072369 7:138215865-138215887 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1033962884 7:146935501-146935523 ATGCCCTTCTAGAAGAGTGAAGG - Intronic
1034520683 7:151617085-151617107 GTATTCTTTTAGTAGAGACAGGG - Intronic
1034693305 7:153031524-153031546 GTATTCTTTTAGTAGAGACAGGG + Intergenic
1037054134 8:14416495-14416517 GTATACAATTAGCAGAGTGAAGG + Intronic
1038903682 8:31873191-31873213 GTATTCTTGTAGAATAGAGATGG + Intronic
1038905157 8:31893372-31893394 TTCTCCTTATAGTAGAGTGAAGG + Intronic
1040089391 8:43381475-43381497 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1041118865 8:54566457-54566479 GTGTCATCTGAGAAGAGTGAAGG + Intergenic
1041319838 8:56601755-56601777 GTGTACTTTTAGTAGAGAGAGGG - Intergenic
1043669468 8:82863892-82863914 TTATTCTTTTAGAAGGGGGAAGG - Intergenic
1044065339 8:87691954-87691976 GCATCATTTTAGCAGAGTGGAGG + Intergenic
1044930071 8:97244033-97244055 ATATCCTTTGAGAAGAGGGTTGG - Intergenic
1045533099 8:103002750-103002772 TAGTCCTTTTACAAGAGTGAGGG - Intergenic
1045851549 8:106704752-106704774 GCATCCTTGTAGAACAGTGATGG - Intronic
1046487144 8:114901550-114901572 ATACCCTTCTAGAAGAGTGAAGG - Intergenic
1050314545 9:4387958-4387980 ATGCCCTTTTAGAAGAGTGAAGG + Intergenic
1050658085 9:7851524-7851546 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1052802170 9:32978936-32978958 ATATGCTTTTAGTAGTGTGATGG - Intronic
1055206363 9:73735534-73735556 TTAACATTTTAGAAGAGAGAAGG + Intergenic
1055685828 9:78773693-78773715 ATCTCTTTTTAGAGGAGTGAGGG - Intergenic
1055970596 9:81908193-81908215 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1058967693 9:110052510-110052532 TTTTCCTTTTAGAATAGAGATGG - Intronic
1058967791 9:110053351-110053373 GTATTCTTTTAGTAGAGGCAGGG - Intronic
1061915068 9:133746134-133746156 GTATTCTTTTAGTAGAGACAGGG + Intergenic
1202802194 9_KI270720v1_random:10091-10113 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1203446753 Un_GL000219v1:63862-63884 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1186345395 X:8686777-8686799 GTATTTTTTTAGTAGAGTGGGGG - Intronic
1186893395 X:13982372-13982394 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1187180244 X:16937082-16937104 CTTTCCTTAGAGAAGAGTGAGGG + Intergenic
1192738483 X:73871286-73871308 GTATTCTTTTAGAAGAGACAGGG + Intergenic
1192913826 X:75633729-75633751 CAATCCTTTTGCAAGAGTGAGGG + Intergenic
1196510874 X:116510681-116510703 GTATTCTTTTAGTAGAGACAGGG + Intergenic
1197500029 X:127230922-127230944 TAGTCCTTTTACAAGAGTGAGGG - Intergenic
1197934465 X:131726602-131726624 ATGCCCTTTGAGAAGAGTGAAGG - Intergenic
1198498521 X:137218747-137218769 ATGTCCTTTTAGAAGAGTGAAGG - Intergenic
1199268079 X:145850408-145850430 GTATCATTTTGGAGTAGTGAGGG + Intergenic
1200734268 Y:6776901-6776923 TTGCCCTTTTAGAATAGTGAAGG + Intergenic
1201433955 Y:13936609-13936631 ATATCTTTTTAGTAGAGTGGGGG - Intergenic
1201712682 Y:17009788-17009810 GTATCTTTATAGCAGTGTGAAGG + Intergenic