ID: 1089529466

View in Genome Browser
Species Human (GRCh38)
Location 11:119116912-119116934
Sequence CTCTGTGAGCAGTGGCTCTG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 345
Summary {0: 1, 1: 0, 2: 0, 3: 40, 4: 304}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089529454_1089529466 26 Left 1089529454 11:119116863-119116885 CCTCATCCCTCCCTCCCCCTTTA 0: 1
1: 0
2: 13
3: 181
4: 1625
Right 1089529466 11:119116912-119116934 CTCTGTGAGCAGTGGCTCTGTGG 0: 1
1: 0
2: 0
3: 40
4: 304
1089529456_1089529466 19 Left 1089529456 11:119116870-119116892 CCTCCCTCCCCCTTTATTACCGT 0: 1
1: 0
2: 1
3: 15
4: 219
Right 1089529466 11:119116912-119116934 CTCTGTGAGCAGTGGCTCTGTGG 0: 1
1: 0
2: 0
3: 40
4: 304
1089529463_1089529466 0 Left 1089529463 11:119116889-119116911 CCGTTTTTTGTACTTGATGCCTT 0: 1
1: 0
2: 3
3: 41
4: 446
Right 1089529466 11:119116912-119116934 CTCTGTGAGCAGTGGCTCTGTGG 0: 1
1: 0
2: 0
3: 40
4: 304
1089529459_1089529466 12 Left 1089529459 11:119116877-119116899 CCCCCTTTATTACCGTTTTTTGT 0: 1
1: 0
2: 3
3: 24
4: 324
Right 1089529466 11:119116912-119116934 CTCTGTGAGCAGTGGCTCTGTGG 0: 1
1: 0
2: 0
3: 40
4: 304
1089529462_1089529466 9 Left 1089529462 11:119116880-119116902 CCTTTATTACCGTTTTTTGTACT 0: 1
1: 0
2: 1
3: 13
4: 204
Right 1089529466 11:119116912-119116934 CTCTGTGAGCAGTGGCTCTGTGG 0: 1
1: 0
2: 0
3: 40
4: 304
1089529460_1089529466 11 Left 1089529460 11:119116878-119116900 CCCCTTTATTACCGTTTTTTGTA 0: 1
1: 0
2: 1
3: 20
4: 282
Right 1089529466 11:119116912-119116934 CTCTGTGAGCAGTGGCTCTGTGG 0: 1
1: 0
2: 0
3: 40
4: 304
1089529461_1089529466 10 Left 1089529461 11:119116879-119116901 CCCTTTATTACCGTTTTTTGTAC 0: 1
1: 0
2: 0
3: 21
4: 212
Right 1089529466 11:119116912-119116934 CTCTGTGAGCAGTGGCTCTGTGG 0: 1
1: 0
2: 0
3: 40
4: 304
1089529458_1089529466 15 Left 1089529458 11:119116874-119116896 CCTCCCCCTTTATTACCGTTTTT 0: 1
1: 0
2: 1
3: 18
4: 234
Right 1089529466 11:119116912-119116934 CTCTGTGAGCAGTGGCTCTGTGG 0: 1
1: 0
2: 0
3: 40
4: 304
1089529457_1089529466 16 Left 1089529457 11:119116873-119116895 CCCTCCCCCTTTATTACCGTTTT 0: 1
1: 0
2: 5
3: 17
4: 205
Right 1089529466 11:119116912-119116934 CTCTGTGAGCAGTGGCTCTGTGG 0: 1
1: 0
2: 0
3: 40
4: 304
1089529455_1089529466 20 Left 1089529455 11:119116869-119116891 CCCTCCCTCCCCCTTTATTACCG 0: 1
1: 0
2: 1
3: 23
4: 266
Right 1089529466 11:119116912-119116934 CTCTGTGAGCAGTGGCTCTGTGG 0: 1
1: 0
2: 0
3: 40
4: 304

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089529466 Original CRISPR CTCTGTGAGCAGTGGCTCTG TGG Exonic
900131044 1:1087391-1087413 CCCAGTGGACAGTGGCTCTGGGG + Intronic
900410216 1:2509226-2509248 CTGTGTGAGCTGCTGCTCTGAGG - Intronic
900708159 1:4093639-4093661 CTCTTTCAGCAGTGTCTCAGGGG + Intergenic
901654840 1:10763228-10763250 CTCTGTGACCAGCGGCTCCATGG + Intronic
902210829 1:14903320-14903342 CGCTTTGAGCAGTGTCCCTGGGG + Intronic
902536282 1:17120736-17120758 GTCTGTGAGCTGTGCCTTTGGGG - Intergenic
903293516 1:22329370-22329392 CACTGTGTGCAGAGGCCCTGGGG - Intergenic
903389651 1:22954874-22954896 CTCTGGGAGCAGTGGGGCTGTGG - Intronic
903775445 1:25790457-25790479 CTCTTTGAGAAGTGGCCCAGAGG - Intergenic
904334373 1:29787355-29787377 CTCAGTGAGGAGGGGCCCTGGGG + Intergenic
904914020 1:33956784-33956806 CTGTGTGAAGAGTGGCTGTGGGG - Intronic
906025129 1:42666958-42666980 CTGTGTGAGCAAAGGCTCAGGGG - Intronic
906371622 1:45258695-45258717 CCCTGAGAGCAGTTGTTCTGGGG + Intronic
907501711 1:54886270-54886292 CTCCGTCAGCAGAGGCTGTGAGG + Intronic
909784127 1:79588598-79588620 CTCTGTGAGTAATGTCCCTGTGG - Intergenic
910208833 1:84774034-84774056 ATCAGTGAGCAGTGGCTGTCGGG + Intergenic
910457577 1:87413851-87413873 TTCTTTGAGCAGTGGCTCTCTGG + Intergenic
911994035 1:104739801-104739823 CTCTGTCAGCCTTGGATCTGTGG - Intergenic
912418398 1:109527348-109527370 CTCTGTGAGCAGAGACCCTGTGG + Intergenic
914096095 1:144545474-144545496 CTCTGTAAGAGGTGACTCTGGGG + Intergenic
914314886 1:146500646-146500668 TTCTTTGAGCAGTGGCTCTCTGG + Intergenic
914499466 1:148232741-148232763 TTCTTTGAGCAGTGGCTCTCTGG - Intergenic
914980950 1:152413973-152413995 CTGTGTGGGCAGCGGCTATGGGG - Intronic
915284166 1:154842322-154842344 CTCTGAGAGCCAGGGCTCTGTGG - Intronic
915507942 1:156369145-156369167 CTCCGTGAGCAGGGCCTCTGTGG + Intergenic
915702296 1:157807374-157807396 TTCTGTGGGCAGGTGCTCTGTGG - Intronic
915928220 1:160040723-160040745 CTCTGAGAACAGAGGCTATGAGG + Exonic
917611420 1:176692614-176692636 CTCTGTCAGCTGTTCCTCTGTGG + Intronic
917620983 1:176795388-176795410 TTCTTTGAGAAATGGCTCTGTGG - Intronic
918355957 1:183706723-183706745 CTCTGCCATCAGGGGCTCTGTGG - Intronic
918753959 1:188311968-188311990 CTCTGTTAGAACTGGCTCTGGGG - Intergenic
919847358 1:201650299-201650321 CTCTGAGGGCAGGGGCTCTCCGG - Intronic
921366085 1:214375493-214375515 CTCTGTTAACAGGGACTCTGAGG + Intronic
922107141 1:222522403-222522425 CTCTGTATGCAGTGCTTCTGTGG - Exonic
922471148 1:225878115-225878137 TTCTGTGAGCAGTGGGAGTGAGG - Intronic
922858811 1:228797946-228797968 CTCTGTGAGCAGAGACTGTCAGG + Intergenic
923084392 1:230691812-230691834 CTCCGTGAGCATGGGCACTGGGG - Intronic
924370324 1:243340919-243340941 CTCTGTGAGCCATTTCTCTGTGG - Intronic
924554999 1:245110759-245110781 CACAGTGGTCAGTGGCTCTGTGG + Intronic
1063280524 10:4624849-4624871 CTTTGTGAGCAGTGGAGGTGGGG - Intergenic
1064268615 10:13845894-13845916 CGCTGAGAGCACAGGCTCTGGGG - Intronic
1065408349 10:25392450-25392472 CTCTGTGGCCAGTGGCTCCTCGG - Intronic
1065850186 10:29781380-29781402 CTCTGGGAGCAGTGGATGTTAGG - Intergenic
1067688037 10:48479538-48479560 CTCAGTGAGCAGGGTCTTTGGGG + Intronic
1069796067 10:71052751-71052773 TACTGTGAGCAGTGGTCCTGGGG - Intergenic
1070744897 10:78927725-78927747 CCCAGTGAGCAGTGGCTCTTTGG + Intergenic
1071277196 10:84066073-84066095 GCCTGTGAGCACTGGCCCTGAGG + Intergenic
1071563086 10:86658135-86658157 CTCTATAAGCAGTGGCTCTTTGG + Exonic
1072639999 10:97204817-97204839 CCCTGTGGGAAGTGGCTGTGGGG - Intronic
1072694204 10:97590935-97590957 CTCTGAGTCCAGGGGCTCTGTGG + Intronic
1072695565 10:97600484-97600506 CTCTGAGGGCAGAGGCCCTGGGG + Intronic
1075216306 10:120539237-120539259 CTCTAACAGCAGTGGCTCTAGGG - Intronic
1075345576 10:121679668-121679690 CTCTGGGAGGAGTGACTGTGTGG + Intergenic
1075595905 10:123728956-123728978 CAGTCTGTGCAGTGGCTCTGAGG - Intronic
1075985292 10:126779864-126779886 CAATGTGAGAAGTGGCTGTGGGG - Intergenic
1076705093 10:132297144-132297166 CTCTGGCTGCTGTGGCTCTGGGG + Intronic
1076874239 10:133208104-133208126 CTCTCTGAGCAGAGGCCATGGGG + Intronic
1077721722 11:4637019-4637041 GTCCCTGAGCAATGGCTCTGAGG - Intergenic
1078155297 11:8794800-8794822 CTCTGTGGGAAGAGGCACTGAGG + Intronic
1078544744 11:12239263-12239285 TCCTGTGAGCATTGCCTCTGCGG + Intronic
1078954971 11:16183057-16183079 CTCTGTGATCAGTGTTTCTAAGG + Intronic
1079159235 11:17976970-17976992 CTCAGGGAGCTGAGGCTCTGTGG + Intronic
1080424916 11:32146538-32146560 CTCGGTGAGGATTGGCTCTTGGG - Intergenic
1083353435 11:62047488-62047510 CTGGGTGAGCAGAGGCTCTCTGG - Intergenic
1083603460 11:63962648-63962670 ATGTGTAAGCAGTGGGTCTGGGG + Intergenic
1083627438 11:64078797-64078819 CTCTCTGAGCAGGGGGTGTGGGG + Intronic
1083762873 11:64828181-64828203 CTTCGTGAGCAATGGCTCTTTGG - Intronic
1084062879 11:66687367-66687389 CTATCTGGGCAGAGGCTCTGGGG + Intronic
1084093257 11:66893290-66893312 CTCTGTCAGGAGTGGCTCTTAGG - Intronic
1084302256 11:68259411-68259433 CTGTGTGAGCTGTGGCTTGGGGG - Intergenic
1084429003 11:69101102-69101124 CTCTGTGGGCACAGGCACTGTGG + Intergenic
1084780034 11:71401956-71401978 CCCAGTGAGCAGTGGCTGGGAGG + Intergenic
1085024072 11:73226464-73226486 CTCAGTAAGCAGTGGCCCAGAGG + Intronic
1089061049 11:115626343-115626365 CCCTGGGATCAGTGGCTATGGGG + Intergenic
1089529466 11:119116912-119116934 CTCTGTGAGCAGTGGCTCTGTGG + Exonic
1091080099 11:132658414-132658436 CACTGTGGCCAGTGTCTCTGGGG - Intronic
1091593559 12:1859758-1859780 GTCTCTGAGAAGAGGCTCTGAGG - Intronic
1091807738 12:3367754-3367776 CTCTGGAAGCTGTGGCTCTGGGG - Intergenic
1093761370 12:22915137-22915159 CTTTGTGATCAGAGTCTCTGTGG + Intergenic
1096587045 12:52629516-52629538 CTCTGTAGGCATTGGCTGTGTGG - Intergenic
1098911326 12:76211985-76212007 CTCTGGGGCCAGTGGCCCTGAGG + Intergenic
1099242189 12:80151326-80151348 CTGTTTGAGCTGTGACTCTGCGG - Intergenic
1100126107 12:91427633-91427655 CTTTGTGAGTGGTTGCTCTGGGG - Intergenic
1100818113 12:98405315-98405337 CTCCTTGGGCAGTGGCTCAGTGG - Intergenic
1101511572 12:105397733-105397755 CTCTTTGAGCATTTTCTCTGGGG + Intergenic
1102438533 12:112944210-112944232 CTCTTTGAGCTGTTGCTCTAGGG + Intronic
1103155806 12:118684005-118684027 CTCTGTGAACAGTGCCTCTCTGG + Intergenic
1103322974 12:120102432-120102454 CCCTGTGAGCGAGGGCTCTGTGG - Intronic
1104071578 12:125350302-125350324 CTCTCTGACCAGTAGCTCTGTGG + Exonic
1104590461 12:130080631-130080653 ACGTGTGAGCAGTGGCTCAGTGG + Intergenic
1104606872 12:130196014-130196036 CTGTGTGGACTGTGGCTCTGAGG - Intergenic
1104658247 12:130590356-130590378 CTCTTTGTGCTGTGGCCCTGGGG - Intronic
1105472643 13:20706114-20706136 CCCCGTGGGCAGGGGCTCTGAGG - Intronic
1108487367 13:50940579-50940601 CAGTGTGAGCACTGGCTCTGAGG + Intronic
1112388650 13:98962985-98963007 CTCTGTGAGCAGTGTCCCATGGG - Intronic
1113893683 13:113749622-113749644 CTGTGTGAGCGGGGCCTCTGGGG - Intergenic
1114178526 14:20345122-20345144 CTCTGGTAGGAGTGGATCTGGGG + Exonic
1114472956 14:22976303-22976325 CACTGTAAACAGTTGCTCTGGGG + Intronic
1115949789 14:38708121-38708143 CTCTTGGAGCAGTGGCACTAAGG + Intergenic
1116936310 14:50744160-50744182 CTCTGTGGACAGTGGCACAGGGG - Intronic
1116956876 14:50932991-50933013 CTCTTTGAGCTGTGGCTCTTCGG + Intronic
1117047014 14:51823377-51823399 CTCTGAGAGAAGAGGCTCTTGGG - Intergenic
1117049889 14:51849279-51849301 CTCCTTGAGCATTTGCTCTGGGG - Intronic
1117116573 14:52519744-52519766 AACTGTGTGCAGAGGCTCTGAGG - Intronic
1118444477 14:65838915-65838937 CTCTGCCTGCAGTGGCTTTGGGG + Intergenic
1118766471 14:68912888-68912910 TTCTGTGAGCTGGGGCTCTCTGG + Intronic
1119558538 14:75571667-75571689 CTCTGTGAGGTGTGGCAGTGGGG + Intergenic
1119619883 14:76124140-76124162 CTCTGTTCCCACTGGCTCTGGGG - Intergenic
1121032955 14:90675022-90675044 CTCTGCAAGCTGTGGCTCCGGGG - Intronic
1121189437 14:92012637-92012659 CTCTGTGTGGAGTGTCTCTATGG - Intronic
1122600283 14:102917920-102917942 CCCTGCGCTCAGTGGCTCTGTGG - Intergenic
1124351320 15:28957686-28957708 CCTGGTGAGCAGGGGCTCTGTGG + Intronic
1124417711 15:29487398-29487420 ATCTGTATGGAGTGGCTCTGTGG - Intronic
1124496326 15:30189665-30189687 AGCTGTGAGCAGTGGCCATGGGG - Intergenic
1124561068 15:30774002-30774024 CTCTCTGATCACTTGCTCTGAGG - Intergenic
1124747248 15:32348980-32349002 AGCTGTGAGCAGTGGCCATGGGG + Intergenic
1125034258 15:35105989-35106011 CTTTGTGTGCATTGGCACTGTGG + Intergenic
1125356025 15:38818150-38818172 TTCTCTGAGCACAGGCTCTGGGG - Intergenic
1125404293 15:39336718-39336740 CTCCATGGGCAGTGGCTCTTGGG - Intergenic
1125492434 15:40158261-40158283 CCCTGTGTGCAGCGGCCCTGGGG - Intergenic
1125729198 15:41883274-41883296 CCCTCTGAGCACTGGCACTGGGG + Intronic
1127599366 15:60519954-60519976 TTCTTTGAGCAGTGGCACTGTGG + Intronic
1127848194 15:62889977-62889999 CTGTGTGAGCAGAGGCTTGGAGG + Intergenic
1128725109 15:69982375-69982397 GTCTGAGTGCCGTGGCTCTGGGG - Intergenic
1132074951 15:98812179-98812201 CTCTGGGAGCCATGGCTCTTGGG + Intronic
1132220076 15:100098832-100098854 CTCTGTGGGCATTGGCCCTGTGG - Intronic
1132396037 15:101475049-101475071 CTTTGTGACCAGTGGCGCTAGGG - Intronic
1133284618 16:4684817-4684839 CTCCCTAAGCAGTGGCTCTGGGG - Intronic
1133775805 16:8894280-8894302 TTGTGAGGGCAGTGGCTCTGAGG - Intronic
1133928228 16:10211143-10211165 GCCTGTGAGCTGTGGCTCCGAGG - Intergenic
1134826011 16:17285031-17285053 ATCTGTGAGCAGTGGGTGAGTGG - Intronic
1135536135 16:23296000-23296022 CTGTGTGATCTGGGGCTCTGCGG + Intronic
1135721616 16:24822684-24822706 CTCTGGGAGCAGTGGAGGTGGGG + Intronic
1136580951 16:31150374-31150396 CTTGGTGAGCAGTGGCCCTTAGG + Intergenic
1138022281 16:53495525-53495547 CTCTGTGAGCTGCTGCTATGAGG - Intronic
1138374038 16:56550362-56550384 TTCTGTGAGAAGTGGCTCCTAGG + Intergenic
1138652359 16:58467992-58468014 CTCTCTGAGCTGTGTCTCTGGGG + Intronic
1138939500 16:61773549-61773571 CTCTGTGAGTTTTGGCTTTGTGG + Intronic
1140819698 16:78651608-78651630 CTGTGTGAGCAATAGCACTGAGG - Intronic
1141484144 16:84327883-84327905 CCCTGAGGGCAGCGGCTCTGTGG - Intronic
1142395983 16:89831836-89831858 CCCTTAGAGCACTGGCTCTGGGG + Intronic
1144643219 17:16950812-16950834 CACTATGAGCAGAGGCTCAGAGG - Intronic
1144662497 17:17080310-17080332 CACTCTGGGGAGTGGCTCTGAGG - Intronic
1144773320 17:17771434-17771456 ATCCTTTAGCAGTGGCTCTGAGG + Intronic
1145254676 17:21316125-21316147 GTCTGAGAGCAGGGTCTCTGTGG + Intergenic
1145321921 17:21771840-21771862 GTCTGAGAGCAGGGTCTCTGTGG - Intergenic
1147040743 17:37716722-37716744 CTCTATGAGCTGTAGCTCTAAGG - Intronic
1147946759 17:44084736-44084758 CTCTGTGTGCCCTGGCTATGGGG - Intronic
1149334901 17:55625694-55625716 CTGTGTGAGAAGTGAATCTGTGG - Intergenic
1151251336 17:72837932-72837954 CTCTTTGAGCAGTACCTCTGAGG - Intronic
1151682587 17:75629689-75629711 CTCGGTGAGCTGTGGCCCAGTGG - Exonic
1153663787 18:7350118-7350140 CTCCATGAGCAATAGCTCTGGGG + Intergenic
1153891292 18:9517957-9517979 CTCTCTAAGCAGAGGCTCAGTGG + Intronic
1155087873 18:22475218-22475240 CTCTCTGTGCTGTGGCCCTGAGG + Intergenic
1155447738 18:25929628-25929650 CTTTGTGAGCTGTGGCATTGGGG - Intergenic
1157500134 18:48184674-48184696 CTGCGTGAGAAGTGGCTCTGGGG + Intronic
1158360477 18:56666550-56666572 GTCTGTGATCAGTGGCTCCTGGG - Intronic
1158471652 18:57742516-57742538 CTTTGTGAGAAAGGGCTCTGGGG - Intronic
1159219075 18:65436616-65436638 CAGTGTGAGAGGTGGCTCTGAGG - Intergenic
1160212781 18:76896502-76896524 CCCTGTGGGCAGTGCCTGTGTGG - Intronic
1160446009 18:78927312-78927334 CCGGGTGAGCAGGGGCTCTGAGG + Intergenic
1160810470 19:1010939-1010961 CTCTGGGAGCAGCGGCTGGGTGG - Intronic
1161658292 19:5529631-5529653 GTGTTTGAGCAGTGGCTCTGTGG + Intergenic
1162377317 19:10312379-10312401 CTCTGTGATCAGAGGATGTGGGG - Intronic
1162679718 19:12331694-12331716 CTCTGGGAGGAGTGGCCCAGGGG + Intronic
1163403093 19:17106312-17106334 CTGTGTGAGCATTTGCTGTGTGG + Intronic
1163493875 19:17633315-17633337 GTCAGTCAGCAGTGGCTATGAGG - Intronic
1164608674 19:29617813-29617835 CTCTTTGAGCAGTGGGTCGCTGG - Intergenic
1164733192 19:30521124-30521146 CTCTGCTAGCACTGGCTCTGTGG - Intronic
1165091846 19:33391891-33391913 CTCTGTGGGCTCTGGCCCTGAGG + Intronic
1167296270 19:48652009-48652031 CTCTGTGTGCAGTGAGGCTGGGG - Intergenic
1167561158 19:50226807-50226829 CTCTGGGAGCAGTGGGTGTGGGG + Intronic
925258783 2:2511926-2511948 CTCTGAGAGCAGAGGGGCTGTGG + Intergenic
925337241 2:3107438-3107460 CTTTATTAGCAGTGGCACTGAGG + Intergenic
925483670 2:4304295-4304317 TTCTGGGAGCAGTGCCTCTAGGG + Intergenic
926817165 2:16810390-16810412 TTCTGGGAGCAGTAGCTGTGTGG - Intergenic
927276729 2:21268299-21268321 CTCGGTGAGCACTGGTCCTGAGG + Intergenic
927835560 2:26395501-26395523 CTCTGGGAGCAGTTGTGCTGCGG + Exonic
928381307 2:30821173-30821195 TTCTGTGAGCACGGACTCTGGGG + Intergenic
929548726 2:42875401-42875423 CTTTGTGAGCAGTGGCTGCTGGG + Intergenic
929872088 2:45767684-45767706 CACTGTCAGCAGTGCTTCTGTGG + Intronic
931970029 2:67575952-67575974 CTCTGTGATCTTTGGCTTTGTGG + Intergenic
932781848 2:74563713-74563735 TTCTGGGGGCAGTGCCTCTGTGG + Intronic
933806053 2:85998584-85998606 GGCTGGGAGCAGTGGCTGTGTGG + Intergenic
934713007 2:96527738-96527760 CCCTGTGGGCACTGGCTCCGGGG - Intergenic
935477350 2:103538536-103538558 TTCTGTGAGTGGAGGCTCTGAGG + Intergenic
935660945 2:105466409-105466431 CACCGTGAGCAGGGTCTCTGGGG - Intergenic
936145782 2:109979985-109980007 CTCTCTGAACCCTGGCTCTGGGG + Intergenic
936198907 2:110391493-110391515 CTCTCTGAACCCTGGCTCTGGGG - Intergenic
936341339 2:111635229-111635251 TTCTGGGAGCAGTGGCTCCCTGG - Intergenic
936429776 2:112452242-112452264 CTCTCTGACCACTTGCTCTGGGG - Intergenic
938061474 2:128258430-128258452 CGCTGTGTGCAGTGGGGCTGTGG + Intronic
938917785 2:135960750-135960772 TTGTGTGTGCAGTGGCTCTAAGG - Intronic
939282509 2:140082663-140082685 CTCTGTGATGACTGACTCTGAGG - Intergenic
940375402 2:152952455-152952477 CTGCGTGAGGAGTGGGTCTGAGG - Intergenic
940856357 2:158731377-158731399 CCCTTTGTGCTGTGGCTCTGGGG - Intergenic
940987728 2:160064989-160065011 CTCTGGGAGCTGTGGGTGTGTGG + Intergenic
942219858 2:173758348-173758370 CTGTGTTAGCAGAGGGTCTGAGG + Intergenic
942317900 2:174711363-174711385 CTCTGTGAGAACTGGTTCTCAGG + Intergenic
947517924 2:230823342-230823364 GTGTGTGAGCAGTGTTTCTGGGG - Intergenic
947960194 2:234229917-234229939 CCCTGAGGGCAGTGGATCTGTGG + Intergenic
948285922 2:236785161-236785183 CTCTTGGATCACTGGCTCTGGGG + Intergenic
948542613 2:238701337-238701359 CCCTGGGAGCAGTTTCTCTGTGG + Intergenic
948928141 2:241112777-241112799 GTCTTTGAGCTGTGGCTTTGTGG - Intronic
1169194854 20:3677549-3677571 CTCAGGTAGCAGAGGCTCTGAGG - Intronic
1169197728 20:3692502-3692524 CTCTGTGAGCAGAGGGTCCTTGG - Exonic
1170113757 20:12834470-12834492 CATTGTGATCAGAGGCTCTGGGG + Intergenic
1170461563 20:16581578-16581600 CTCTGGGCACAGTGCCTCTGGGG - Intergenic
1171981556 20:31632717-31632739 CTGTGGGAGCGGAGGCTCTGCGG - Intergenic
1172254659 20:33506779-33506801 CTAAGTGCTCAGTGGCTCTGGGG - Intronic
1174079295 20:47959670-47959692 TCCTGGGAGCAGTTGCTCTGTGG + Intergenic
1174093222 20:48066725-48066747 CTCTGGAAGCAGAGGCTCAGGGG + Intergenic
1174146413 20:48455522-48455544 CTCTGGGGACAGTGGGTCTGGGG + Intergenic
1174982261 20:55409070-55409092 ATCTCTCAGCAGTGGCTATGTGG - Intergenic
1175085222 20:56452613-56452635 CTATGTGATCAGTGGACCTGTGG - Exonic
1178473299 21:32914367-32914389 CTCTGTGAGAATTGACTGTGAGG - Intergenic
1178888921 21:36504857-36504879 CTCTGGGAGCAGTGACTCATGGG - Intronic
1179587542 21:42383291-42383313 CTCTGGGAGCAGGGGCAGTGAGG - Intronic
1179798336 21:43798638-43798660 CTCTGTGTGCAGTGTGTGTGAGG + Intronic
1179819342 21:43927671-43927693 CTGTGGGAGCAGTGACTTTGTGG + Intronic
1180138760 21:45878142-45878164 CTGTGGCAGCAGTGGCTTTGAGG + Intronic
1180228380 21:46411929-46411951 GTGTGTGAGCTGTGGCTCTGCGG - Exonic
1180949910 22:19716243-19716265 CTGGGTGACCAGTGGGTCTGGGG + Intronic
1181522984 22:23460000-23460022 CTCAGTGAAGAGTGGCACTGGGG + Intergenic
1182185489 22:28397409-28397431 CTTTGTGAGCACTAGCTTTGTGG - Intronic
1182275979 22:29188942-29188964 CTGTCTGAGCAGAGGCCCTGAGG + Intergenic
1182984194 22:34701032-34701054 CACTGCCAGCAATGGCTCTGCGG - Intergenic
1184111791 22:42399762-42399784 CACTGTCAGCAGTGGCCGTGTGG - Intronic
1184188301 22:42878856-42878878 CTCTGTGGGCCGTGGCCCAGGGG - Intronic
1184679458 22:46062184-46062206 CCCCGGGAGCAGTGTCTCTGCGG - Intronic
1185045587 22:48527165-48527187 CTCTGGAGGCTGTGGCTCTGGGG + Intronic
1185195473 22:49466705-49466727 TTCGGGGAGCAGAGGCTCTGAGG - Intronic
949928404 3:9059611-9059633 CACTGTGAGCGGTGGTGCTGGGG - Intronic
950474643 3:13207651-13207673 CCCTGGGTGCAGAGGCTCTGGGG - Intergenic
950631170 3:14283171-14283193 AGCTGTGGGCAGTGGCACTGGGG + Intergenic
950820481 3:15753070-15753092 CTCTGTGGGCAGTGGCAGTGAGG + Intronic
952741991 3:36742876-36742898 CTCTGTGTGCAGTTGTCCTGGGG - Intergenic
952766688 3:36960450-36960472 CACCGTGACCAGTGGTTCTGTGG - Intergenic
954473560 3:50721926-50721948 CTCTGTGACTAGGGGCTCTGGGG - Intronic
956601976 3:71032278-71032300 CTGTCTGTGCAGTGGCACTGAGG + Intronic
956820383 3:72948869-72948891 CTCTGTGAGGAGTGGATTGGAGG + Intronic
956877352 3:73476674-73476696 CTCTTTGATCATTTGCTCTGGGG + Intronic
957040985 3:75335411-75335433 CTCTTTGATCACTAGCTCTGGGG + Intergenic
957277962 3:78113238-78113260 CTCAGTGTTCTGTGGCTCTGGGG + Intergenic
959609744 3:108279904-108279926 CCTTGTGAACTGTGGCTCTGAGG - Intergenic
962454969 3:135556664-135556686 CTCTGTGGACAGTGGTCCTGAGG + Intergenic
964668975 3:159204508-159204530 CTTTTGGAGCACTGGCTCTGGGG - Intronic
965825544 3:172725768-172725790 CGCTGTTCGCAGAGGCTCTGTGG + Intergenic
966879940 3:184344587-184344609 GTCTGTGAGCAGTCGCTCTCAGG - Exonic
969052733 4:4384960-4384982 TGCTGGGAGCAGTGGCCCTGTGG - Intronic
969302645 4:6306261-6306283 CTCTGTCAGCTGTGTCTCTCTGG - Intergenic
969798388 4:9543505-9543527 CCCTGTTAGCAGGGGCTGTGGGG - Intergenic
969940874 4:10730090-10730112 CTGTGTTGGCAGTGGCTGTGGGG + Intergenic
970875178 4:20861009-20861031 CTTTGTGAGCAGTGGAACCGAGG - Intronic
970981485 4:22103814-22103836 CTCTGGGAGCCTTGGCTCTGAGG + Intergenic
975199245 4:71565902-71565924 CTCTTTTATCACTGGCTCTGAGG - Intronic
977034583 4:91933665-91933687 CTCTATGAGTAGTGTGTCTGAGG - Intergenic
977083122 4:92558854-92558876 ATCTGAGATCAGTTGCTCTGAGG - Intronic
977819741 4:101458166-101458188 CTCTGGGAGCACTGTCTCAGGGG - Intronic
978981795 4:114956248-114956270 ATCTCTGAGCAGTGGCACAGAGG + Intronic
979000685 4:115214485-115214507 CTGTGTGGGCAGAGGCTGTGAGG - Intergenic
985531504 5:436327-436349 CTCTGTTGTCAGTGGCTTTGAGG + Exonic
985561495 5:588829-588851 TTCTGTGAGCAGCAGCTCTGGGG + Intergenic
985650341 5:1104640-1104662 CTCTGTGGGGAGTGGTCCTGGGG - Intronic
985803172 5:2019449-2019471 CTCCTTGAGCATTGTCTCTGGGG + Intergenic
985835026 5:2264112-2264134 CTCGGGGAGCAGTGACCCTGTGG + Intergenic
986758200 5:10857069-10857091 CTCTGTGATCAGTTGTTTTGTGG + Intergenic
987412267 5:17626143-17626165 CTCACTGATCAGTGGGTCTGAGG + Intergenic
990588064 5:57231551-57231573 CTCAGTGCGCAGTGGCACAGTGG - Intronic
994002084 5:94792285-94792307 CTCTGTGAGTACTGGCTTTGCGG + Intronic
994193311 5:96893586-96893608 CTCTGTGAGCTCTACCTCTGAGG + Intronic
998159854 5:139807246-139807268 CTGGATGAGCATTGGCTCTGGGG - Intronic
999119148 5:149195572-149195594 CACTGGGAGAGGTGGCTCTGGGG + Intronic
999144895 5:149385863-149385885 CTCTGCCAGGAGCGGCTCTGGGG - Intronic
1001886310 5:175293531-175293553 CTCTGTGCCCAGGGGTTCTGAGG - Intergenic
1002076486 5:176711739-176711761 CCCTTTGAGCAGGGGATCTGGGG + Intergenic
1002961164 6:1916008-1916030 CTGCGTGAGCAGTGGCTGGGCGG - Intronic
1003260587 6:4512086-4512108 GTCTGTGCTCAGTGGCTCTGGGG - Intergenic
1005580215 6:27227045-27227067 CTCTGTGATCAGGGTCTCTGAGG - Intergenic
1006564160 6:34939942-34939964 CATTGTGGGCAGTGGCTTTGGGG + Intronic
1007174241 6:39885342-39885364 CTCTTTGAGCACTGGCTCCTGGG + Intronic
1007589182 6:43011302-43011324 CTGTGTGGGCTGTGGCCCTGTGG - Exonic
1011684787 6:89815498-89815520 CTTTGTTAGCAGTGGCCCAGGGG - Intronic
1015870761 6:137774188-137774210 CTCTGGCAGCACTGGCTTTGAGG - Intergenic
1016391502 6:143579967-143579989 TTCTGTGAGCTGTGGGACTGGGG + Intronic
1018133786 6:160757945-160757967 CTAGGTGAGCACTGGCCCTGGGG - Intergenic
1018255971 6:161919721-161919743 CACTGTGAGCATTTGCTCTGTGG - Intronic
1019021929 6:168926185-168926207 ATCTGTGAGCACTGTCTCTCAGG + Intergenic
1019156794 6:170044700-170044722 TACTGTGAGCACAGGCTCTGTGG - Intergenic
1019388708 7:773511-773533 CTCTCTGAGCTGTGGCCCTTGGG + Intronic
1019716256 7:2540843-2540865 CTCTCTGAGCAGCAGCTCTGTGG + Intronic
1019729266 7:2621535-2621557 CTCTGTGAGGACTGGATCTTTGG + Intergenic
1020108725 7:5435720-5435742 TCCTGTGAGCAGAGGCACTGGGG - Intronic
1021094311 7:16517994-16518016 CTCTGTTAGCAGTGGCATTCAGG - Intronic
1023619508 7:42055478-42055500 CTCTGCTAGCTGTGGCTCTGTGG + Intronic
1024276796 7:47684022-47684044 CACTGTGAGAAGTGGAGCTGGGG - Intergenic
1024369340 7:48562066-48562088 CTCTGTGAGCCGGGGTTCAGAGG + Intronic
1024386486 7:48757753-48757775 ATCTGTGAGCTGTGCATCTGTGG - Intergenic
1024617837 7:51130492-51130514 CTCTGTGAGCTGTGGTGTTGAGG - Intronic
1024895759 7:54259661-54259683 CTCTGCGTGCAGTGCCACTGTGG - Intergenic
1024934501 7:54698824-54698846 CTCTATCAGCAGAGGCTCTCAGG + Intergenic
1025018937 7:55465518-55465540 ATCTGTGAGGAGTCGGTCTGTGG - Intronic
1026437908 7:70416013-70416035 CTGTGGTAACAGTGGCTCTGTGG + Intronic
1028103227 7:86847010-86847032 CCCTGTGAGAAGTGGCACTCAGG - Intronic
1029408261 7:100390844-100390866 CTCTGGGATCAGAGGCTCTTGGG - Intronic
1033511604 7:142065260-142065282 CTCTGGGAGCAGAAGCTCTATGG + Intronic
1033514674 7:142094289-142094311 CTCTGGGAGCAGATGCTCTATGG + Intronic
1033583677 7:142758850-142758872 GTCTCTGAGCAGTGGGTCTCCGG + Intronic
1034673084 7:152872174-152872196 GTCTCTCAGCGGTGGCTCTGGGG + Intergenic
1034761402 7:153675334-153675356 CTGTGTGAACAGGGGGTCTGGGG - Intergenic
1035348661 7:158227070-158227092 CTCTCTGATGAGTAGCTCTGAGG - Intronic
1035554593 8:556786-556808 CTCTGTAAGCATTGGCTCTTTGG + Intergenic
1035943962 8:3938438-3938460 GTCTTTGTGCAGTGGATCTGTGG + Intronic
1036744115 8:11391819-11391841 TTCTGTGAGCTGTGGCTGTCAGG - Intronic
1038133396 8:24759032-24759054 CTATGTCAGCTGTGGCACTGAGG - Intergenic
1042871146 8:73400823-73400845 CTCCGTGTGCAGTGGTTGTGTGG - Intergenic
1044186173 8:89254295-89254317 CTCTGTAACCAGTCTCTCTGAGG + Intergenic
1044525189 8:93242883-93242905 CTCTGTTAGCAGTCCCTCTGAGG + Intergenic
1045290024 8:100825078-100825100 CTCTAAGGGCAGTGGCTCTTGGG + Intergenic
1046787254 8:118281358-118281380 TTCCGTGTGCAGTGGCTCCGAGG + Intronic
1046983032 8:120357402-120357424 CTCTTGGATCAGTGGCTCTGAGG - Intronic
1047533596 8:125699025-125699047 CTCTGTGGTCTGTGGCACTGTGG + Intergenic
1048311865 8:133328980-133329002 ACCTGTGAGCAGAGACTCTGAGG + Intergenic
1049184278 8:141241201-141241223 TGCGGTGAGCAGTGGCTCTGCGG + Intronic
1049216673 8:141411464-141411486 CGCCGTGTGCACTGGCTCTGGGG + Intronic
1050472815 9:6009737-6009759 TTCTGTGAGCTGAGGTTCTGTGG - Intergenic
1053445455 9:38149860-38149882 CTCTGCAATCACTGGCTCTGTGG + Intergenic
1057785013 9:98080883-98080905 CTGTGGCCGCAGTGGCTCTGGGG + Exonic
1057900207 9:98942868-98942890 CACAGTGGGCCGTGGCTCTGTGG - Intergenic
1058561004 9:106229154-106229176 CTGTGTGGGTAGTGGCTTTGGGG - Intergenic
1061285091 9:129618039-129618061 CTGTGTGAGGAATGGTTCTGAGG + Intronic
1061887722 9:133601051-133601073 CTCTGGGAGCAGGGCCTCAGAGG + Intergenic
1062303745 9:135890236-135890258 TTGTGTGTGCAGAGGCTCTGTGG - Intronic
1062408176 9:136407791-136407813 CACTGTGGGCGATGGCTCTGTGG - Intronic
1062454326 9:136628614-136628636 CTCAGTGAGCAGGGGTGCTGAGG + Intergenic
1187379155 X:18784793-18784815 CTCTGAGACAAGTGGCTATGTGG + Intronic
1189427226 X:40912357-40912379 AGCTGCCAGCAGTGGCTCTGGGG - Intergenic
1189488115 X:41447975-41447997 CTCTTTGGGCAGAAGCTCTGTGG - Intronic
1190532436 X:51393236-51393258 TTGTGTGAGCAATGGCTCAGAGG - Intergenic
1191611366 X:63117633-63117655 TTCTGTTAGCAGTGTCTCAGAGG - Intergenic
1192244246 X:69359867-69359889 CTCGGTCAGGAGAGGCTCTGAGG - Intergenic
1192630726 X:72776382-72776404 CTTTATGATCAGTGGATCTGGGG - Intergenic
1192650984 X:72944422-72944444 CTTTATGATCAGTGGATCTGGGG + Intergenic
1196155907 X:112430050-112430072 CTCTGAGATCACTGGATCTGTGG + Intergenic
1201621721 Y:15966361-15966383 GTCTGTAAACAGTTGCTCTGGGG - Intergenic