ID: 1089534108

View in Genome Browser
Species Human (GRCh38)
Location 11:119150021-119150043
Sequence GTCCTCCAGCGTCACGGCCA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 117}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089534108_1089534118 17 Left 1089534108 11:119150021-119150043 CCATGGCCGTGACGCTGGAGGAC 0: 1
1: 0
2: 0
3: 10
4: 117
Right 1089534118 11:119150061-119150083 GCTGACCACGCACCTGAAGAAGG 0: 1
1: 0
2: 0
3: 5
4: 96
1089534108_1089534119 20 Left 1089534108 11:119150021-119150043 CCATGGCCGTGACGCTGGAGGAC 0: 1
1: 0
2: 0
3: 10
4: 117
Right 1089534119 11:119150064-119150086 GACCACGCACCTGAAGAAGGTGG 0: 1
1: 0
2: 0
3: 4
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089534108 Original CRISPR GTCCTCCAGCGTCACGGCCA TGG (reversed) Exonic
904049665 1:27631699-27631721 GTCCCACACCGTCACTGCCACGG - Intronic
905403406 1:37718385-37718407 GTGCTCCAGCTGCAGGGCCAGGG - Exonic
915092854 1:153438720-153438742 CTCCTCCAGCTTCACAGCCAGGG + Intronic
915285323 1:154848557-154848579 CTCCACCAGCTTCACGGGCAGGG + Intronic
920033990 1:203053910-203053932 CTCCTGCAGCATCATGGCCAGGG - Exonic
1063377955 10:5565380-5565402 GTCCTCCAGCATCACTCCCAGGG + Intergenic
1063499400 10:6539284-6539306 GTCCTCCAGCCCCCAGGCCATGG + Intronic
1071555335 10:86597288-86597310 GTCTTCCAGCCTCAAGGCGAGGG - Intergenic
1071942262 10:90602994-90603016 GTCCTCCATTGTCATGGCCATGG - Intergenic
1075082927 10:119395933-119395955 GTTCTCCTGCGTCACTGCCCTGG + Intronic
1076771931 10:132670524-132670546 GTCCTCCTGCTTCTGGGCCAGGG - Intronic
1079099824 11:17534173-17534195 CTCCTCCAGCCTCCCGGCCCAGG + Intronic
1081439654 11:43066037-43066059 GCCCCCCAGCGCCACTGCCATGG - Intergenic
1083852585 11:65376894-65376916 GTCCCTCAGCGTCAGGGCCCAGG + Exonic
1084780933 11:71407769-71407791 CTCCCCCAGCCTCACCGCCATGG - Intergenic
1089534108 11:119150021-119150043 GTCCTCCAGCGTCACGGCCATGG - Exonic
1094647232 12:32337612-32337634 GTCCTCCAGCCTCTGGGTCAGGG - Exonic
1100656442 12:96650836-96650858 GGCCTCCAGCTTCAGGGCCCTGG + Intronic
1103975779 12:124701603-124701625 ATCCTCCAGGGTCAAAGCCAAGG + Intergenic
1104012343 12:124940637-124940659 TTCCTCCAGCCTCAGGGCCTTGG - Intergenic
1105705544 13:22965688-22965710 ATCCCCCAGCGCCACGGACATGG - Intergenic
1105858446 13:24390673-24390695 CTCCCCCAGCGCCACGGACATGG - Intergenic
1111654287 13:91132604-91132626 GTCCTCAAGCCCCAGGGCCACGG - Intergenic
1112280195 13:98056181-98056203 GTCCTCCAGCTTCACTGAGAGGG + Intergenic
1113602475 13:111580095-111580117 GTCCTTCAGGGTCACTGCAATGG - Intergenic
1113767294 13:112889323-112889345 GTCCTCCAGTGTCCCAGCAAAGG + Intergenic
1119296532 14:73537723-73537745 CACCTCCAGCTCCACGGCCAAGG - Exonic
1119300776 14:73569728-73569750 CACCTCCAGCTCCACGGCCAAGG - Exonic
1122199599 14:100114426-100114448 GTCCTCCAGGGCCAGGGCCCTGG + Intronic
1125474669 15:40038994-40039016 GTCCTGCCGCGTCAAGGCCCTGG + Intronic
1128404554 15:67322589-67322611 CACCTCCAGCGTCAGGGCCCAGG - Intronic
1132893139 16:2214373-2214395 GGCCTCCAGCTCCGCGGCCAGGG + Exonic
1133119339 16:3596595-3596617 CTCCTCCTCTGTCACGGCCAAGG + Intronic
1135133597 16:19872012-19872034 GGCCGCCAGCGTGATGGCCAAGG + Exonic
1136284910 16:29234995-29235017 GTCCTCCTGCGTTCTGGCCAAGG - Intergenic
1136297934 16:29314240-29314262 GGCCTCCAGCTTCACATCCAAGG - Intergenic
1136497491 16:30653054-30653076 GTCTTCCAGCATCACCACCAGGG - Exonic
1136683151 16:31979386-31979408 GTCCTCTAACGTCCAGGCCACGG - Intergenic
1137554303 16:49460996-49461018 GTCCTCCAGCCTCACGATCCTGG - Intergenic
1138224845 16:55284109-55284131 GACCTCAAGCGTTACAGCCAGGG - Intergenic
1140723107 16:77788670-77788692 GCCCTCGAGCGCCATGGCCAAGG + Exonic
1141423856 16:83933220-83933242 GGGCTCCAGGGTCACAGCCAAGG + Intronic
1142059580 16:88020745-88020767 GGCCTCCAGCTTCACATCCAAGG - Intronic
1142374895 16:89701721-89701743 CGCCCCCAGCGTCACGGCCGCGG - Intergenic
1142425628 16:90000869-90000891 GTCCTCCAGCGGGAGGGCCCAGG - Intergenic
1144733970 17:17544633-17544655 GTCCTCAAGTGTGACGGGCAGGG + Intronic
1150295337 17:64004408-64004430 GTTCTCCAGGGTCAGGGCCATGG + Intronic
1151778598 17:76226641-76226663 GTTCTCCAGCGACAAGGCTAAGG - Intronic
1152662803 17:81550828-81550850 GTCCTCCAGCGTGAAGCCCCCGG + Exonic
1161964372 19:7540201-7540223 GTCTTCCAGCGGCTGGGCCAGGG + Exonic
1162756746 19:12865349-12865371 GTCATCCTGCGTCAAGGCTACGG + Exonic
1167569121 19:50276053-50276075 GTCCTCCTGGGCCTCGGCCAGGG - Exonic
1168419375 19:56191236-56191258 TTCTTCCAGCGTCAGGGGCAGGG - Intronic
1168490207 19:56802787-56802809 ATCCTCCAGCTTCATGGCTAGGG - Intronic
925273832 2:2635199-2635221 GTCCTCCAAGGTCACAGTCAAGG + Intergenic
925731781 2:6924285-6924307 GCCCCCCAGCAACACGGCCACGG - Intronic
928361412 2:30665011-30665033 GTCCTTCAGGGGCACGGCGATGG + Intergenic
928624777 2:33128480-33128502 GTCCTCCAGCCACATGGCCATGG + Intronic
930090327 2:47527185-47527207 GTCCTCCAGGACCACAGCCAGGG + Intronic
932474262 2:71991643-71991665 GTCCTTCAGTGTGACAGCCAAGG + Intergenic
938578612 2:132626333-132626355 GTCCTCCAGCTTCCAGGCCAGGG - Intronic
942147431 2:173040439-173040461 GTCATCCATCGTCAAGGCCCAGG + Intronic
947713039 2:232326591-232326613 GTCCTCAAACATCATGGCCAAGG + Intronic
947720104 2:232365060-232365082 GTCCTCAAACATCATGGCCAAGG + Intergenic
947732722 2:232440047-232440069 GTCCTCAAACATCATGGCCAAGG + Intergenic
1173206906 20:41002390-41002412 TTCCTCCAGCCTCAGGACCATGG + Intergenic
1173872662 20:46351611-46351633 GTCCTCCAAGGCCATGGCCAGGG - Intronic
1173982939 20:47238998-47239020 GTCCTCCACGGTCACCGTCACGG - Exonic
1175720967 20:61287078-61287100 GACCTGCAGCTTCAGGGCCAAGG - Intronic
1176159175 20:63640016-63640038 GTCTTCCAGAGTCACACCCAGGG - Exonic
1179321098 21:40291754-40291776 GTCCTCCAGCGTCACCCCCCAGG + Intronic
1180996028 22:19965771-19965793 GTCCTCCCTCTCCACGGCCAGGG - Intronic
1183713745 22:39521589-39521611 GTTCTCCAGCGACAAGGCTAAGG + Exonic
1184349991 22:43937165-43937187 TCCCTCCAGCCTCACAGCCAAGG - Exonic
949879561 3:8650783-8650805 GTCTTCCAGAGTCAAGGCCACGG - Intronic
950073378 3:10170170-10170192 TTCCTCCATCATCAAGGCCATGG + Intronic
954364204 3:50137712-50137734 GTCCTGGAGAGTCATGGCCAGGG - Intergenic
955246295 3:57227906-57227928 GTCCTCCAGCGTCTCCTCGATGG - Exonic
955457939 3:59145206-59145228 GTCCTCCAGAGGCAAGGGCAGGG - Intergenic
960156245 3:114299639-114299661 GACCACCAGCGTCGCGGCCATGG - Exonic
962197825 3:133379142-133379164 GTCCTCCAGGGTCAGGGAGAGGG + Intronic
968556374 4:1248289-1248311 GCCCTCCCGCGTCACCGCCGGGG + Intronic
968618390 4:1592631-1592653 GCTCTCCAGTGTCACGGCCCTGG - Intergenic
968919703 4:3516133-3516155 GTCCGCCAACCTCACGGACAAGG - Exonic
972562836 4:40243767-40243789 GGCCTCCTGCGTCAATGCCATGG + Exonic
973887330 4:55336582-55336604 GTTTTCCGGCGTCACGGGCAGGG - Intergenic
982317245 4:154044186-154044208 GGCCTCCAGGGTCCTGGCCACGG - Intergenic
988766597 5:34384443-34384465 GTCCTCCAGGGTCAGTGCAAGGG + Intergenic
999276050 5:150330852-150330874 TTCCTCCAACCTCACAGCCAAGG - Intronic
1002660233 5:180786739-180786761 TTCCTCCACCGTCAGGGCCCAGG - Intergenic
1002670333 5:180861316-180861338 GTCCTCCAGCGTCCCAGAGAGGG - Intergenic
1002856567 6:1043270-1043292 GTCCTCCAGCATCTCAGCAAGGG - Intergenic
1013306190 6:108848757-108848779 CTCCTCCACGGTCCCGGCCAGGG - Intronic
1013534096 6:111047501-111047523 GTACCCCAGTGTCACGGGCATGG + Intergenic
1017027922 6:150197715-150197737 CTCCTCCACCGTGGCGGCCAGGG - Intronic
1017027938 6:150197763-150197785 CTCCTCCACCGTGGCGGCCAGGG - Intronic
1017027997 6:150197955-150197977 CTCCTCCACCGTGACGGGCAGGG - Intronic
1017028027 6:150198051-150198073 CTCCTCCACCGTGGCGGCCAGGG - Intronic
1017028042 6:150198099-150198121 CTCCTCCACCGTGACGGGCAGGG - Intronic
1017028073 6:150198195-150198217 CTCCTCCACCGTGGCGGCCAGGG - Intronic
1017028120 6:150198339-150198361 CTCCTCCACCGTGGCGGCCAGGG - Intronic
1023626145 7:42116996-42117018 TTCCTCCAGGGACAGGGCCAAGG + Intronic
1024558285 7:50622396-50622418 GACCTCCAGAGTTACTGCCACGG + Intronic
1029305898 7:99619941-99619963 GTCCTCCACCATGGCGGCCAGGG - Exonic
1032472836 7:132190762-132190784 GTGCTCCAGGGTCCCTGCCAAGG + Intronic
1033732949 7:144196076-144196098 GACTTCCAGAGGCACGGCCAAGG - Intergenic
1033743801 7:144294656-144294678 GACTTCCAGAGGCACGGCCAAGG - Intergenic
1033750100 7:144354941-144354963 GACTTCCAGAGGCACGGCCAAGG + Intergenic
1035589463 8:802029-802051 GCCCTCCATCCTCACGGCCTGGG + Intergenic
1038348624 8:26755770-26755792 GTGCTCCAGCGCCAAGTCCAGGG - Intronic
1042389537 8:68217621-68217643 TTGCTCCAGCGTCACGCTCAGGG - Exonic
1042730784 8:71931804-71931826 GTCCTCCTGCCTCACCACCATGG - Intronic
1044726436 8:95198056-95198078 GTCATCCAGTGGCACCGCCATGG + Intergenic
1049640616 8:143713506-143713528 CCCCTCCAGTGTCACAGCCATGG - Intronic
1056992797 9:91426082-91426104 CTCCTCCAGCATCACTGCCTGGG - Intergenic
1058486697 9:105448470-105448492 CTCCTCCAGAGTCAGGGCCCCGG - Intronic
1060240198 9:121896707-121896729 TTCCTCCCGCCTCAGGGCCAGGG - Intronic
1060283162 9:122227354-122227376 GTCCTCCAGCGGCCCGGCCCTGG - Intronic
1061563451 9:131421595-131421617 TGCCCCCAGCCTCACGGCCAGGG + Intronic
1061999916 9:134210757-134210779 GCCCTTCAGCGCCAGGGCCATGG - Intergenic
1062268484 9:135698280-135698302 GTCCTCCGGCATCACGGTGATGG - Intronic
1203759288 EBV:3684-3706 GTCCGCCAGCGGCAGGTCCAGGG - Intergenic
1203773863 EBV:62214-62236 CTCCACCAGCTCCACGGCCATGG + Intergenic
1186862642 X:13689047-13689069 GTCCCCCAGGGTCTCGGCCGCGG + Intergenic
1188965431 X:36545610-36545632 GTCCTCCATCCTCTGGGCCAGGG + Intergenic
1200116103 X:153770353-153770375 GTCCTCGAACATCAGGGCCAGGG - Exonic
1200255623 X:154581068-154581090 GTTCTCCAGCGACAAGGCTAAGG + Intergenic
1200262146 X:154623336-154623358 GTTCTCCAGCGACAAGGCTAAGG - Intergenic