ID: 1089535756

View in Genome Browser
Species Human (GRCh38)
Location 11:119160092-119160114
Sequence TTGAACAAGAATGTGGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 423
Summary {0: 1, 1: 0, 2: 2, 3: 36, 4: 384}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089535749_1089535756 16 Left 1089535749 11:119160053-119160075 CCAGGGAGGAAGGGGACGTGTGT 0: 1
1: 0
2: 1
3: 30
4: 270
Right 1089535756 11:119160092-119160114 TTGAACAAGAATGTGGAGGCAGG 0: 1
1: 0
2: 2
3: 36
4: 384

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089535756 Original CRISPR TTGAACAAGAATGTGGAGGC AGG Intronic
900823808 1:4910464-4910486 TAGTACAGAAATGTGGAGGCAGG + Intergenic
900985145 1:6068898-6068920 TTGGGCAAGAATGTGGCGCCTGG - Intronic
903298487 1:22361252-22361274 TTTAACAAAAATCAGGAGGCTGG + Intergenic
903417259 1:23192350-23192372 TTGAAAGAGAATTTGGAGCCAGG - Exonic
903805791 1:26004897-26004919 GTGACCAAGAATGAGGAGGTGGG - Intergenic
904128328 1:28258407-28258429 TTTCCCAAGAATCTGGAGGCAGG + Intergenic
904614498 1:31742704-31742726 TTGACCAAGCATGGGGAGACTGG - Intronic
904809186 1:33152267-33152289 TTCAGCAAGACTGGGGAGGCTGG + Intronic
904965676 1:34370718-34370740 TTGAGCCAAAATGTGAAGGCTGG - Intergenic
905963534 1:42067057-42067079 TTGAAAAAGAAGGTTGGGGCCGG + Intergenic
906551031 1:46666668-46666690 TTGAAAAAGAATGGAGAGGAGGG - Intronic
907334072 1:53689003-53689025 TTGAGGAAGAATGTGGACCCTGG - Intronic
907828331 1:58039604-58039626 CTGAAAAAGAATGTGGGGGACGG - Intronic
908503132 1:64764694-64764716 GTTCACAAGACTGTGGAGGCTGG + Intronic
909053710 1:70797985-70798007 TTGAACAAGAATGGTGAGAGAGG + Intergenic
909272421 1:73640692-73640714 TTGAACAAGAATCAGGAATCAGG - Intergenic
910204469 1:84734385-84734407 TAGAACAAAAAGGTGGAGGAAGG - Intergenic
910363396 1:86437717-86437739 CTGTTCAAGAATATGGAGGCTGG + Intronic
911290261 1:96048941-96048963 TAGAACAAAAAGGTGGAGGAAGG - Intergenic
911989892 1:104681669-104681691 TAGAACAAGAATTTGGGGGTTGG + Intergenic
912485793 1:110026989-110027011 TTCGACAAGAAAGTGGAGGCCGG + Intergenic
912604375 1:110973425-110973447 TAGAACAAAAATGTGGAAGAAGG - Intergenic
913057095 1:115172587-115172609 TTGAAGAAGAAAGTGGAAACAGG - Intergenic
913344163 1:117791481-117791503 TAGAACAAAAAGGTGGAGGAAGG + Intergenic
914266282 1:146040875-146040897 TTGAAAAGGAATGTTCAGGCCGG - Intergenic
914416601 1:147489195-147489217 TTTAACAAGAATGTGGCTCCAGG - Intergenic
914960780 1:152204536-152204558 TTCAAAAAGAATGAGGAGTCAGG + Intergenic
915583636 1:156831230-156831252 TTGGGCAAGGATGTGGAGGCGGG + Intronic
915796197 1:158736354-158736376 TGGAACAAAACTGTGGAGGTGGG - Intergenic
916000587 1:160611524-160611546 TTGAAAAATAAGGTGGATGCAGG + Intronic
916418227 1:164612117-164612139 TAGTTCAAGAAGGTGGAGGCGGG + Intronic
917689229 1:177450272-177450294 TTGAAAAATAAAATGGAGGCCGG - Intergenic
918197939 1:182240138-182240160 CTGAACATCAATGTTGAGGCAGG - Intergenic
918673879 1:187257487-187257509 TAGAACAAAAAGGTGGAGGAAGG + Intergenic
920604443 1:207366726-207366748 TAGAACAAAAAAGTGGAGGAAGG - Intergenic
921400208 1:214713699-214713721 TAAAAAAAGAAAGTGGAGGCTGG - Intergenic
921511656 1:216038490-216038512 TAGAATAAGAAAGTGGAGGGGGG - Intronic
922865626 1:228859193-228859215 TGGAACAAGAAGGTGGAGGAAGG - Intergenic
922929718 1:229379617-229379639 TTGAAGATGAATTTGGTGGCTGG + Intergenic
923266304 1:232317781-232317803 TTGACAGAGATTGTGGAGGCCGG - Intergenic
923630344 1:235645499-235645521 TTGAATAAGAATGTTCAGGCTGG + Intronic
923751370 1:236749498-236749520 TTAAAAAAGAATGCTGAGGCTGG + Intronic
923925900 1:238626984-238627006 TCGAACAAAAATGTAGAGGAAGG - Intergenic
924551843 1:245085476-245085498 CTGAACAAAAATGGGGAGGTAGG + Intronic
1064110400 10:12533924-12533946 TGGAATAAGAATGTGATGGCTGG - Intronic
1064638578 10:17393056-17393078 TAGAACAAAAAAGTGGAGGAAGG + Intronic
1064904775 10:20333917-20333939 TAGAACAAAAAGGTGGAGGAAGG + Intergenic
1065063153 10:21929753-21929775 ATGAACCAGACTGAGGAGGCTGG - Intronic
1065644689 10:27822030-27822052 GTGAACAAGAACGTGGGGACAGG + Intronic
1068367609 10:56070900-56070922 ATGCAAAAGAATGTGGAGGTGGG - Intergenic
1069194429 10:65531361-65531383 TAGAACAAAAAGGTGGAGGAAGG - Intergenic
1070683151 10:78463072-78463094 TTGAACAGGGATCTGAAGGCAGG - Intergenic
1070699319 10:78588200-78588222 GTGTTCAAGAATGTGGAGCCTGG - Intergenic
1070861078 10:79662733-79662755 TATAACAAGCATGTGGAGGCAGG - Intergenic
1070876179 10:79812857-79812879 TATAAAAAGCATGTGGAGGCAGG + Intergenic
1071643109 10:87335005-87335027 TATAACAAGCATGTGGAGGCAGG + Intergenic
1074916955 10:117966444-117966466 TTACAAAAGAATTTGGAGGCAGG + Intergenic
1074960643 10:118442287-118442309 TTGAACAAGAATGCAGTAGCTGG - Intergenic
1075076200 10:119352276-119352298 TGGAACAAGAATATTGTGGCTGG - Intronic
1076807444 10:132866146-132866168 TTGAAGATGAATGGGGAGACCGG - Exonic
1077232497 11:1464318-1464340 TTGAAAAAGGATGTGGTGGCCGG + Intergenic
1078273901 11:9824260-9824282 TTGAAAAAGATTGTTAAGGCCGG + Intronic
1078452874 11:11453281-11453303 TTTAACAAGAAGGTGGCGGAAGG - Intronic
1079331284 11:19535117-19535139 TTTAGCAAGATTGTGCAGGCAGG + Intronic
1082778807 11:57270105-57270127 TTGCACAAAAATGTGTAGACAGG + Intergenic
1085068180 11:73517325-73517347 TTTAAAAAGTATGTAGAGGCTGG - Intronic
1085165232 11:74393706-74393728 ATCAACAACGATGTGGAGGCAGG - Intronic
1085448402 11:76616200-76616222 TTGAACAAGCATGTGGCAGAGGG - Intergenic
1087438832 11:98157613-98157635 TAGAACAAAAAGGTGGAGGAAGG - Intergenic
1088187689 11:107191247-107191269 TAGAACAACAAAGTGGAGGAAGG - Intergenic
1089535756 11:119160092-119160114 TTGAACAAGAATGTGGAGGCAGG + Intronic
1090059118 11:123448513-123448535 TAGAAGTAGAAAGTGGAGGCTGG - Intergenic
1090135276 11:124191443-124191465 TTCAATAAAAGTGTGGAGGCTGG + Intergenic
1090354576 11:126131473-126131495 TTACACAAGGGTGTGGAGGCTGG - Intergenic
1090904079 11:131058581-131058603 GTGAACAACAATGTGGACACTGG - Intergenic
1091294557 11:134464492-134464514 GTGAAAAGGAATGGGGAGGCAGG - Intergenic
1091410701 12:237373-237395 TTGGACAAGAGCCTGGAGGCAGG - Intronic
1091461822 12:648860-648882 GTGAACAAAAAGCTGGAGGCAGG - Intronic
1091717720 12:2791640-2791662 TTTAAGAAGTATGTAGAGGCCGG + Intergenic
1091835754 12:3584362-3584384 TTCAACATGAATTTGGAGGGGGG + Intronic
1092571059 12:9721719-9721741 ATGAACAAGAAAGAGGAAGCAGG - Intronic
1093160314 12:15739499-15739521 TGGAACAAAAAGGTGGAGGAAGG + Intronic
1093628757 12:21383458-21383480 TAAAGCAAGAACGTGGAGGCAGG - Intronic
1093771814 12:23026869-23026891 TAGAACAAAAATGTGGAGGAAGG + Intergenic
1093773897 12:23049917-23049939 TTGAACAAAAATGAGAAGGAAGG + Intergenic
1093784663 12:23178254-23178276 TTAAACAGGAACGTGGTGGCAGG - Intergenic
1094755795 12:33466826-33466848 TTGAATAAGAGTGTTGAGACAGG - Intergenic
1095729198 12:45487689-45487711 TAGAACAAAAAGGTGGAGGAGGG - Intergenic
1095897817 12:47297872-47297894 TTTAAAAAGACTGTTGAGGCTGG - Intergenic
1096284223 12:50284084-50284106 TGGGACAAGAATTTGGGGGCAGG - Intergenic
1096317290 12:50579051-50579073 TTGTACAAAAATGTGGACTCAGG - Intronic
1097318792 12:58202629-58202651 TTGAACAAAAAGATGGAGGAAGG - Intergenic
1098377415 12:69831958-69831980 TTGAAGAATAAAGAGGAGGCTGG + Intronic
1098684532 12:73401606-73401628 GAGAACAAAAATGTGGAGGAAGG + Intergenic
1098731159 12:74038132-74038154 TTGAACAACGATGGGGTGGCTGG - Intergenic
1099137780 12:78929864-78929886 TTGAGAAAGAATGTGGTGGGGGG + Intronic
1099310335 12:81012565-81012587 TTGAAGAAAAAGGTAGAGGCGGG + Intronic
1100126977 12:91439046-91439068 TAGAACAAAAAGGTGGAGGAAGG + Intergenic
1100432342 12:94541929-94541951 TTGATTAAGAATCTTGAGGCTGG + Intergenic
1100957080 12:99920795-99920817 TAGAACAAGAAAGTGGAGGAAGG - Intronic
1101013239 12:100472842-100472864 TTGTGCAAAAGTGTGGAGGCGGG + Intergenic
1101062458 12:100986367-100986389 TAGGACAAAAAAGTGGAGGCAGG - Intronic
1101978471 12:109383836-109383858 TTGACCCAGTATGTGGAGTCGGG - Intronic
1103104027 12:118206889-118206911 TTTAAAAACAATGAGGAGGCCGG - Intronic
1103885824 12:124199330-124199352 ATGAAAAAGAATAAGGAGGCTGG - Intronic
1104928221 12:132324749-132324771 CTGAACCAGAATGGAGAGGCTGG - Intronic
1105254540 13:18734040-18734062 GTGAACCAGAATTTGGAGGAGGG - Intergenic
1106844859 13:33727650-33727672 TTGACCAAGAAAGAGGAGGTTGG - Intergenic
1108011539 13:46018458-46018480 ATGAACAAGATTGCTGAGGCAGG + Intronic
1108519428 13:51233293-51233315 TGGAACAAGGATGTGATGGCTGG - Intronic
1108597422 13:51961406-51961428 TAGAACTAGAATTTGAAGGCAGG - Intronic
1109960959 13:69629951-69629973 TTGAAAAAGATTGAGGAGCCAGG + Intergenic
1110544121 13:76737404-76737426 TAGAAAAAGAGAGTGGAGGCTGG - Intergenic
1110873287 13:80478122-80478144 GAGAACAACAATGTGAAGGCTGG - Intergenic
1112577034 13:100645106-100645128 TAAAACAAGAATGTTCAGGCCGG - Intronic
1112705562 13:102065124-102065146 ATGATGATGAATGTGGAGGCTGG - Intronic
1113160928 13:107380536-107380558 CTGAAAAAGAGTGTGGGGGCCGG - Intronic
1114782363 14:25552225-25552247 TTGAAAAATAATATGGAGGATGG + Intergenic
1115006701 14:28494329-28494351 TAGAACAAAAAGGTGGAGGAAGG - Intergenic
1116521152 14:45848660-45848682 TAGAACAAAAAGGTGGAGGAAGG - Intergenic
1116795248 14:49383316-49383338 TTTAAGAAGAAGGTGGAGCCTGG + Intergenic
1117328736 14:54691888-54691910 ATGAACAATTTTGTGGAGGCAGG - Intronic
1117442643 14:55774277-55774299 TAGAACAAAAAGGTGGAGGAAGG + Intergenic
1118092796 14:62500741-62500763 TTCTAAAAGAATGTGGAGGCAGG - Intergenic
1118209974 14:63756784-63756806 ATGAAAAATAATGAGGAGGCTGG + Intergenic
1118734200 14:68690464-68690486 TTGCAGAGGAATGGGGAGGCAGG - Intronic
1119312035 14:73655641-73655663 TTGAAAAAGAAAATGTAGGCCGG - Intronic
1119722332 14:76899645-76899667 TAGAACAAGAGTGAGGAGGGCGG + Intergenic
1119989252 14:79176682-79176704 TTGAACATGAATGGGTAGGAGGG - Intronic
1121188716 14:92002875-92002897 TTGAAAAAGAATGTGCTGGCTGG - Intronic
1122142379 14:99670406-99670428 TTGAAAAAGAGTGTGGAGTCTGG - Intronic
1122428072 14:101623212-101623234 GGGAACAACAGTGTGGAGGCAGG + Intergenic
1123889315 15:24759828-24759850 TTCAACAAAAATGTGTTGGCAGG - Intergenic
1123986460 15:25650572-25650594 TAGAACAAAAAGGTGGAGGAAGG + Intergenic
1125286941 15:38103429-38103451 TTCACCAAGAAAGTGAAGGCAGG + Intergenic
1125392470 15:39209116-39209138 TAGAACAAAAAAGTGGAGGAAGG + Intergenic
1127006997 15:54581915-54581937 AGGCTCAAGAATGTGGAGGCTGG + Intronic
1127084173 15:55409106-55409128 TTGAAAAAGGATTTGGTGGCCGG + Intronic
1128527721 15:68423793-68423815 ATCAACAAGAAGGAGGAGGCCGG - Intronic
1128753263 15:70163859-70163881 TGGACCAAGAATTAGGAGGCTGG + Intergenic
1129861967 15:78870158-78870180 TTAAAAAAGTATGTGCAGGCTGG + Intronic
1130933527 15:88449602-88449624 TAAAGCAAGAAGGTGGAGGCAGG + Intergenic
1131106000 15:89735166-89735188 TTGAAAAACAAGTTGGAGGCTGG - Intronic
1131997195 15:98144162-98144184 TAGAACAAGAAGGTGGAGGAAGG - Intergenic
1133376674 16:5293022-5293044 TTCAAATAGAATTTGGAGGCTGG + Intergenic
1133659999 16:7907083-7907105 TAGAACAAAAAGGTGGAGGAAGG + Intergenic
1133695160 16:8256252-8256274 TAGAACAAAAAGGTGGAGGAAGG - Intergenic
1133974948 16:10594063-10594085 TTTTAAAAGAATTTGGAGGCCGG - Intergenic
1135272665 16:21082746-21082768 TTGAACCGGGAGGTGGAGGCAGG + Intronic
1135529686 16:23242337-23242359 TAGAACAAAAAGGTGGAGGAAGG - Intergenic
1135864450 16:26088092-26088114 AAAGACAAGAATGTGGAGGCAGG - Intronic
1136621766 16:31434136-31434158 CTGAACCAGAATGCAGAGGCGGG + Intronic
1136774003 16:32861498-32861520 TTTGAAAAGCATGTGGAGGCTGG - Intergenic
1136896606 16:34000021-34000043 TTTGAAAAGCATGTGGAGGCTGG + Intergenic
1137989689 16:53141296-53141318 TGGAACCAGAATGTTAAGGCTGG - Intronic
1138967955 16:62109300-62109322 TTGTACAAGATTTTGGTGGCAGG + Intergenic
1139280593 16:65767002-65767024 TTGAAAAAGGATTTGCAGGCTGG - Intergenic
1139809814 16:69605141-69605163 TTAAAAAAGAAAGTGGAGGCCGG + Intronic
1140309557 16:73835765-73835787 GGGAAAAAGAAAGTGGAGGCCGG - Intergenic
1140494328 16:75370406-75370428 TTTAAAAATAATGTGGAGGGAGG + Intronic
1203076425 16_KI270728v1_random:1123609-1123631 TTTGAAAAGCATGTGGAGGCTGG - Intergenic
1146139117 17:30349551-30349573 TAGAACAAAAAGGTGGAGGGAGG - Intergenic
1146246145 17:31284822-31284844 CTGTAAAACAATGTGGAGGCCGG + Intronic
1150351463 17:64448178-64448200 TTGAAATAGAACGTGCAGGCTGG - Intergenic
1151329054 17:73396171-73396193 TCAAACAAGAAGGAGGAGGCTGG - Intronic
1151447479 17:74176658-74176680 CTGAACAAGGAAGTGGAAGCCGG + Intergenic
1151651096 17:75470164-75470186 TTGAAAATGAAGGTTGAGGCTGG + Intronic
1152031248 17:77844902-77844924 TTGGAGAAGCATGGGGAGGCAGG - Intergenic
1152075318 17:78155919-78155941 TTCAACAATAGTGTGTAGGCCGG - Intronic
1152366779 17:79860925-79860947 GTGGACATGAATGTGGGGGCAGG - Intergenic
1154979625 18:21492048-21492070 ATGATGAAGAATTTGGAGGCTGG + Intronic
1155269912 18:24130461-24130483 TTCAACAAAAATGTGGAAGTGGG + Intronic
1156377817 18:36530665-36530687 TACAACAAGAATGTGCATGCTGG - Intronic
1156773422 18:40758021-40758043 TTCATCATGAACGTGGAGGCAGG - Intergenic
1156970416 18:43147603-43147625 TAGAATAACAATGTGCAGGCTGG + Intergenic
1159965193 18:74588064-74588086 TTGAAGAATAATGTGGAGGGTGG - Intergenic
1160207513 18:76847087-76847109 TTGAAAAATGATGTCGAGGCCGG - Intronic
1160255811 18:77247897-77247919 TTTTCCAAGAATGTGGAGGGAGG + Intergenic
1161528959 19:4775419-4775441 TTAAAAAAGAAAGAGGAGGCTGG + Intergenic
1161576522 19:5057630-5057652 GTGAACAAGGACGTGGAGCCAGG - Intronic
1162564901 19:11440524-11440546 TTGAACCCGGATGTGGAGGTTGG - Intronic
1162634345 19:11955296-11955318 TTAAACAAGAATTTTCAGGCTGG - Intronic
1162867748 19:13561673-13561695 TAGAACAAAAAAGTGGAGGAAGG + Intronic
1163585680 19:18162231-18162253 TTGGCCAGGACTGTGGAGGCCGG - Exonic
1163801789 19:19370220-19370242 TTGAAAAAAAATGTTGGGGCTGG + Intergenic
1164404870 19:27935869-27935891 ATAAACAAGGAAGTGGAGGCAGG + Intergenic
1164592065 19:29512643-29512665 GAGAACAAGAATGAGGAGGAAGG + Intergenic
1164808441 19:31137334-31137356 TAGAACAAAAAGGTGGAGGACGG + Intergenic
1165724200 19:38101115-38101137 ATGTACAACAATGAGGAGGCCGG + Exonic
1166575929 19:43837755-43837777 TTGAACAGAGATGTGGAGCCTGG + Intronic
1166766902 19:45256552-45256574 TTGAAGTAGAATTTGGGGGCTGG + Intronic
1167448948 19:49556100-49556122 TTGAAAAGGAAGGAGGAGGCGGG + Intronic
1168096677 19:54119790-54119812 TTCAAGAAGAATGGGAAGGCTGG - Intronic
925326532 2:3026371-3026393 TTCAGGAAGAATGTGGAGGAGGG + Intergenic
925960214 2:9006854-9006876 TAGAACAAAAAGGTGGAGGAAGG - Intergenic
927023706 2:19043712-19043734 TAGAACAAAAAGGTGGAGGAAGG + Intergenic
927280886 2:21305448-21305470 TTGGAGAAGAAAGTGAAGGCAGG + Intergenic
929411555 2:41702611-41702633 GTGAAGAAGAAGGTGGAGGTTGG - Intergenic
929825766 2:45308618-45308640 GTGATTAAGAATGTGGATGCTGG + Intergenic
929910953 2:46089182-46089204 TAGAATAAGAATGAGGAGGGAGG - Intronic
930235999 2:48889504-48889526 TTGATCAAGGTTGTGAAGGCTGG + Intergenic
930904469 2:56549629-56549651 TTCAACATGAATTTGGGGGCAGG - Intergenic
930994630 2:57701503-57701525 TTTGACAAGAATGTGTATGCAGG + Intergenic
931476569 2:62593887-62593909 TAGAACAAAAATGTGGAGGAAGG + Intergenic
932301190 2:70668012-70668034 TAGAACAAAAAGGTGGAGGAAGG + Intronic
932537942 2:72619495-72619517 TTTAAAAAGAATGAGGAGGAGGG + Intronic
932752856 2:74382774-74382796 TTTAAAAAATATGTGGAGGCCGG + Intronic
935150817 2:100433560-100433582 AAGAACAAAAATGTGGAGGAAGG + Intergenic
936157056 2:110054603-110054625 GTGAACAAAAGTGTGGAGGAAGG + Intergenic
936187638 2:110316841-110316863 GTGAACAAAAGTGTGGAGGAAGG - Intergenic
936944042 2:117914682-117914704 TGGAACAAGAATATGGAAGCAGG + Intergenic
937454143 2:122026755-122026777 TAGAGCAAGAAGGTGGAGGAAGG - Intergenic
938301968 2:130221755-130221777 TAGAACAAGAAGGTGGAGGAAGG + Intergenic
938454733 2:131452697-131452719 TAGAACAAGAAGGTGGAGGAAGG - Intergenic
939675112 2:145062795-145062817 TAGAACAAAAAAGTGGAGACAGG - Intergenic
940097052 2:149988958-149988980 TTGATCCTGAATGAGGAGGCTGG - Intergenic
940727371 2:157349696-157349718 TTGAAAAAGAAATGGGAGGCAGG - Intergenic
942270173 2:174266498-174266520 TAGAACAAAAAGGTGGAGGAAGG - Intergenic
942689649 2:178571964-178571986 TTGAACAGGAGTTTGAAGGCTGG + Exonic
942950742 2:181718028-181718050 TTCAACAACACTGTAGAGGCAGG + Intergenic
944153783 2:196590493-196590515 ATGCACAAGAATGTGGATCCAGG + Intronic
945520266 2:210818810-210818832 TTGAATATGAATGTGGAAGGAGG + Intergenic
947266495 2:228288094-228288116 CTGAAGAAGAAACTGGAGGCTGG + Intergenic
948737613 2:240019520-240019542 TTTAAAAAGAACGTGGAGGCCGG + Intronic
949011207 2:241679670-241679692 TTGAAAATGCATCTGGAGGCTGG + Intronic
1168878572 20:1186857-1186879 TTGAACAGGAGTGTGGTGCCAGG - Intronic
1170291236 20:14771104-14771126 TAGAACAAAAATGTAGAGGAAGG + Intronic
1170694876 20:18649150-18649172 CTGAACAAGACAGTGGTGGCAGG - Intronic
1171314843 20:24180703-24180725 TAGAAAATGACTGTGGAGGCAGG - Intergenic
1171840686 20:30206852-30206874 TTGATCAGGAATGGGGAAGCTGG + Intergenic
1172905605 20:38366915-38366937 TTGACCAAGAGTGAGAAGGCCGG + Intronic
1174179710 20:48667094-48667116 TGGAACAAAGATGTGGTGGCTGG + Intronic
1177288422 21:19079722-19079744 TTTAACAACAATTTGGTGGCTGG - Intergenic
1177644234 21:23881699-23881721 TAGAACAAAAAGGTGGAGGAAGG - Intergenic
1179315509 21:40240560-40240582 CTGAACAAAAACGTGAAGGCTGG - Intronic
1181745128 22:24950779-24950801 ATGAACCAGAATGCGTAGGCTGG - Intergenic
1182469148 22:30536691-30536713 TTGAACAAGGAGGAGGAGGAGGG + Intronic
1183155379 22:36070829-36070851 TTAAAAAAGAATGTGATGGCTGG + Intergenic
1185332799 22:50259205-50259227 ATGGGCAAGAATGTGGAGGGAGG + Intronic
950444180 3:13026524-13026546 GTGAACAAAACTGTGGAGCCTGG + Intronic
951391146 3:22105691-22105713 TAGAACAAAAAGGTGGAGGAAGG - Intronic
951465871 3:22999986-23000008 TTGAAGAAGAATTTGGGGGGTGG + Intergenic
951707607 3:25558954-25558976 CTGAAGAAAAATGTGGAGACAGG - Intronic
951715474 3:25639600-25639622 TTAAAAACAAATGTGGAGGCTGG - Intronic
952138113 3:30446533-30446555 TAGAGCAAGAATGTGGAGCCTGG - Intergenic
952962696 3:38602714-38602736 TTGACCAGGAAGGTGGAGGATGG - Intronic
953895734 3:46798692-46798714 CAGAACAAAAATGTGGAGGAAGG + Intronic
954184193 3:48904391-48904413 ATAAAGAAGAAAGTGGAGGCTGG - Intergenic
954280290 3:49572492-49572514 TTGGACAAGAATGAGGAATCAGG + Intronic
954965938 3:54610923-54610945 TTGAAAAAAAATGTCCAGGCAGG - Intronic
957065613 3:75519495-75519517 TTCAAATAGAATTTGGAGGCTGG - Intergenic
958145656 3:89621350-89621372 TAGAACAAAAAAGTGGAGGAAGG - Intergenic
958253579 3:91298815-91298837 TTGGAGATGATTGTGGAGGCTGG - Intergenic
959245982 3:103868602-103868624 TAGAACAAAAAGGTGGAGGAAGG + Intergenic
960848146 3:122023378-122023400 TTGAAGAAAAATGTGATGGCTGG - Intergenic
961115169 3:124323217-124323239 ATGAAAAAGGATGGGGAGGCTGG - Intronic
961287716 3:125819926-125819948 TTCAAATAGAATTTGGAGGCTGG + Intergenic
961596995 3:128025663-128025685 TTGAACCAGGAGGTGGAGGTTGG + Intergenic
962193937 3:133341015-133341037 TTGAATAACAATGTGGAAGTGGG - Intronic
963226329 3:142866232-142866254 TAGAACAAAAAGGTGGAGGAAGG + Intronic
964504822 3:157387780-157387802 TTGAACAGGAATTGGGAAGCAGG - Intronic
964508913 3:157427943-157427965 TAGAACAAAAAGGTGGAGGAAGG + Intronic
964653733 3:159043196-159043218 TAGAACAAATATGTGGAGGAAGG - Intronic
965269453 3:166594558-166594580 GTGAAGAAGAATGTGAAAGCAGG - Intergenic
966123634 3:176550058-176550080 CTGAACAAGCAAGTGAAGGCAGG - Intergenic
967226802 3:187299655-187299677 TGGAACAAGAAAGCAGAGGCAGG + Intergenic
967332504 3:188305449-188305471 CTGTACTAGAATCTGGAGGCAGG + Intronic
967793675 3:193575448-193575470 TTGCACAGGAATTTGGAGGTAGG + Intronic
970642670 4:18084724-18084746 CTGAACAAGAATGTGGAGGTGGG + Intergenic
970741358 4:19241731-19241753 TGTAATAAGAATGTAGAGGCTGG + Intergenic
971778231 4:30995847-30995869 TTGCACGAGAAGATGGAGGCAGG - Intronic
973154365 4:46931546-46931568 TGGAGCATGAATATGGAGGCAGG - Intronic
973243435 4:47983826-47983848 TTGAAGAAGAAAATGAAGGCTGG + Intronic
973884461 4:55306533-55306555 TTCAACAAGAATTTGGGGCCAGG - Intergenic
974122356 4:57654915-57654937 ATGAGCAAGAATGTTGAGGGTGG - Intergenic
975194586 4:71509206-71509228 TTGAATAAGAATGGTGAGACAGG - Intronic
975612940 4:76219271-76219293 TTGAACTAGAATGGAGAGCCAGG + Intronic
977927324 4:102716011-102716033 ATTAAAAAGAATGAGGAGGCCGG + Intronic
978089664 4:104699588-104699610 TTGACCAAGAATCTGCAGGGAGG + Intergenic
979363505 4:119792717-119792739 TTGGAAAAGAAACTGGAGGCTGG + Intergenic
979780787 4:124649360-124649382 TTGTAAAAGAATGTGGAGGCAGG + Intergenic
980307899 4:131088286-131088308 TTAAATAAGAATGTGGGGGATGG - Intergenic
980907596 4:138963311-138963333 TAGAACAAAAAGGTGGAGGAAGG - Intergenic
981452849 4:144919266-144919288 TAGAACAAAAAAGTGGAGGAAGG - Intergenic
983506318 4:168557338-168557360 TTGAACGAACAAGTGGAGGCCGG - Intronic
986685744 5:10274041-10274063 ATGAAGAGGAGTGTGGAGGCTGG - Intergenic
986937425 5:12906629-12906651 TTGCAAAAGATTGTGGATGCAGG + Intergenic
987225810 5:15840352-15840374 TTGGAAAAGAATGAGGAGGAGGG - Intronic
987402251 5:17490539-17490561 TTAAACTTGAATGTGCAGGCAGG + Intergenic
987876028 5:23682022-23682044 CAGAAGAAGAATATGGAGGCAGG - Intergenic
988213193 5:28235774-28235796 ATGTACAAGAATGTTCAGGCTGG + Intergenic
988222780 5:28370751-28370773 TTGAAAATAATTGTGGAGGCTGG + Intergenic
989392144 5:40912041-40912063 TTGAAGAAGTATGTGGGGCCGGG - Intronic
989758000 5:44979513-44979535 TTGAACAAGAGTGGTGAGTCTGG - Intergenic
990001862 5:50902731-50902753 TAGAACAAAAAGGTGGAGGAAGG - Intergenic
990201709 5:53383425-53383447 TGGAACAAAAATGTAGAGACAGG + Intergenic
991519758 5:67482670-67482692 TTGAACAAGACTCTGGGGCCGGG - Intergenic
991689269 5:69210829-69210851 TCTAAAAAGAATGTTGAGGCCGG - Intergenic
992002380 5:72448540-72448562 TTGGACAAGAATGTTAAGGGAGG + Intronic
992030207 5:72713513-72713535 TTGAACAAAAAGGAGGAGGAAGG + Intergenic
993590374 5:89788095-89788117 TAGAACAAAAATGTGGAGGAAGG + Intergenic
993941227 5:94061412-94061434 TTGAACAAGAATAGTGAGGATGG - Intronic
996851269 5:127955652-127955674 TTGAATAAGAATGGTGAGACTGG - Intergenic
998333218 5:141347489-141347511 GAGAACAAAAATGTAGAGGCTGG + Intronic
998484550 5:142490382-142490404 ACCAAGAAGAATGTGGAGGCAGG + Intergenic
999267951 5:150279037-150279059 TTCATCTACAATGTGGAGGCTGG + Intronic
1003473005 6:6454214-6454236 TAGAACAACAAGGTGGAGGAAGG + Intergenic
1003557847 6:7156880-7156902 TTGAACAAGAATGGGTACACAGG - Intronic
1003604038 6:7542913-7542935 TTGATCCAGAATGTGTGGGCAGG + Intronic
1003769863 6:9288308-9288330 TAGAATAACAATGTGGAGGAAGG + Intergenic
1004770363 6:18774363-18774385 TTCCACAAGAATGTGGAGCGGGG + Intergenic
1005083625 6:21981564-21981586 CAGAACAAGAAAGAGGAGGCAGG - Intergenic
1005132238 6:22522507-22522529 TGGCATAAGAATGTGAAGGCTGG + Intergenic
1005699607 6:28387119-28387141 TTAAAAATAAATGTGGAGGCTGG - Intronic
1006217374 6:32455965-32455987 TTGAATAAGAATGGTGAGGGAGG - Intergenic
1006234427 6:32616140-32616162 TAGAACAAAAAGGTGGAGGAAGG - Intergenic
1008014235 6:46500539-46500561 TTGAAGAAGTAGGAGGAGGCTGG - Intergenic
1008820992 6:55630285-55630307 TTGGACAAGAATGGGGTGGGTGG + Intergenic
1008969909 6:57355492-57355514 CTGAACAAGAATTTGGATCCAGG + Intronic
1009158876 6:60257302-60257324 CTGAACAAGAATTTGGATCCAGG + Intergenic
1009190892 6:60628213-60628235 TTGCAGATGATTGTGGAGGCTGG + Intergenic
1011220305 6:85048181-85048203 ATGAGCAAAAATGGGGAGGCTGG - Intergenic
1011781002 6:90789275-90789297 TAGAACAAAAATGTGAAGGAAGG - Intergenic
1014054413 6:116997174-116997196 TGGAACAAAAAGGTGGAGGAAGG + Intergenic
1014139312 6:117922068-117922090 TTGAGCAAGCATGTAAAGGCCGG + Intronic
1014399299 6:120967212-120967234 TAGAACAAAAAGGTGGAGGAAGG + Intergenic
1014924270 6:127252877-127252899 TTGAACAAAAAGGTGGAAGAAGG - Intergenic
1015199117 6:130559339-130559361 TAGTCCAAGAATGTGTAGGCTGG + Intergenic
1015391769 6:132690401-132690423 ATGAACAAGGGTGTGGATGCAGG - Intronic
1016072556 6:139757368-139757390 TTGAATCAGAATATGGAGGGTGG - Intergenic
1016769966 6:147838302-147838324 TTGAATAAGAACCTGGAGGCAGG + Intergenic
1016943567 6:149506180-149506202 TTAAATAAGAAAATGGAGGCTGG + Intronic
1017876196 6:158526218-158526240 GTGAAGAAGAATGTGAAGGCTGG + Intergenic
1017961930 6:159231013-159231035 TTAAACAAGAAGGAGGAAGCAGG + Intronic
1018246731 6:161830990-161831012 ATGAACCAGAATGTGGAGCTTGG - Intronic
1018394988 6:163371250-163371272 TTGATCAACAATGGGGAGGGGGG + Intergenic
1020449602 7:8306199-8306221 GTGAACAAGAGTGAGGATGCTGG - Intergenic
1020527309 7:9278485-9278507 TTGAACAAAAAAATGGAGTCAGG + Intergenic
1020680618 7:11232473-11232495 TTGAAAGAGAAGGTGGAGGAGGG + Intergenic
1020891201 7:13880048-13880070 TTGAATTAGAATTTGGAGGTAGG + Intergenic
1021426902 7:20510543-20510565 TCTAAAAATAATGTGGAGGCAGG - Intergenic
1022243059 7:28531411-28531433 ATGAACATGAAGGTGGAGACTGG - Intronic
1022604207 7:31792373-31792395 TTGAATAAGCATGAGGAGGATGG + Intronic
1022846623 7:34216333-34216355 TAGAACAAGAAGGTGGAGGAGGG - Intergenic
1023101495 7:36722637-36722659 TAAAACAAGACTTTGGAGGCTGG + Intronic
1023227731 7:37988945-37988967 TAGAACAAGAAGGTGGAGGAAGG - Intronic
1023616374 7:42024449-42024471 TTCAGCAAGAACGTGGAGGCTGG - Intronic
1024465376 7:49706625-49706647 TGTAACAGGAATGTGGAGGATGG - Intergenic
1026370997 7:69699072-69699094 TAGAAAAAGAATTTGGAGACTGG + Intronic
1026620359 7:71944857-71944879 TTGAAGAAGAGTTAGGAGGCAGG + Intronic
1027391477 7:77708225-77708247 GTGAATAAGATTGTAGAGGCAGG + Intronic
1028392210 7:90329512-90329534 TAGAACAAAAAGGTGGAGGAAGG - Intergenic
1028699798 7:93764121-93764143 TTGAATAAGAATGGTGAGACTGG - Intronic
1028981372 7:96971076-96971098 TTGTACAAGACTGTGCAGGGGGG + Intergenic
1029413006 7:100427314-100427336 TTTAACAAGAAAGAAGAGGCGGG + Intronic
1030509392 7:110466151-110466173 TTGAATAAGACTCTGGAGACTGG - Intergenic
1031097800 7:117441795-117441817 GTGAAAAATAATGTGGAGGCCGG - Intergenic
1032491240 7:132326136-132326158 TAGAACAAAAAGGTGGAGGAAGG + Intronic
1032555740 7:132832802-132832824 TTGACCAAGAAACAGGAGGCCGG + Intronic
1032597247 7:133253752-133253774 ATGGACCAGAATGCGGAGGCAGG - Intronic
1032729423 7:134623370-134623392 TTGAAGGAGAGTGTGGAGGGCGG + Intergenic
1033858363 7:145593996-145594018 TAGAACAAAAAGGTGGAGGAAGG - Intergenic
1035822213 8:2605622-2605644 TTGAACAGGGATGTGCTGGCAGG - Intergenic
1036144555 8:6242754-6242776 TTGAAAAAGAATGTTAAGGTGGG + Intergenic
1037101927 8:15057244-15057266 TTGAGCAAGAATATGCAGGAAGG + Intronic
1038381221 8:27096154-27096176 TAGAACAAGAAGGTGGAGAAAGG + Intergenic
1039336685 8:36599045-36599067 TTGAACCACAATATGGAGGCTGG + Intergenic
1039338663 8:36622882-36622904 TGGAACTAGACTCTGGAGGCAGG + Intergenic
1039822204 8:41144422-41144444 CTGGACATGAATGTGAAGGCTGG + Intergenic
1041809075 8:61887408-61887430 TTGACTAGGATTGTGGAGGCTGG + Intergenic
1042044286 8:64630850-64630872 GTGAACAAGAATGTGGGGGTTGG + Intronic
1043738309 8:83775136-83775158 ATGGAAAAGGATGTGGAGGCAGG - Intergenic
1043974883 8:86573252-86573274 TAGAACAAAAATATGGAGGAAGG + Intronic
1044351945 8:91176738-91176760 TAGAACAAAAAGGTGGAGGGAGG - Intronic
1045247834 8:100459011-100459033 TTGAGTAAGACTGTGCAGGCTGG - Intergenic
1046353173 8:113042875-113042897 TTGAAGAACAACGTGGAGGTTGG - Intronic
1046847005 8:118928644-118928666 TTGACCAAGAATGTGGCTGGAGG + Intronic
1047361943 8:124177482-124177504 CTGAACAGCAAAGTGGAGGCAGG - Intergenic
1047580858 8:126213839-126213861 TTGAATAAAAATGTGGAGGAGGG + Intergenic
1047774669 8:128059958-128059980 TAGAATAAGAATTTAGAGGCTGG + Intergenic
1048546788 8:135395080-135395102 TAGAGCAAGAATATGCAGGCAGG - Intergenic
1050826245 9:9950426-9950448 TTTAAGAAGAAAGTGGAGGCCGG + Intronic
1051197734 9:14581570-14581592 TTGAATAAGAGTGGGGAGGCTGG - Intergenic
1051863710 9:21654796-21654818 TGGAACAAAAAGGTGGAGGAAGG - Intergenic
1052897714 9:33763401-33763423 TTGCTAAAGAAGGTGGAGGCCGG + Intronic
1053201159 9:36152268-36152290 TTGATTAAGGATGTGTAGGCAGG + Intronic
1055443908 9:76363878-76363900 TTGAAAAAGAGGATGGAGGCAGG + Intergenic
1055837535 9:80461831-80461853 TTGAATAGGAATGTTGAGACAGG - Intergenic
1056009902 9:82317043-82317065 TAGAACAAAAATGTGGAGGAAGG + Intergenic
1056759959 9:89407333-89407355 TGGAACTAGAATGTGATGGCTGG + Intronic
1056779809 9:89540997-89541019 TGGAACAAAAAGGTGGAGGAAGG - Intergenic
1057055477 9:91957253-91957275 TTTAAAAATAATGTGTAGGCTGG + Intergenic
1057323226 9:94033155-94033177 TTGAAAAAGGACGTGCAGGCTGG - Intronic
1057336567 9:94160321-94160343 TGGAACAAAAAGGTGGAGGAGGG - Intergenic
1057515730 9:95718912-95718934 TTGAACATGAATGTGATGTCTGG + Intergenic
1058196487 9:101983395-101983417 TTCAACACCAGTGTGGAGGCTGG - Intergenic
1058438654 9:104987638-104987660 TGGAACAAGAATTTGGAGTCTGG - Intergenic
1058511579 9:105724336-105724358 TTGAAAATGAAGGTTGAGGCTGG + Intronic
1060371131 9:123072785-123072807 TGGAACAAGATGATGGAGGCGGG - Intronic
1061048958 9:128182918-128182940 TTAATTAAGACTGTGGAGGCCGG - Intronic
1061048963 9:128182975-128182997 TTGGACAGGAATGGGGAGGGTGG - Intronic
1061544483 9:131296548-131296570 TACTACAAGAATGTGTAGGCTGG - Intronic
1062203229 9:135320108-135320130 TAGAACAAAAAGGTGGAGGAAGG + Intergenic
1186466967 X:9790875-9790897 TTGGGCAAGAGTGTGGAGTCAGG + Intronic
1186529330 X:10279503-10279525 TTGAACAAAAAGGTGGAGAAAGG - Intergenic
1187632146 X:21185277-21185299 TTGAAGAAGAATGAGGAATCAGG - Intergenic
1188495410 X:30778351-30778373 TAGAACAATAAAGTGGAGGAAGG + Intergenic
1188520596 X:31033695-31033717 TGGAAGAAGAATGAAGAGGCAGG - Intergenic
1188913413 X:35879248-35879270 CTGAATAAGAATGTTGAGACTGG - Intergenic
1189073826 X:37894779-37894801 TAGAACAAAAAGGTGGAGGAAGG + Intronic
1190762869 X:53451088-53451110 GTGAGCAAAGATGTGGAGGCAGG + Intergenic
1192561388 X:72130288-72130310 AGGAACAAGAATGAGGAGGAAGG - Exonic
1193956948 X:87875175-87875197 TTAAACAAAAATTTGGAGACAGG + Intergenic
1194062025 X:89215451-89215473 TGGAAAAAGAGAGTGGAGGCGGG - Intergenic
1195207795 X:102620955-102620977 TTGAACAAGAGTGTTGAGAGAGG + Intergenic
1196070365 X:111514561-111514583 TCAAACAAAAATGTGGAAGCAGG + Intergenic
1197646817 X:129027092-129027114 GTGATCAGGGATGTGGAGGCTGG - Intergenic
1198644445 X:138790471-138790493 AGGAAAAAGACTGTGGAGGCAGG - Intronic
1198979998 X:142384445-142384467 TTGAACAGGAATTTGGAAGAAGG + Intergenic
1199544835 X:148997022-148997044 ATGAACAACAATGTGAAGGTGGG - Exonic
1199715771 X:150506418-150506440 TTTATAAAGAATGTGGAGGAAGG - Intronic
1200105957 X:153712575-153712597 TTTAAAAAGCATGTGGAGGCTGG + Intronic
1200715949 Y:6544752-6544774 TGGAAAAAGAGAGTGGAGGCGGG - Intergenic