ID: 1089536307

View in Genome Browser
Species Human (GRCh38)
Location 11:119162478-119162500
Sequence AATCAGAAGCAGAATGAGCC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 368
Summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 333}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089536307_1089536308 -9 Left 1089536307 11:119162478-119162500 CCAGGCTCATTCTGCTTCTGATT 0: 1
1: 0
2: 2
3: 32
4: 333
Right 1089536308 11:119162492-119162514 CTTCTGATTTCCCCTCCCCCAGG 0: 1
1: 0
2: 2
3: 39
4: 302
1089536307_1089536309 -8 Left 1089536307 11:119162478-119162500 CCAGGCTCATTCTGCTTCTGATT 0: 1
1: 0
2: 2
3: 32
4: 333
Right 1089536309 11:119162493-119162515 TTCTGATTTCCCCTCCCCCAGGG 0: 1
1: 0
2: 4
3: 40
4: 250

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089536307 Original CRISPR AATCAGAAGCAGAATGAGCC TGG (reversed) Exonic
900676538 1:3890690-3890712 GTGCAGAAGCAGAATGAGCCAGG - Exonic
901185289 1:7368958-7368980 AAACAGAAGCAGAAGGAGGAAGG - Intronic
904937671 1:34143207-34143229 AATCAGAGTCAGAATGAGACTGG + Intronic
906564708 1:46790722-46790744 AGTCAGAGGGAGAATGAGCAGGG - Intronic
906581835 1:46941344-46941366 CAGCAGAAGCAGAATGAGCAGGG + Exonic
906601882 1:47137553-47137575 CAGCAGAAGCAGAATGAGCAGGG - Exonic
906895767 1:49769516-49769538 AAGCAGAAAAAGAAAGAGCCAGG + Intronic
907728593 1:57044057-57044079 AATCAGATGAAGAGTGTGCCAGG - Intronic
908019352 1:59884457-59884479 CATCAGAAGCAACATAAGCCAGG + Intergenic
908415431 1:63908871-63908893 ACTCAGATGAAGAATGTGCCAGG + Intronic
908472972 1:64462442-64462464 AAAAATAAGCAGAATTAGCCAGG - Intergenic
909920283 1:81373299-81373321 AACCCTAAGCAGGATGAGCCTGG + Intronic
910235197 1:85028404-85028426 AATCAGCAGAAGAATCATCCTGG - Intronic
910526284 1:88182569-88182591 AATGAGAAGCAGAATGACAAAGG + Intergenic
912703519 1:111895632-111895654 ATTCAGCAGCAGGATGAGTCAGG + Intronic
912792188 1:112663257-112663279 ATTCAAAAGGGGAATGAGCCGGG - Intronic
913252924 1:116927085-116927107 AAACAGAAGCAGAAAGAGCAAGG + Intronic
913397492 1:118388391-118388413 AAGCAGAAGCAGAATGACTCTGG + Intergenic
913446947 1:118960164-118960186 AAACAGAGGCAGAAATAGCCAGG - Intronic
914136863 1:144909180-144909202 AACCAAAACCAGAGTGAGCCAGG + Intronic
915579733 1:156806210-156806232 AGACAGAAACAGAAGGAGCCTGG + Intergenic
916890508 1:169108009-169108031 AATCGGCAGGAGAATGAGTCAGG + Intronic
916928871 1:169553410-169553432 AATCAAAACCACAATGAGGCCGG + Intronic
917695600 1:177520082-177520104 AAAGAAAAGCAGAATGAGCCTGG + Intergenic
918225294 1:182475670-182475692 AATCAGGAGCAGAGTGAGCTTGG - Intronic
919080763 1:192863208-192863230 AATTAGAGCCAGAATTAGCCTGG - Intergenic
919450706 1:197769543-197769565 AATGAGAAGCAGAAAGCACCTGG + Intronic
920362256 1:205427060-205427082 AACCAGAGGCAGTATGACCCCGG - Intronic
920410593 1:205757108-205757130 AATCAAAACCACAATGAGCCGGG - Intergenic
922914014 1:229240861-229240883 AACCAGAAGCAGAGGGGGCCCGG + Intergenic
923683990 1:236141994-236142016 AATCAGCAGCAGAATGCGCGAGG + Intergenic
924597624 1:245461246-245461268 AAGCAGAAGCAGAATCAGTCTGG - Intronic
924675105 1:246167805-246167827 AATCAAAACCACAATGAGGCTGG - Intronic
1063362607 10:5470133-5470155 GATCAGTAGCAGGATGGGCCAGG - Intergenic
1064527560 10:16273612-16273634 AAATACAAGCAGAATTAGCCAGG + Intergenic
1064999203 10:21321665-21321687 AATAAAAAGCAAAATTAGCCAGG + Intergenic
1065502693 10:26397786-26397808 AATCAGAATCTGAATGAGGGTGG - Intergenic
1069498025 10:68924440-68924462 AATAAGAGGCAGAATAAGCTGGG - Intronic
1070485454 10:76926285-76926307 AATTAGAAACAGAAAGAGGCAGG - Intronic
1072311288 10:94157760-94157782 AATCAGAGGGTGAATGAGGCAGG - Intronic
1072548190 10:96456744-96456766 AATCAGATCCACAATGTGCCAGG + Intronic
1072690822 10:97571315-97571337 AATCTCCAGCAGAGTGAGCCTGG + Intergenic
1072936441 10:99717936-99717958 AACCAGAAGCTCAAGGAGCCAGG - Intronic
1073119181 10:101111210-101111232 CATCAGAAGCAGCAAGAGCTGGG - Intronic
1074449115 10:113544899-113544921 AAGCAGAAACAGACAGAGCCAGG - Intergenic
1074945744 10:118278986-118279008 ATTCAGCAGGAGAATGTGCCAGG - Intergenic
1075310049 10:121406279-121406301 AATCAGAGTCGGGATGAGCCAGG + Intergenic
1075375734 10:121976411-121976433 AATCAGAATCAGGCTGTGCCTGG - Intergenic
1075397355 10:122137290-122137312 AAAAAAAAGCAGAATGAGCCTGG + Intronic
1075524029 10:123167263-123167285 ATTCAGAAAGAGAATGACCCTGG - Exonic
1076293220 10:129363659-129363681 AAACAGAAGCAGAACCAGTCAGG - Intergenic
1076486919 10:130827214-130827236 AATCAGTAGCAGAAAGATACTGG + Intergenic
1077109722 11:856759-856781 AATCAAAAGCAGGATGAGCAGGG - Intronic
1077858288 11:6151453-6151475 AATCAGAAAGTGAAGGAGCCAGG + Intergenic
1078650753 11:13189849-13189871 AATCAGAAGCAGAAGTAACCTGG + Intergenic
1079170244 11:18086829-18086851 AATGAAAAACAGTATGAGCCTGG + Intronic
1081440022 11:43070239-43070261 AATAATAAGCAAAATGTGCCAGG + Intergenic
1084722154 11:70913816-70913838 AACCAGAAGCACAGAGAGCCTGG - Intronic
1084908172 11:72365021-72365043 AATCAAAACCACAATGAGGCTGG + Intronic
1086529310 11:87764808-87764830 AATCAGAAACAAAATGCTCCTGG - Intergenic
1087930513 11:103972418-103972440 AATAAAAAGGAGAATGAGACAGG - Intronic
1088621499 11:111689074-111689096 AAACAGAAGCAGAATGTTGCAGG + Intronic
1089031655 11:115336615-115336637 AATCAGAACCAAAATAAGTCAGG + Intronic
1089536307 11:119162478-119162500 AATCAGAAGCAGAATGAGCCTGG - Exonic
1090161024 11:124495665-124495687 GAACAGAAGCAGATTGATCCTGG - Intergenic
1090894435 11:130958011-130958033 AACCAGAAGTACAATGAGTCAGG - Intergenic
1093206191 12:16253572-16253594 AATCAAAACCATAATGAGGCTGG + Intronic
1094220324 12:27985960-27985982 ATTCAGAGGAAGGATGAGCCTGG + Intergenic
1094232014 12:28116636-28116658 AATCTGAAGAAGAATAAGCTGGG + Intergenic
1094371584 12:29744245-29744267 AAGATGAAGCAGAATGAACCAGG + Intronic
1095728295 12:45475769-45475791 AATAAGAATCAGAATGCACCTGG - Intergenic
1095945981 12:47753625-47753647 AATGAGAAGGAGGAGGAGCCAGG + Intronic
1096084291 12:48855277-48855299 AAACAAAAACAGAATTAGCCGGG + Intergenic
1096165597 12:49420852-49420874 AATTAGAAACAAAATTAGCCAGG + Intronic
1096510860 12:52127445-52127467 AATCAGAAGCTGTGTGACCCTGG + Intergenic
1096752355 12:53769139-53769161 AATCAGAAGCAGACTGTGGGGGG - Intergenic
1097437421 12:59568346-59568368 ACTGAGAAGCAGAATGAGAGGGG + Intergenic
1098342512 12:69467309-69467331 AACCTGGAGCCGAATGAGCCTGG + Intergenic
1098853774 12:75629032-75629054 AATCAAAGGCACCATGAGCCAGG - Intergenic
1099062860 12:77934078-77934100 AATCTGGAACTGAATGAGCCTGG - Intronic
1099086376 12:78251645-78251667 AAGCAGAAACAGAAGTAGCCTGG + Intergenic
1099326790 12:81226478-81226500 AATCAGAAGACAGATGAGCCTGG - Intronic
1102701514 12:114843436-114843458 AGCCAGAAGCAGAAGGAGCGAGG - Intergenic
1103112111 12:118289692-118289714 ATTTAGAAACAGAATGAACCTGG + Intronic
1106139251 13:26997830-26997852 AAACAGAAGCAGATGGAGGCTGG - Intergenic
1108105822 13:47007850-47007872 AATTAAAAGCTGAAGGAGCCAGG + Intergenic
1109699394 13:66005958-66005980 AGCCAGAAACACAATGAGCCAGG + Intergenic
1110086036 13:71381036-71381058 ATTAAGAAACAGAATTAGCCAGG + Intergenic
1110694674 13:78474207-78474229 GATAAGATGCAAAATGAGCCAGG - Intergenic
1111249194 13:85581095-85581117 AGTTAGAAGCAAAATGATCCTGG - Intergenic
1111256167 13:85671540-85671562 AATGAGAAGCAAAGTCAGCCTGG + Intergenic
1111423913 13:88054205-88054227 AACCAGAAGAAGAATGAAACTGG - Intergenic
1112029971 13:95447963-95447985 AAGCAGAGGCAGAAAGAGCCTGG - Intronic
1114443479 14:22769938-22769960 AGTCAGTTGCAGAATGAGCGTGG + Intronic
1114650619 14:24282219-24282241 AAGCAGAAGCAGCATGATGCAGG + Intergenic
1114860725 14:26517228-26517250 TAGCAGCAGCAGAATGAGCAAGG - Intronic
1115114838 14:29867698-29867720 GTACAGAGGCAGAATGAGCCAGG + Intronic
1118454259 14:65930416-65930438 AATAAGAAGGAAAATTAGCCAGG - Intergenic
1119211261 14:72833883-72833905 AATCAAAACCACAATGAGGCCGG + Intronic
1119371012 14:74143251-74143273 TGACAGAAACAGAATGAGCCTGG + Intronic
1120111350 14:80561034-80561056 ACTTAGAAGCAGAATGAACTTGG + Intronic
1124006038 15:25796242-25796264 AAACAGAAACAAAATTAGCCAGG + Intronic
1124127976 15:26955726-26955748 AACAAGATGCAGAATCAGCCAGG + Intergenic
1124801810 15:32840081-32840103 AATCCAAAGCAGAATGGGCTGGG + Intronic
1125352328 15:38780941-38780963 AATCAGAAGCTGAAGGAGAAGGG - Intergenic
1126770730 15:52053370-52053392 AATCAAAACCACAATGAGGCCGG - Intronic
1126800715 15:52295011-52295033 CATCAGAAGCTGAAGCAGCCTGG - Intronic
1127406032 15:58647419-58647441 ATTCAGAAACAAAATTAGCCAGG - Intronic
1128129076 15:65213619-65213641 TATCAGAATCAGAAACAGCCAGG - Intergenic
1128176408 15:65560170-65560192 AATCAAAAGCAGCCTAAGCCAGG - Intronic
1128805245 15:70526137-70526159 AGGCAGAAGCAGAATGAGTTGGG - Intergenic
1128860686 15:71068873-71068895 AAAAAAAATCAGAATGAGCCTGG + Intergenic
1128882338 15:71255198-71255220 AATCAGAAGGAAAAGGAGCCTGG - Intronic
1129600446 15:76995340-76995362 AATCAGCAGCAAAATGAGGAAGG - Exonic
1129966228 15:79738349-79738371 TATCAGTCGCAGAGTGAGCCTGG - Intergenic
1130226434 15:82062027-82062049 ACTCAGAAGCAAGATGAACCTGG + Intergenic
1131129868 15:89891361-89891383 AATCAAAACCACAATGAGCTGGG + Intronic
1133078586 16:3299699-3299721 ATTCAGAGGAAGGATGAGCCGGG + Exonic
1133782495 16:8950674-8950696 ATTCAGAAGCTGTATGTGCCTGG + Intronic
1136079033 16:27839458-27839480 AAACAGAAGCAGAAAGCGCAAGG + Intronic
1136756044 16:32684944-32684966 AATCACAAGCAGAAGGAAACTGG + Intergenic
1136812069 16:33185428-33185450 AATCACAAGCAGAAGGAAACTGG - Intergenic
1136818545 16:33295508-33295530 AATCACAAGCAGAAGGAAACTGG - Intronic
1136825109 16:33352041-33352063 AATCACAAGCAGAAGGAAACTGG - Intergenic
1136830175 16:33450812-33450834 AATCACAAGCAGAAGGAAACTGG - Intergenic
1137015791 16:35373189-35373211 AATCACAAGCAGAAGGAAACTGG + Intergenic
1137024856 16:35463143-35463165 AATCACAAGCAGAAGGAAACTGG - Intergenic
1137582744 16:49643887-49643909 CGTCAGCAGCAGAAAGAGCCAGG + Intronic
1137782474 16:51109253-51109275 ACTCAGAAACAGAATGAGAGGGG - Intergenic
1137844580 16:51674641-51674663 AATCAGAAGGAGAGTGAGTGAGG + Intergenic
1138860455 16:60749851-60749873 ACCCAGAAGCAGACTCAGCCAGG - Intergenic
1139934270 16:70556961-70556983 ACTGAGAAGCAGGATGAGCTGGG + Exonic
1202990647 16_KI270728v1_random:8398-8420 AATCACAAGCAGAAGGAAACTGG - Intergenic
1203058184 16_KI270728v1_random:945297-945319 AATCACAAGCAGAAGGAAACTGG + Intergenic
1143238313 17:5421944-5421966 AAACAGAAACAAAATTAGCCGGG - Intronic
1143591844 17:7889729-7889751 AAGCAGAAGGAGAACAAGCCAGG + Exonic
1143934314 17:10466449-10466471 AATAAGTAGCAGAAAAAGCCAGG + Intronic
1145720072 17:27062957-27062979 AAATAGAAGCAGAATAAGACTGG + Intergenic
1146299612 17:31677946-31677968 AGTCAGAAGCTGAAGGAGCAGGG + Intergenic
1146561080 17:33871201-33871223 GTTCAGAAGCTGAATGAGGCTGG + Intronic
1146567239 17:33923951-33923973 ACTCACAGGCAGAATGGGCCAGG + Intronic
1146703093 17:34979450-34979472 AATGCGCAGCAGAATGAACCAGG - Intronic
1147422551 17:40329748-40329770 AATCAAAAGCACAATGAGGCTGG - Intronic
1148733834 17:49853397-49853419 TTTCAGAAGCAGAGGGAGCCAGG + Intergenic
1148841052 17:50497491-50497513 AAAAAGAAGCAGAAGGGGCCAGG + Intergenic
1149917031 17:60619844-60619866 AATCAAAAACAAAATGAGACAGG - Intronic
1149974223 17:61249945-61249967 AATCAGAAATTGAATGAGGCAGG + Intronic
1150926313 17:69535685-69535707 AAACAGAAGCAAAAAGAACCAGG + Intronic
1151042820 17:70883320-70883342 AATCAAAAGCAGAGTGTGTCAGG + Intergenic
1152439960 17:80300846-80300868 AATCAAAATCACAATGAGGCCGG - Intronic
1152613272 17:81326044-81326066 AATGAGAAGCAAAGTGGGCCAGG + Intronic
1153236289 18:2991549-2991571 AAACATAAACAAAATGAGCCAGG + Intronic
1158465957 18:57690104-57690126 GGTCAGAAACAGAATGAGTCAGG + Intronic
1160863303 19:1246661-1246683 CACTGGAAGCAGAATGAGCCTGG + Intergenic
1163138222 19:15329066-15329088 AAAAAAAAGCAGAATGCGCCGGG - Intronic
1163692333 19:18744586-18744608 AGTCAGAGGCAGAATGAAGCGGG - Intronic
1164713684 19:30376558-30376580 TTTCAGAAACAGAATGGGCCAGG + Intronic
1164813223 19:31174787-31174809 GATGAGAACCAGAAGGAGCCAGG + Intergenic
1165012585 19:32859622-32859644 AAGCAGAGGCAGAAAGTGCCAGG - Intronic
1166055767 19:40287524-40287546 AACCAAAACCAGAAAGAGCCGGG - Intergenic
1166869241 19:45861276-45861298 AAGCAGAAGAAGAATGAAACAGG - Intronic
1168075576 19:53979338-53979360 ACTCAGAAGTAGATTCAGCCTGG + Intronic
1168360961 19:55739930-55739952 AAACAGAAGAAGAAAAAGCCTGG + Intergenic
926145429 2:10394329-10394351 AACCAGCAGCAGAATGTACCAGG - Intronic
926811697 2:16760724-16760746 AATCAGAAGCAACATGGGCAAGG - Intergenic
927481654 2:23458673-23458695 CATCAGAATCAGCATGAACCAGG + Intronic
928563484 2:32517178-32517200 AATCATAACCAAAATTAGCCGGG + Intronic
928657841 2:33471767-33471789 AATTAGAAGCAAACTGACCCAGG - Intronic
928746417 2:34421118-34421140 AAGCAGAAGAAGAAAGAGACAGG - Intergenic
929497028 2:42454061-42454083 AATCAGAACCACAATGAGGATGG + Intronic
930075260 2:47401160-47401182 ATTCAGCAGCAGAATCACCCTGG - Intergenic
931131425 2:59340882-59340904 AGTAAGAAGCAGAATGAGACAGG + Intergenic
931522910 2:63119002-63119024 AAGCTGAAGAAGAATGAGGCTGG - Intergenic
932025899 2:68132298-68132320 AATCAGAAGCAGAATGGAAAGGG + Intronic
932465181 2:71917120-71917142 CATGAGAAGAAGAAGGAGCCTGG - Intergenic
932470255 2:71950528-71950550 AATCAGAAGTGGACAGAGCCTGG + Intergenic
932599861 2:73116187-73116209 AAACAGAAGCAGGAAGAGCTTGG + Intronic
933535493 2:83567875-83567897 AATCAAAGGCAAAATGATCCTGG - Intergenic
934530408 2:95083608-95083630 AGCCAGAAGCAGGAGGAGCCTGG - Intergenic
936066730 2:109338026-109338048 CATCAAAAACAGAAGGAGCCTGG - Intronic
937877621 2:126837297-126837319 AATCAGAAGGGGACAGAGCCTGG + Intergenic
939347247 2:140981460-140981482 ACACAGTAACAGAATGAGCCAGG - Intronic
939691371 2:145265953-145265975 AGGCAGAAGCAGAATGATCTGGG + Intergenic
940006437 2:149012849-149012871 AATCAGAAATAGAATGAAACTGG + Intronic
940448074 2:153801916-153801938 AATTAGAAGCAGAAAGACACAGG - Intergenic
940855862 2:158728378-158728400 GCTCTGAAGCAGAATAAGCCAGG + Intergenic
941418901 2:165257832-165257854 AATCAAAACCACAATGAGGCTGG - Intronic
943202843 2:184851370-184851392 ACTCAGAAGCAGAAAGAGAATGG - Intronic
943357133 2:186870579-186870601 ACTTAGAAGCAGTCTGAGCCAGG + Intergenic
943778120 2:191790188-191790210 AAACATAAGCAGAAAGAGCAAGG - Intergenic
945621953 2:212150687-212150709 AAGCACAAGAAGAATGAGTCTGG - Intronic
945953288 2:216060995-216061017 AATCAAAAATGGAATGAGCCGGG + Intronic
946651661 2:221898050-221898072 AATCAGAGGCAGGATAAGACTGG - Intergenic
947182303 2:227422010-227422032 ATTAAGAAGCAAAATGAGGCTGG - Intergenic
947231194 2:227888389-227888411 AAGCAGAAGCAGGATCAGGCGGG + Intronic
947420003 2:229933562-229933584 AAAGAGAAGCATCATGAGCCGGG + Intronic
947719751 2:232363278-232363300 AAACAGTAGCTGAATGTGCCTGG + Intergenic
949037675 2:241824828-241824850 AAAAAGAAGAAGAATGAGGCTGG - Intergenic
1169103637 20:2974680-2974702 AATCAAAACCAAAATGAGGCCGG - Intronic
1170622536 20:18007829-18007851 ATTCAGAAGCAGAAGCTGCCAGG + Intronic
1172299962 20:33842463-33842485 ATTCACTGGCAGAATGAGCCAGG + Intronic
1172811659 20:37652346-37652368 AAGAAGAAGAAGAAAGAGCCAGG - Intergenic
1173060023 20:39651817-39651839 AGCCAGAAGCAGAGTCAGCCAGG + Intergenic
1173283291 20:41648422-41648444 AATCTTGAGCAGAATGATCCAGG - Intergenic
1173499145 20:43539679-43539701 ATTCTGAAGCAGAATCACCCTGG + Intronic
1174214394 20:48904869-48904891 TATCAGAAGCAAAATGTGCTGGG + Intergenic
1175373018 20:58505358-58505380 AACAAGAAACACAATGAGCCAGG - Intronic
1176302100 21:5103320-5103342 AAACAAAAACAGAATTAGCCGGG + Intergenic
1176387602 21:6146572-6146594 AAACAGAAGCAGTAGGAGACGGG + Intergenic
1178990715 21:37353455-37353477 AATCAGCAGGAGATTGAGGCAGG - Intergenic
1179090475 21:38260795-38260817 AATTAGCAACAGAATAAGCCAGG + Intronic
1179164648 21:38925922-38925944 GATCAGAAGGAAGATGAGCCTGG + Intergenic
1179735870 21:43391676-43391698 AAACAGAAGCAGTAGGAGACGGG - Intergenic
1179854929 21:44158575-44158597 AAACAAAAACAGAATTAGCCGGG - Intergenic
1180847732 22:18993417-18993439 AAGCAGGAGAAGAATGAGGCTGG - Intergenic
1181935750 22:26437173-26437195 GGTCAGAAGCAGGATAAGCCTGG + Intronic
1182165884 22:28172508-28172530 AACCAGAAGCAGAAGATGCCAGG - Intronic
1183081882 22:35462092-35462114 AATCAGAAGCAAATGGGGCCGGG - Intergenic
1183627871 22:39015617-39015639 AATTGGAAGTAGAATGTGCCTGG - Exonic
1183996560 22:41637832-41637854 AATCAGAAGCAGGCTGGGCGCGG + Intronic
1184732710 22:46379645-46379667 AAGCAGGAGAAGAATGAGGCTGG + Intronic
949200680 3:1375323-1375345 TTTCAGTAGCAGAATGAGACTGG + Intronic
949338363 3:3001992-3002014 AATCTGAAGCAAATTGAGGCAGG + Intronic
950010697 3:9721628-9721650 AAACAGAAGCAGAGTAGGCCTGG + Intronic
950446645 3:13042590-13042612 AGACAGCAGCAGCATGAGCCGGG - Intronic
952235145 3:31471632-31471654 AGCCAGAAACAGAATGAGCCAGG + Intergenic
952920962 3:38283532-38283554 CATCAGAAGTAGCAGGAGCCGGG + Intronic
954159148 3:48707732-48707754 CATTAAAACCAGAATGAGCCTGG - Intronic
954335321 3:49913046-49913068 AGCCAGATGCAGAATGAGCCTGG + Intronic
956028114 3:65005697-65005719 AGACAGATGCAGAATGAGTCAGG - Intergenic
957024054 3:75159509-75159531 AATAAGAATCATAATGGGCCAGG - Intergenic
959465715 3:106684183-106684205 AATCAGAATGAGAATCAACCAGG - Intergenic
959563162 3:107805677-107805699 GAGCAGAAACAGAATGATCCTGG + Exonic
960205128 3:114887610-114887632 CATCAGAAGCTGGAAGAGCCAGG + Intronic
960263016 3:115589749-115589771 AATCTCAAACAGAATCAGCCTGG - Intergenic
960319709 3:116219877-116219899 AATCAAAATCACAATGAGCCGGG + Intronic
961084794 3:124057625-124057647 ACTCCCAAGCAGAAGGAGCCTGG + Intergenic
961581970 3:127890781-127890803 AATCAGAATCAGAATGAGTCAGG - Intergenic
964458495 3:156895316-156895338 AATCAAAACCACAATGAGGCTGG + Intronic
965667529 3:171111124-171111146 AATTAAAACCACAATGAGCCAGG + Intronic
966448955 3:180036590-180036612 AAACCGAAGCAGAATGTACCAGG - Exonic
967325300 3:188232647-188232669 AATAACAAGCAGAGTTAGCCAGG - Intronic
967690896 3:192472493-192472515 AATCAGAGGGAGAAAAAGCCAGG - Intronic
967830327 3:193913038-193913060 AAGCAGAAGCTGAAAGATCCAGG - Intergenic
968604077 4:1523360-1523382 AAACAGAAGAAGAATGGGGCAGG - Intergenic
970678569 4:18481019-18481041 AAGCAGAGGTAGAAAGAGCCAGG + Intergenic
971078069 4:23173479-23173501 AATTAGAAGAAGAATTAGCATGG - Intergenic
972705490 4:41538776-41538798 AGTCAGGAGCAGAATGTGACAGG - Intronic
972763478 4:42130182-42130204 AATCAAAACCACAATGAGGCTGG + Intronic
974044826 4:56890014-56890036 AATCAAAACCACAATGAGGCCGG + Intergenic
976376251 4:84348898-84348920 TATCAGAAGGAGACTGGGCCAGG + Intergenic
976598890 4:86919619-86919641 AAAAAGAAGCAGAATGGGGCCGG - Intronic
977285303 4:95098649-95098671 AAGCAGCAGCAGAATGAACCTGG - Intronic
977858379 4:101924523-101924545 AAACAGAAGCAGAAAGGGTCAGG + Intronic
978710968 4:111780636-111780658 AATCAAAACCACAATGAGGCTGG + Intergenic
982230163 4:153201258-153201280 AATCAAAAACACAATGAGGCTGG - Intronic
982722905 4:158877775-158877797 AATCTGAAGTAGAATTAGCAGGG + Intronic
985556296 5:559813-559835 AATAATAAGAAGAATTAGCCAGG - Intergenic
985987423 5:3528042-3528064 AATCAGAACAAGATTTAGCCAGG + Intergenic
986251236 5:6060304-6060326 AATAGGAAGCAGGAGGAGCCTGG + Intergenic
987070554 5:14333467-14333489 AATCAGAAGAATGATGGGCCAGG - Intronic
987173648 5:15284883-15284905 AGTCAGAGGCAGAAGAAGCCAGG - Intergenic
987956160 5:24743413-24743435 AATCAGAAACATAATGAATCTGG - Intergenic
988819648 5:34868901-34868923 AAACACAGACAGAATGAGCCTGG - Exonic
989159057 5:38372453-38372475 AAAAAGAAGCAGTATGAGGCCGG - Intronic
990601417 5:57362328-57362350 AAAAAGAAGCAAAATTAGCCAGG + Intergenic
990816650 5:59793171-59793193 ACTCAGAGGCAGAATGACTCAGG + Intronic
990864679 5:60367694-60367716 AATGACAAGCATACTGAGCCAGG - Intronic
993776501 5:92005368-92005390 AAGCAGAACAAAAATGAGCCAGG + Intergenic
993973850 5:94453032-94453054 AATCTGAAGCAGACTCATCCAGG + Intronic
994145624 5:96391877-96391899 AATCAGAAGCAGAAACTGGCAGG - Exonic
996929059 5:128864292-128864314 AATTAGAAGGTGAATTAGCCAGG - Intronic
997736595 5:136216824-136216846 AAGCAGAAGCAGACACAGCCGGG + Intronic
997750137 5:136336474-136336496 AATGAGAAGCAGAAAGGGCTAGG + Intronic
998163758 5:139828658-139828680 TTTCAGAAGCAGGATGAGGCAGG - Intronic
999057682 5:148597488-148597510 AGTAAGAAGAAGAATGAGACAGG - Intronic
999251079 5:150182746-150182768 CCTGAGAAGCAGAAGGAGCCGGG - Exonic
999680964 5:154059692-154059714 AATCAGAAGCAGTAAGTGCTAGG + Intronic
1000006408 5:157188768-157188790 AATCAACAACAGAATTAGCCAGG - Intronic
1000850429 5:166333294-166333316 AAAGAGAAGCAGCAGGAGCCAGG + Intergenic
1001759461 5:174195244-174195266 AATCAGAACCACCATGAGACTGG + Intronic
1001842219 5:174887652-174887674 AAGCAGAGGCAGCAGGAGCCAGG - Intergenic
1003340714 6:5217868-5217890 AAGGAGAAGCAGACTGAGCCAGG + Intronic
1003982078 6:11399476-11399498 AATCAAAACCACAATGAGCTGGG + Intergenic
1004440764 6:15650576-15650598 AATCAAAACCACAATGAGGCCGG - Intronic
1004472750 6:15943774-15943796 AATCAGACTCAGAATGTCCCTGG - Intergenic
1004735181 6:18398688-18398710 CATCAGCAGAAGAATGAGGCTGG - Intronic
1005366468 6:25083365-25083387 AATCAGAAGCATGAGGAGACAGG + Intergenic
1005526963 6:26660236-26660258 AATCAGAAACATAATCAGCAAGG - Intergenic
1006476592 6:34259208-34259230 AATCAGAACCACAATGGGTCAGG + Intergenic
1007060941 6:38940435-38940457 AGTCAGAATCAGAATAGGCCAGG + Intronic
1007367714 6:41406635-41406657 AAGCAGAAGCAGAAGGAGGTTGG + Intergenic
1007880634 6:45162232-45162254 AAGAAGAAGAAGAAAGAGCCAGG + Intronic
1008140867 6:47830622-47830644 AATAAGTAGCAGAATGAACCAGG + Intronic
1009314633 6:62203091-62203113 AATCTGCAGTAGAAGGAGCCAGG + Intronic
1009526458 6:64752248-64752270 AATCAGAAAGAGAATGACTCAGG + Intronic
1010118483 6:72343604-72343626 ATTAAGAAAAAGAATGAGCCAGG - Intronic
1010223713 6:73469690-73469712 AATCACCACCAGAATCAGCCAGG - Intronic
1010786047 6:80003115-80003137 ACTCATAAGCAGATTGAGTCAGG - Intergenic
1012556911 6:100524736-100524758 ACTAAGAAGCAGAGAGAGCCTGG - Intronic
1015948928 6:138531806-138531828 TATCAGAAAAAGAATTAGCCAGG - Intronic
1016341979 6:143072085-143072107 AATTAAAACCACAATGAGCCAGG - Intronic
1017442935 6:154480532-154480554 AATCGCATGGAGAATGAGCCAGG - Intronic
1017473424 6:154763157-154763179 AATGAAAAGCAGAATGAGGAGGG - Intronic
1017995440 6:159528010-159528032 AATCAGATGCAGATGGAGCCTGG + Intergenic
1018579145 6:165292694-165292716 AAGGAGAAGCAGAGTCAGCCTGG + Intronic
1021111135 7:16696033-16696055 CTTCAAAAGCAGAAGGAGCCGGG - Intronic
1021939520 7:25665873-25665895 AAGCAAGAGGAGAATGAGCCAGG + Intergenic
1022195998 7:28067884-28067906 ACTTAGAAGCAGAAGGAGACGGG - Intronic
1022417872 7:30193472-30193494 AATCAAAAGCAGAACCACCCTGG - Intergenic
1022441759 7:30439018-30439040 AATCAAAACCACAATGAGACAGG + Intronic
1023018416 7:35987877-35987899 AGTAAGAAGTAGAATGAGCCAGG + Intergenic
1023498887 7:40827494-40827516 AATCAGAAGCAGATTGGAGCTGG - Intronic
1025823097 7:64989776-64989798 AAGAAGAAGAAGAATAAGCCAGG + Intronic
1028314157 7:89378948-89378970 AATGAGAAGCAGAAATAGCCTGG + Intergenic
1028951266 7:96637813-96637835 AATCAGAATAAGAATTAGCCAGG - Intronic
1029595784 7:101537043-101537065 AATCAGGACCAGCCTGAGCCAGG - Intronic
1029624352 7:101710586-101710608 AAGCAGAAACAGGATGTGCCTGG + Intergenic
1031475714 7:122218682-122218704 AACCACAAGTAGAAGGAGCCTGG + Intergenic
1031651444 7:124295589-124295611 AATCAGAAGCAGAGGGACCATGG + Intergenic
1032095577 7:128937099-128937121 AATCATAAGCAAAATCAACCAGG + Intergenic
1033686030 7:143642426-143642448 AATCAGAAGGTGAGTGAGACAGG + Intronic
1033689712 7:143724889-143724911 AATCAGAAGGTGAGTGAGACAGG - Exonic
1033698583 7:143815195-143815217 AATCAGAAGGTGAGTGAGACAGG - Intergenic
1033905635 7:146198745-146198767 AATAAGAAGAAAAATGACCCTGG + Intronic
1034057766 7:148054265-148054287 AATAAGAAGTGGAATTAGCCGGG - Intronic
1034717950 7:153261083-153261105 CCTCAGCAGCAGAATGGGCCAGG - Intergenic
1036453805 8:8891814-8891836 CATCAGGAGCAGCTTGAGCCGGG + Exonic
1037533337 8:19801555-19801577 AATAACAAGCAGACTGGGCCAGG + Intergenic
1037977847 8:23225778-23225800 AACCAAAAGCAGGATGAGCCGGG - Intergenic
1038056638 8:23864733-23864755 GATGAGAATCAGACTGAGCCTGG + Intergenic
1038225051 8:25648054-25648076 AATCAAAACCACAATGAGGCTGG - Intergenic
1038894973 8:31772451-31772473 AATCCGAAGGAAAATAAGCCTGG - Intronic
1041063448 8:54058973-54058995 AATTAGAATCAGACTCAGCCAGG - Intronic
1041196126 8:55402965-55402987 AATCAGAATCAGAAAGGGCCAGG + Intronic
1042101256 8:65277976-65277998 AATAAAAAGCAGACCGAGCCAGG + Intergenic
1043015982 8:74940921-74940943 AATAAGCAGCAGAAGTAGCCAGG - Intergenic
1044015970 8:87049141-87049163 AATCAGCAGCAAAAAGACCCAGG - Intronic
1044657824 8:94566675-94566697 AATCAAAACCACAATGAGCCTGG + Intergenic
1045784618 8:105905621-105905643 AAACAGAAGCAAAATGAGGAAGG + Intergenic
1046980079 8:120327671-120327693 AATCACAGGTAGAATGAGTCTGG - Intronic
1049541112 8:143209441-143209463 CATCAGAATCAGAGAGAGCCGGG + Intergenic
1049664261 8:143836013-143836035 CACCAGAAGCAGAGTGAGCTGGG + Exonic
1051491586 9:17672859-17672881 ATTCTGAAACAGAATGAGGCTGG - Intronic
1051731320 9:20146244-20146266 CATCAGAAGCAGAGAGAGTCTGG + Intergenic
1052842356 9:33303473-33303495 GCCCAGAAGCAGCATGAGCCTGG - Intronic
1053116521 9:35509051-35509073 AATCAGAATCAGAATGAGGCTGG + Intronic
1055114834 9:72595159-72595181 AATCAGAAGCAGAGGAGGCCAGG - Intronic
1055160721 9:73123662-73123684 AATAACAATCAGACTGAGCCAGG - Intergenic
1056821058 9:89842449-89842471 AATGAGAAGCAGAAGCTGCCGGG + Intergenic
1058179667 9:101781278-101781300 AATCAGAAGAGGAAAGAGCTTGG - Intergenic
1058574736 9:106388525-106388547 AATGAGAAGCAACATGATCCAGG - Intergenic
1058644995 9:107123143-107123165 AAGCAGAAGGAGTATGAGCTTGG + Intergenic
1061613130 9:131761860-131761882 CATCAATAGCAGAATGGGCCAGG - Intergenic
1061615394 9:131775636-131775658 AACCAGAGGCAGAGTGACCCTGG + Intergenic
1061998620 9:134204289-134204311 AATCAGAAACAGAAGGAGCAGGG - Intergenic
1186519134 X:10189841-10189863 AGTCAGAACCAGAATCAGCAAGG + Intronic
1187087615 X:16057980-16058002 AATCAAAACCATAATGAGGCTGG + Intergenic
1188314824 X:28660065-28660087 AAGCAGAAGCAGAGTGAGGATGG + Intronic
1190415210 X:50174119-50174141 AAAAAGAAGCTGAATGAGGCTGG + Intergenic
1190991938 X:55560830-55560852 AATAAGAGGCAGAATATGCCAGG - Intergenic
1191110807 X:56802177-56802199 AATCAACAGCATAATGACCCAGG - Intergenic
1193006319 X:76622565-76622587 AATCATAAGCAAAAAGAGCAGGG + Intergenic
1196362161 X:114874803-114874825 AATCAAAACCATAATGAGGCCGG - Intronic
1197431480 X:126371764-126371786 AATCACAGGCAGAATGAAACTGG + Intergenic
1198105352 X:133456242-133456264 TATAAGAAATAGAATGAGCCCGG - Intergenic
1199067612 X:143438837-143438859 ACTGGGAAGGAGAATGAGCCAGG - Intergenic
1200086242 X:153608025-153608047 AATCAAAACTAGAATGAGGCTGG + Intergenic