ID: 1089537166

View in Genome Browser
Species Human (GRCh38)
Location 11:119168175-119168197
Sequence CTGGGCTCACGTAGCCCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 115}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089537166_1089537178 15 Left 1089537166 11:119168175-119168197 CCTTCTGGGCTACGTGAGCCCAG 0: 1
1: 0
2: 0
3: 5
4: 115
Right 1089537178 11:119168213-119168235 GGAAGTGTAGGGATAAGGGTGGG 0: 1
1: 0
2: 1
3: 30
4: 352
1089537166_1089537182 24 Left 1089537166 11:119168175-119168197 CCTTCTGGGCTACGTGAGCCCAG 0: 1
1: 0
2: 0
3: 5
4: 115
Right 1089537182 11:119168222-119168244 GGGATAAGGGTGGGGGCTTTGGG 0: 1
1: 0
2: 1
3: 30
4: 310
1089537166_1089537176 11 Left 1089537166 11:119168175-119168197 CCTTCTGGGCTACGTGAGCCCAG 0: 1
1: 0
2: 0
3: 5
4: 115
Right 1089537176 11:119168209-119168231 GTGTGGAAGTGTAGGGATAAGGG 0: 1
1: 0
2: 2
3: 12
4: 251
1089537166_1089537174 4 Left 1089537166 11:119168175-119168197 CCTTCTGGGCTACGTGAGCCCAG 0: 1
1: 0
2: 0
3: 5
4: 115
Right 1089537174 11:119168202-119168224 TGGAAGTGTGTGGAAGTGTAGGG 0: 1
1: 0
2: 2
3: 35
4: 411
1089537166_1089537175 10 Left 1089537166 11:119168175-119168197 CCTTCTGGGCTACGTGAGCCCAG 0: 1
1: 0
2: 0
3: 5
4: 115
Right 1089537175 11:119168208-119168230 TGTGTGGAAGTGTAGGGATAAGG 0: 1
1: 0
2: 1
3: 24
4: 337
1089537166_1089537170 -6 Left 1089537166 11:119168175-119168197 CCTTCTGGGCTACGTGAGCCCAG 0: 1
1: 0
2: 0
3: 5
4: 115
Right 1089537170 11:119168192-119168214 GCCCAGGGTGTGGAAGTGTGTGG 0: 1
1: 0
2: 5
3: 48
4: 367
1089537166_1089537180 17 Left 1089537166 11:119168175-119168197 CCTTCTGGGCTACGTGAGCCCAG 0: 1
1: 0
2: 0
3: 5
4: 115
Right 1089537180 11:119168215-119168237 AAGTGTAGGGATAAGGGTGGGGG 0: 1
1: 0
2: 1
3: 24
4: 351
1089537166_1089537177 14 Left 1089537166 11:119168175-119168197 CCTTCTGGGCTACGTGAGCCCAG 0: 1
1: 0
2: 0
3: 5
4: 115
Right 1089537177 11:119168212-119168234 TGGAAGTGTAGGGATAAGGGTGG 0: 1
1: 0
2: 1
3: 27
4: 332
1089537166_1089537183 30 Left 1089537166 11:119168175-119168197 CCTTCTGGGCTACGTGAGCCCAG 0: 1
1: 0
2: 0
3: 5
4: 115
Right 1089537183 11:119168228-119168250 AGGGTGGGGGCTTTGGGAACTGG 0: 1
1: 0
2: 4
3: 50
4: 479
1089537166_1089537179 16 Left 1089537166 11:119168175-119168197 CCTTCTGGGCTACGTGAGCCCAG 0: 1
1: 0
2: 0
3: 5
4: 115
Right 1089537179 11:119168214-119168236 GAAGTGTAGGGATAAGGGTGGGG 0: 1
1: 0
2: 4
3: 28
4: 319
1089537166_1089537173 3 Left 1089537166 11:119168175-119168197 CCTTCTGGGCTACGTGAGCCCAG 0: 1
1: 0
2: 0
3: 5
4: 115
Right 1089537173 11:119168201-119168223 GTGGAAGTGTGTGGAAGTGTAGG 0: 1
1: 1
2: 6
3: 48
4: 530
1089537166_1089537181 23 Left 1089537166 11:119168175-119168197 CCTTCTGGGCTACGTGAGCCCAG 0: 1
1: 0
2: 0
3: 5
4: 115
Right 1089537181 11:119168221-119168243 AGGGATAAGGGTGGGGGCTTTGG 0: 1
1: 0
2: 2
3: 31
4: 459

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089537166 Original CRISPR CTGGGCTCACGTAGCCCAGA AGG (reversed) Intronic
901480330 1:9520625-9520647 CTGTGCAGACGCAGCCCAGAAGG - Intergenic
902726454 1:18339258-18339280 CTGGGCTCAGGCAGACCAGGTGG - Intronic
903362956 1:22788401-22788423 ATGAGCTCAGGGAGCCCAGAAGG + Intronic
904457035 1:30654010-30654032 CTGAGGTCACGTAGCCCAGGTGG + Intergenic
906606329 1:47174908-47174930 CTGGGCTCACCCAGCCCAGCTGG + Intergenic
911050675 1:93668370-93668392 CTGGGTTGAAGAAGCCCAGAGGG - Intronic
912433116 1:109640133-109640155 CAGGGCTCAAGCAGCCCAGCAGG - Intergenic
915074374 1:153296738-153296760 CTGGGCTCCTCTTGCCCAGAGGG - Intergenic
916071297 1:161171638-161171660 CTGGGCTCCTGTAGACCTGAGGG - Exonic
919454009 1:197801579-197801601 CTGGACTCAGCTAGACCAGAAGG + Intergenic
924707954 1:246513403-246513425 GTGGGCTGACAAAGCCCAGATGG - Intergenic
1063608170 10:7541243-7541265 CTGGGCTCACGTCTCCCAGGAGG + Intergenic
1066005636 10:31144065-31144087 CTGGGCTCACTTGGCTAAGAAGG - Intergenic
1068633968 10:59327989-59328011 CTGGCCAAGCGTAGCCCAGATGG + Intronic
1069156395 10:65035526-65035548 CTGGGCCCACTTAGCCTAGCAGG - Intergenic
1071601967 10:86962756-86962778 CTGGGCTCCCAGGGCCCAGAGGG + Intronic
1072524288 10:96257860-96257882 CTGGCTTCACATAGGCCAGAAGG - Intronic
1075689285 10:124384863-124384885 CTGGGATCAGGTAGGACAGAGGG - Intergenic
1077387124 11:2275328-2275350 CTGGGCTGACGTACAGCAGAGGG - Intergenic
1081169912 11:39854612-39854634 CTGGGCTTAAATAGCCCATAAGG + Intergenic
1086835305 11:91613644-91613666 CTCGGCTCACCTAGCCATGAAGG + Intergenic
1087774475 11:102244902-102244924 ATGGGCTCCCTTAGCGCAGAGGG - Intergenic
1089537166 11:119168175-119168197 CTGGGCTCACGTAGCCCAGAAGG - Intronic
1090396650 11:126423807-126423829 CTGGGGTCACACAGCCCAGGAGG + Exonic
1091440021 12:505427-505449 CTGGACTCCCTAAGCCCAGAGGG + Intronic
1092261113 12:6953777-6953799 GTGGGCTGAAGTAGCCCAGTGGG + Intronic
1096515202 12:52151921-52151943 CTGGGCTCCCCTTGCCCAGGAGG - Intergenic
1101330871 12:103756967-103756989 CTGGGCCTCAGTAGCCCAGAAGG + Intronic
1102058932 12:109917552-109917574 CTGGGCACATATATCCCAGAAGG - Exonic
1102585820 12:113922220-113922242 CTGGGCTAAGGGAGCCCACAGGG - Intronic
1104735857 12:131135768-131135790 CAGGGCTCACCTAGGCCATAGGG - Intronic
1105701040 13:22935828-22935850 CTGGGAACACGTAGCACAGGTGG - Intergenic
1105853870 13:24358876-24358898 CTGGGAACACGTAGCACAGGTGG - Intergenic
1109804208 13:67416507-67416529 CTCCGCTCACTTAGCCCAGCAGG - Intergenic
1114207000 14:20581433-20581455 CTGGCCTCAAGTACCCAAGATGG - Intergenic
1117877202 14:60265415-60265437 CTGGGCTCAAGTAACAGAGATGG - Intronic
1128212197 15:65910562-65910584 CTGGGCTGAGGTGACCCAGAGGG + Intronic
1129470297 15:75750031-75750053 CTGGGCACCCCCAGCCCAGAGGG + Intergenic
1131269764 15:90939930-90939952 CTGGGCTCACGGGGCCTGGATGG + Intronic
1132692135 16:1186311-1186333 CTGGGCCCAGGGAGCCCTGAAGG + Intronic
1132888835 16:2194506-2194528 CTGGGCTCACGGGGCCCTGGAGG + Intronic
1135699061 16:24615560-24615582 GTGGGCTCATGAAGCCAAGAGGG + Intergenic
1145841336 17:27997604-27997626 CTTGGCTCACATAACTCAGAAGG + Intergenic
1146619997 17:34389691-34389713 CTGGTTTCACGCAGACCAGATGG - Intergenic
1147317667 17:39628471-39628493 CTTGGCTCACGTAGCAAGGAGGG + Intronic
1147563923 17:41525103-41525125 CTGCCCTCACCTAGCCTAGATGG - Intronic
1147869660 17:43578419-43578441 CTGAGCTCAGTTGGCCCAGAAGG + Intronic
1154943003 18:21132873-21132895 CTGGCCTCAACCAGCCCAGAGGG + Intergenic
1161062372 19:2221739-2221761 CAGGGCACAGGCAGCCCAGATGG + Intronic
1161236028 19:3198718-3198740 CGGGCCCCACGTGGCCCAGAGGG + Intronic
1161882185 19:6963668-6963690 CTGGGATCCCGTAGCCTACAGGG + Intergenic
1163762341 19:19144605-19144627 CTGGCCTCACGCACCCCAGGTGG - Intergenic
1164441404 19:28282967-28282989 CTGGGAAAAGGTAGCCCAGAAGG - Intergenic
1165137804 19:33681395-33681417 CTGGGCTCATGTGGGCCACAGGG + Intronic
1166077013 19:40419589-40419611 CAGGGCTGATGTAGCCCATATGG + Intergenic
1166726759 19:45033168-45033190 AAGGGCTCACATTGCCCAGAGGG + Intronic
927199048 2:20567357-20567379 CTGGCCTCAGGCAGCCCAGTAGG - Intronic
927691956 2:25214970-25214992 ATGGGTTCAAGGAGCCCAGATGG + Intergenic
927863410 2:26574351-26574373 CTGGGCTCAGGTGGTGCAGATGG + Intronic
929007809 2:37412444-37412466 CTGGCCTCACACAGCCCAGCTGG - Intergenic
929587818 2:43127187-43127209 CAGGCCTCAGGGAGCCCAGACGG - Intergenic
929974354 2:46617176-46617198 GTGGGTTGACGTAGCCCGGAAGG + Exonic
933725722 2:85426048-85426070 CTGGGCTCACCAAGAACAGAAGG - Intronic
936449236 2:112621016-112621038 CTGGGCTCAGGGAGCCCAGTGGG + Intergenic
947915473 2:233829456-233829478 CAGGGATCACGTAGCCCTCAAGG - Intronic
1169012254 20:2260373-2260395 CTGTGCTCACCTGGCCCAGGGGG + Intergenic
1169730767 20:8783601-8783623 CTGGACTAACTTAGGCCAGAAGG + Intronic
1172010294 20:31842513-31842535 CTGGGCTCCCCCAGCCCAGCCGG + Intergenic
1172766388 20:37353387-37353409 CTGAGGTCACGCAGCCCTGAAGG + Intronic
1174169456 20:48606998-48607020 CTGGGCTCCCCCAGCCCAGGTGG - Intergenic
1175964949 20:62655738-62655760 GGGGGCTCACGTGGCCCAGGAGG + Intronic
1177262728 21:18750875-18750897 CTGGGCTCACTTGGCCTGGAAGG - Intergenic
1183740052 22:39664310-39664332 CTGGGCTCCCGCGACCCAGAGGG + Intronic
1184075058 22:42171532-42171554 TTGGGCCCACGGAGCCAAGAAGG - Intronic
1184687366 22:46102681-46102703 CTGGGCTCACCCAACACAGAAGG + Intronic
1185411024 22:50683135-50683157 CAGGTCTCACCTGGCCCAGAGGG - Intergenic
952286821 3:31977454-31977476 CTGGGTTCTGGTGGCCCAGAAGG - Intronic
962358273 3:134713609-134713631 CTGGGCTCAGGTACCTAAGAAGG - Intronic
967388848 3:188935822-188935844 CTGGGGTCACATAGCTCACAGGG - Intergenic
982712178 4:158768869-158768891 CCGGGCTCACGTAACCCCGGCGG - Intergenic
986798781 5:11238850-11238872 CTGTGATCACATAGCCAAGAAGG - Intronic
994411341 5:99410505-99410527 CGGCGCTCAGGCAGCCCAGAGGG + Intergenic
994482488 5:100354742-100354764 CGGCGCTCAGGCAGCCCAGAGGG - Intergenic
998108166 5:139481644-139481666 CAGGGGTCACGGGGCCCAGAAGG - Exonic
999093150 5:148955161-148955183 CAGGGCTCACCTGTCCCAGATGG + Intronic
1000381337 5:160632276-160632298 CTGGGCCCATCTAGCCGAGAAGG + Exonic
1002552726 5:180008328-180008350 CTGGTCTCACAGAGCCCAGTGGG + Intronic
1002976779 6:2086707-2086729 CTGCCAGCACGTAGCCCAGAAGG - Intronic
1003189918 6:3865593-3865615 CTGGGCTCGCACATCCCAGATGG - Intergenic
1008127232 6:47682368-47682390 CTGGGATCACGAAGGCCAGGAGG - Exonic
1009230832 6:61059527-61059549 CTGGGCTCAGGGAGTCCAGGTGG - Intergenic
1015791468 6:136968348-136968370 CTGTGCTCACCTAGCCTAGTGGG + Intergenic
1016802518 6:148181236-148181258 CTCGTCTCTTGTAGCCCAGAGGG - Intergenic
1019401462 7:856548-856570 CTGTCCTCACGCAGCCCAGCAGG - Intronic
1019526339 7:1482129-1482151 CTGGGCCCACGTAGGTCAGTAGG - Intronic
1020047754 7:5055755-5055777 CTGGACTAACTTAACCCAGAAGG + Intronic
1020106902 7:5426506-5426528 CTGGGCGCACAAAGCCCAGGCGG - Intergenic
1020725455 7:11808010-11808032 CTGGTCCCAAGTACCCCAGAGGG + Intronic
1024803773 7:53111734-53111756 CCGGTCTCAGGTAGCCCAGGTGG - Intergenic
1027115567 7:75476639-75476661 CTGGGTTAACTTAGTCCAGAAGG + Intronic
1028228015 7:88272313-88272335 CTGAGCTCCAGTTGCCCAGATGG + Intergenic
1031918643 7:127585519-127585541 CTCGGCCCACGTCGGCCAGAGGG + Exonic
1032494693 7:132352271-132352293 ATGGGCACACGTAGGCGAGAGGG - Intronic
1032724979 7:134582374-134582396 CCGGGCTCAGGTAGTTCAGAGGG + Intergenic
1035032625 7:155871366-155871388 CTGAGCTCAGAGAGCCCAGATGG - Intergenic
1036557960 8:9876509-9876531 TGGGGCTCACCTGGCCCAGAGGG + Intergenic
1039840586 8:41290343-41290365 CTGGGCTAACCCAGCCCTGAAGG + Intronic
1041094770 8:54339071-54339093 CGTGGCTCACCTAGCCCAGTCGG + Intergenic
1041794873 8:61736874-61736896 CTGGGCTCCCTTGGCCAAGATGG + Intergenic
1049944244 9:579237-579259 GTGGGCTCCCGTAGCACAGCTGG + Intronic
1055757259 9:79570754-79570776 CGGGGTTCACGTGGCCCAGTCGG + Intergenic
1056328264 9:85500282-85500304 CTGGGCCCACTCAGCCCTGATGG - Intergenic
1057216591 9:93232021-93232043 CGGGGCTCAGGAAGCCCAGATGG + Intronic
1058621646 9:106889312-106889334 CTGTGCTCGGGTAGCTCAGAGGG + Intronic
1062387220 9:136317602-136317624 CTGGGGTCCAGTAGCCCAGCAGG - Intergenic
1062580770 9:137228351-137228373 CTGGGCTCAGGTCGGCCAGGAGG + Intronic
1186890573 X:13955550-13955572 CTGGGCTCAAGTGGGCCAGCAGG - Intergenic
1194584934 X:95720208-95720230 GTGGACTCTCATAGCCCAGAAGG - Intergenic
1198533662 X:137567200-137567222 CTGGGCACCCGTCGCCCACAGGG + Exonic
1200118932 X:153781406-153781428 CTGGGCCCACATGGGCCAGATGG + Intronic
1200206431 X:154319903-154319925 CCGGGCTCAAATACCCCAGAAGG - Intronic