ID: 1089538111

View in Genome Browser
Species Human (GRCh38)
Location 11:119173045-119173067
Sequence AAGGAGAAGCAGGGTGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1544
Summary {0: 1, 1: 1, 2: 10, 3: 180, 4: 1352}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089538099_1089538111 13 Left 1089538099 11:119173009-119173031 CCCTGGTCAGGGGGTGTGGTGGG 0: 1
1: 0
2: 4
3: 45
4: 331
Right 1089538111 11:119173045-119173067 AAGGAGAAGCAGGGTGAGGGAGG 0: 1
1: 1
2: 10
3: 180
4: 1352
1089538101_1089538111 12 Left 1089538101 11:119173010-119173032 CCTGGTCAGGGGGTGTGGTGGGC 0: 1
1: 0
2: 2
3: 35
4: 321
Right 1089538111 11:119173045-119173067 AAGGAGAAGCAGGGTGAGGGAGG 0: 1
1: 1
2: 10
3: 180
4: 1352

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089538111 Original CRISPR AAGGAGAAGCAGGGTGAGGG AGG Intronic
900120190 1:1045576-1045598 GAGGAGAAGCACAGTGATGGGGG - Intronic
900177708 1:1298165-1298187 AAGGTGAAGCAGGAAGTGGGTGG - Intronic
900320823 1:2082808-2082830 ATGTAGTAGCAGGGAGAGGGTGG + Intronic
900459308 1:2793945-2793967 AAGAAGAAGGAGGGCGAGGAGGG - Intronic
900680117 1:3911973-3911995 AAGGAGATGCTGGGGGAAGGGGG - Intergenic
900851047 1:5143344-5143366 TAAGAGAAGCAGGAGGAGGGAGG + Intergenic
900932829 1:5747619-5747641 AGGGAGGAGCAGAGGGAGGGAGG + Intergenic
901105124 1:6749445-6749467 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
901195226 1:7436557-7436579 TGGGAGGAGCAGGGTGAGGTCGG + Intronic
901224754 1:7606803-7606825 AAGGATCATCAGGGTGAGGAGGG + Intronic
901465146 1:9416675-9416697 AGTGAGACGCAGGCTGAGGGTGG + Intergenic
901469189 1:9443871-9443893 GAGGAGAAGGAGGGAGAGGAAGG - Intergenic
901798712 1:11694785-11694807 AAGAAGAAGAAGGTTGTGGGAGG + Intronic
902091931 1:13910530-13910552 AAGCAGGAGCAAGGTGGGGGAGG - Intergenic
902857367 1:19218304-19218326 AAGGAGAAAGAGGGTAGGGGTGG - Exonic
902995564 1:20222339-20222361 AGGGAGAAGCAGGGCTGGGGAGG + Intergenic
903024395 1:20417150-20417172 ATGAAGAAGCAGGCTGAGAGAGG - Intergenic
903100175 1:21023251-21023273 AGGGAGAGGGAGGGGGAGGGGGG - Intronic
903153798 1:21430714-21430736 AAGGAGAGCCAGGGTGGGGAGGG - Intergenic
903219578 1:21861724-21861746 AAACAGAAGTAGGGGGAGGGTGG - Intronic
903332002 1:22601223-22601245 CAGAAGAAGCAGGCTGAGGAAGG - Intronic
903471458 1:23590546-23590568 ATGGAGAAGCAGGGAGGAGGAGG + Intronic
903603527 1:24558632-24558654 CAGGAGCAACAGGATGAGGGGGG - Intronic
904051116 1:27639510-27639532 AGGGAGAGGGAGGGAGAGGGAGG - Intergenic
904295762 1:29518859-29518881 AAGGAGAAGGAGAATGAGGAAGG - Intergenic
904329576 1:29749507-29749529 CAGAGAAAGCAGGGTGAGGGAGG + Intergenic
904500706 1:30911238-30911260 AAGGGCCAGCAGGGTTAGGGTGG + Intergenic
904588351 1:31592857-31592879 AAGGAGATGGAGGCTCAGGGAGG + Intergenic
904858000 1:33514557-33514579 AAGGAGACGCAGGGGAGGGGTGG + Exonic
905107124 1:35570622-35570644 AAGGAGAAGCAGGTTGGGGTTGG + Intergenic
905205135 1:36339141-36339163 GAGGAGAGGGAGGGGGAGGGTGG + Intergenic
905532577 1:38693779-38693801 AGGGAGAGGGAGGGAGAGGGAGG + Intergenic
905532581 1:38693789-38693811 AGGGAGAGGGAGGGAGAGGGAGG + Intergenic
905535973 1:38722135-38722157 AAAGAGAAGAAGGGAGAGGAAGG + Intergenic
905778960 1:40691457-40691479 AAGGATAGGCAGGGTGGTGGAGG + Intergenic
905913718 1:41671101-41671123 TAGGAGAGGCAGGGTGGGGAGGG - Intronic
906536086 1:46551682-46551704 AATGAGAGGCAGGGTGAGGGGGG + Intergenic
906558680 1:46736889-46736911 AAGCAGCAGCAGGGTTTGGGAGG - Intergenic
906783200 1:48590777-48590799 ACGGGGAGGCAGGGTGTGGGGGG + Intronic
907160988 1:52368695-52368717 GAGGAGCAGGAGGGTGAGCGCGG - Intergenic
907303470 1:53501980-53502002 AAGGAGAAGGCGGGTTTGGGAGG + Intergenic
907328072 1:53653809-53653831 CAGGAGATGCATGGGGAGGGCGG - Intronic
907401421 1:54227166-54227188 AAGGAGAAGCAGAGAAGGGGGGG + Intronic
907455266 1:54571740-54571762 AAGGGGAAGCTGGGTAAGGTGGG + Intronic
907596699 1:55726927-55726949 AAGGAGAATGAGGGAGATGGAGG - Intergenic
907702890 1:56806475-56806497 AAGGAGAAATAGGGCTAGGGTGG + Intronic
907778521 1:57542558-57542580 AAGGAGGTGCAGGGAGAGGCTGG + Intronic
907828627 1:58042573-58042595 AAGGAAAAGGAGGGAGATGGGGG + Intronic
907830149 1:58057100-58057122 AGGGAGAATCAGGTTGAGTGAGG - Intronic
908091975 1:60695922-60695944 AAGGAGGAGCAGAGTAAAGGAGG + Intergenic
908236529 1:62152362-62152384 AAGGAGCAGCAGTCTGAGTGCGG + Intronic
908333692 1:63097939-63097961 AAGGAAAAGAAGGATGGGGGAGG + Intergenic
908776958 1:67649701-67649723 AAGGAGAATCAGGAGGAGGTAGG + Intergenic
908778125 1:67661449-67661471 AATGAAAAGCAGGGGGAGGGTGG - Intergenic
908791988 1:67791923-67791945 AAGGAGAAGAGGGGTTAGTGTGG - Intronic
908833640 1:68206931-68206953 AAGGACAAGGAGGGGGAGGAGGG - Intronic
908909342 1:69055046-69055068 AAATAGAGGCAGGGTGAGGAGGG - Intergenic
908912055 1:69083294-69083316 ATGGAGAAGATGGGGGAGGGAGG - Intergenic
910174222 1:84411670-84411692 AAGGAGAAGTAGGGACAGGTTGG + Intronic
910373483 1:86543521-86543543 AGGGAGAAGCAGGGAGCAGGAGG + Intergenic
910422714 1:87084767-87084789 AAGGAGAGGGGGGGTGAGAGAGG - Intronic
910559222 1:88572282-88572304 ATGGAGAAGAAGTGTGAGAGGGG - Intergenic
910860079 1:91734531-91734553 AGGGAGGAGCAGGGGGAGAGAGG - Intronic
910983732 1:92983909-92983931 AAGCAGCAGCAGGGTTTGGGAGG + Intergenic
911016685 1:93341000-93341022 AGGAAGAAGCAGGGTCAAGGAGG - Intergenic
911582796 1:99653684-99653706 AAGGAGAAGCTGGGTGAACTTGG - Intronic
912392490 1:109313871-109313893 AAAGAAATGCAGGGTGGGGGTGG - Exonic
912701708 1:111882769-111882791 ATAGAGAGGCTGGGTGAGGGTGG + Intronic
912735648 1:112147194-112147216 AAGGAGAAAGAGAGGGAGGGAGG - Intergenic
912866983 1:113266590-113266612 CAGGAGAAGCTGGGCGTGGGGGG - Intergenic
913012376 1:114697095-114697117 AAGGAGAAGCAGGTTCATGGAGG - Intergenic
913090528 1:115473750-115473772 AGAGAGAAGCAGGGTAAGGAAGG + Intergenic
913524652 1:119679269-119679291 ATGGGGGAGTAGGGTGAGGGTGG + Intronic
913939864 1:125091646-125091668 AAGGAGGAGGAGGGGGAAGGAGG + Intergenic
915047181 1:153028002-153028024 AAGGAGAAGGAGAAGGAGGGAGG - Intergenic
915095445 1:153459292-153459314 AGGGAGAAGCAGGGAGAGTCGGG + Intronic
915107981 1:153546137-153546159 AAGGAGATGCAGGGGGTGGTGGG + Intronic
915393170 1:155562512-155562534 AAGGAGTGGAAGGTTGAGGGGGG - Exonic
915559534 1:156678494-156678516 AAGGAGAAGTAGGGCTGGGGAGG + Intergenic
915580373 1:156809511-156809533 AGGGAGGAGTGGGGTGAGGGAGG + Intronic
915839396 1:159202665-159202687 GAGGAAAAGCTGGGGGAGGGTGG - Intronic
915967419 1:160323182-160323204 AATGGGAAGGAGGGTGAAGGAGG + Intronic
916281610 1:163057855-163057877 AAGGAGAACCAAGCTGAGGAGGG - Intergenic
916332159 1:163628692-163628714 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
916412471 1:164559586-164559608 AAGGGGTTGCGGGGTGAGGGTGG - Intronic
916487996 1:165276386-165276408 AAAGATAGGAAGGGTGAGGGTGG - Intronic
916804229 1:168243220-168243242 AAAGATATGCAGGGAGAGGGAGG - Exonic
916818017 1:168372153-168372175 AAGGAACAGCAGGGATAGGGAGG - Intergenic
916973372 1:170048689-170048711 AAGCAGAAGCGGGGTGGCGGGGG + Intronic
917139388 1:171819829-171819851 AAAGAGAAGTTGAGTGAGGGTGG + Intergenic
917191862 1:172426517-172426539 AATGAGAGGCAGGGTGAGGGTGG - Intronic
917232909 1:172857151-172857173 AGGGAGAAGGAGGGAGAGGGAGG + Intergenic
917271659 1:173282037-173282059 ACTGGGAAGCATGGTGAGGGTGG + Intergenic
917421250 1:174866082-174866104 AAGGAGAGGAGGGGAGAGGGAGG + Intronic
917460107 1:175222205-175222227 GAGGAGAAGGAAGGAGAGGGAGG + Intergenic
917660822 1:177175276-177175298 ATGGAAAAGCGGGGTGGGGGGGG + Intronic
918069470 1:181124455-181124477 AAGGGGAAGCAGGGAAGGGGAGG - Intergenic
918179499 1:182074127-182074149 AAGAAGAAGGAGGAGGAGGGTGG + Intergenic
918307791 1:183263087-183263109 TAGGAGAAGCAGGGTAAAGGTGG - Intronic
919449335 1:197751870-197751892 AAGGAGGAGGAGGAGGAGGGAGG + Intronic
919595850 1:199561547-199561569 AAGGAGAAGGAGGAGGAGGAAGG - Intergenic
920054288 1:203181295-203181317 AAGGGGATGGAGGGTGAGGCAGG + Intronic
920081470 1:203376928-203376950 AAGGAGAAGAAGAGAGATGGGGG + Intergenic
920265314 1:204717138-204717160 TGGGAGCAGCAGGTTGAGGGAGG + Intergenic
920565149 1:206967144-206967166 TGAGAGAAGCTGGGTGAGGGTGG + Intronic
920651571 1:207841357-207841379 AAGGAGATGGAAGCTGAGGGAGG + Intergenic
920735194 1:208527174-208527196 AGGGAGAGGCCGGGGGAGGGGGG - Intergenic
920748047 1:208647342-208647364 AAAGAGAAGGAGGGGGAAGGAGG - Intergenic
920944362 1:210514703-210514725 AAGGACAAGGGGGGTGAGGCAGG + Intronic
921276446 1:213525369-213525391 AAAGTAAAGCAGGGTTAGGGAGG + Intergenic
921353370 1:214261003-214261025 AAGGAGAAGGAGGAGGAGGAAGG - Intergenic
921931184 1:220755518-220755540 AAGGAGAAGCAAGGCAGGGGCGG + Intronic
922159592 1:223068858-223068880 GAGGAAAAGCAGTGGGAGGGTGG + Intergenic
922254920 1:223885464-223885486 AAGGAAATTCAGTGTGAGGGGGG + Intergenic
922651339 1:227341601-227341623 AAGGAGAAGCAGAGGGATGAGGG + Intergenic
922677151 1:227560123-227560145 AGAGAGAGACAGGGTGAGGGAGG - Intergenic
922678880 1:227573187-227573209 AAGGAGATACAGCGTGGGGGTGG + Intronic
922707962 1:227800351-227800373 AAGGAGAAGGAGAAGGAGGGGGG - Intergenic
922898732 1:229120303-229120325 TAGGAGGAGAAGGGTCAGGGTGG + Intergenic
923014108 1:230112673-230112695 AGGGAGGAGGAGGGAGAGGGTGG + Intronic
923090348 1:230735767-230735789 AAGGAGAAGCAGTTTCAGGAAGG - Intergenic
923109472 1:230879631-230879653 AAGGAGGGGCAGGGTGACTGAGG - Intergenic
923237293 1:232046524-232046546 AAGGGGGAGTAGGGAGAGGGTGG - Intergenic
923274458 1:232384464-232384486 AGAGAGAAGAAGGGAGAGGGAGG - Intergenic
923436943 1:233976083-233976105 AAGGCGAAGGAGGAGGAGGGAGG + Intronic
923509808 1:234640695-234640717 AAAGAGAGGGAGAGTGAGGGAGG + Intergenic
924150308 1:241123285-241123307 AAGGAGCAGCTGGGTTGGGGAGG - Intronic
924311129 1:242744248-242744270 AAGGAGATGAAGGGTGAGAGGGG + Intergenic
924390006 1:243544257-243544279 AAAAAAAAGCAGGGGGAGGGGGG + Intronic
924608679 1:245556342-245556364 AAGGAGGAGGAGGAGGAGGGAGG - Intronic
1062812479 10:477316-477338 GAGGAGAGGGAGGGGGAGGGAGG + Intronic
1062922822 10:1292953-1292975 AAGGAGAGAGAGGGAGAGGGAGG + Intronic
1062936556 10:1394896-1394918 AAGAAGAAGGAGGAGGAGGGAGG - Intronic
1063057225 10:2518967-2518989 AAGAAGAAGAAGGGGGGGGGAGG + Intergenic
1063253348 10:4298850-4298872 CAGGAGGAACAGGGTGAAGGGGG - Intergenic
1063278401 10:4597188-4597210 ATGCAGGAGCAGGGTGAGGAGGG - Intergenic
1063665501 10:8058256-8058278 AGAGAGAAGGAGGGTGAGTGTGG - Intronic
1064136359 10:12754179-12754201 AAGGAGGAGCAGGCTGGGCGTGG - Intronic
1064272689 10:13879748-13879770 AAGGAGGGGGAGGGGGAGGGGGG - Intronic
1064523831 10:16231989-16232011 AAGGAGAAGCAAGTTGATGATGG - Intergenic
1064724940 10:18269747-18269769 AGGGAGGAGCAGAGAGAGGGAGG - Intronic
1065066492 10:21971963-21971985 AAGGAAAAGTGGGGTGAGAGAGG - Intronic
1065184252 10:23156865-23156887 AAGGAGAAGGAAAGAGAGGGAGG + Intergenic
1065675822 10:28173148-28173170 AAGGAGAACCAGGGTGAGCAGGG + Intronic
1065728728 10:28691568-28691590 AGGGAGAGGGAGGGAGAGGGAGG - Intergenic
1065876289 10:30000210-30000232 AAAGAGGAGCAGAGAGAGGGAGG - Intergenic
1065995412 10:31055532-31055554 CAGGAGAGACAGAGTGAGGGGGG + Intergenic
1066302827 10:34111597-34111619 AGGAAGAAGGAGGGAGAGGGAGG + Intronic
1066336116 10:34480219-34480241 AAGGAGAAGCAAGGTGCAGTAGG - Intronic
1066569941 10:36760472-36760494 AAATAGATGCAGGCTGAGGGAGG - Intergenic
1066780270 10:38938139-38938161 AAGGAGGAGGAGGGGGAGGGAGG - Intergenic
1066956018 10:42173425-42173447 AAGGAGGAGGAGGGGGAGGGAGG - Intergenic
1067073911 10:43161845-43161867 AGGGGGAACCAGGGTTAGGGTGG - Intronic
1067205767 10:44211500-44211522 CAGGAGAAGCAGCATGAGGGGGG - Intergenic
1067251598 10:44591362-44591384 AAGGAGAAGCAAGGGGTGGCTGG - Intergenic
1067382440 10:45787406-45787428 AAGCAGGTGCAGGATGAGGGGGG - Intronic
1067536184 10:47111900-47111922 AAGAAAAGGCAGGCTGAGGGAGG + Intergenic
1067735674 10:48848485-48848507 TACGAGGAGCAGGGTCAGGGTGG - Intronic
1067890138 10:50127954-50127976 AAGCAGGTGCAGGATGAGGGGGG - Intronic
1068232744 10:54191961-54191983 AAGGAGAAGGAGGGGAAGGAAGG + Intronic
1068350454 10:55837603-55837625 AAGGATAAACAGAGTTAGGGCGG + Intergenic
1069195298 10:65544121-65544143 AATAAGAAGGAGGGAGAGGGAGG - Intergenic
1069373033 10:67767147-67767169 AAGGAGAAGGAGGAGAAGGGTGG - Intergenic
1069718536 10:70535664-70535686 AAGGAGAAGAAAGGAGAAGGAGG - Intronic
1069751575 10:70748527-70748549 ATGTAGGGGCAGGGTGAGGGTGG - Intronic
1069900630 10:71704880-71704902 AAGGAGGGGCAGCATGAGGGTGG - Intronic
1069909596 10:71751300-71751322 AAGGAGAAGCAAAGTGAACGGGG + Intronic
1070360947 10:75688620-75688642 AAGCAGAAGCAGGGTTTGGGAGG + Intronic
1070540445 10:77411938-77411960 AAGGATACGCATGGCGAGGGAGG - Intronic
1070661280 10:78307078-78307100 GAAGAGAAGAAGGGAGAGGGGGG + Intergenic
1071341445 10:84652376-84652398 CAGAAGAAGCAGAGTGTGGGAGG - Intergenic
1071383874 10:85100332-85100354 AAGGAAAAGCATGGCAAGGGTGG + Intergenic
1071427963 10:85578578-85578600 AAGGAGAAGCAGAGGGAAGTGGG + Intergenic
1071554898 10:86594376-86594398 AAGGAGAGGGAGGGGGAGGGAGG + Intergenic
1071701368 10:87940838-87940860 AAAGAGGAGGAGGGTAAGGGAGG - Intronic
1071785215 10:88892084-88892106 TTTGAGATGCAGGGTGAGGGAGG + Intronic
1071827786 10:89342423-89342445 AAGGAGCAGGAGGATGGGGGAGG - Intronic
1072606881 10:96991803-96991825 AAGCAGAGGCAGGAGGAGGGAGG - Intergenic
1072671924 10:97436731-97436753 AAGGAGAATCAGGCTGGGCGTGG + Intronic
1072726434 10:97816812-97816834 AAGGAGGGGCAGGGGTAGGGAGG + Intergenic
1073056759 10:100708047-100708069 AAGGAGAAGGAAGGGGAGGACGG + Intergenic
1073096312 10:100982213-100982235 AGGGAGCAGCAGGCAGAGGGAGG + Intronic
1073698653 10:105899373-105899395 AAGGAGAAACAGGGAGAGAGAGG + Intergenic
1074015156 10:109527217-109527239 AGGGAGAGGGAGGGAGAGGGAGG - Intergenic
1074232724 10:111553847-111553869 CAGGAGAAGCTGACTGAGGGAGG - Intergenic
1074247739 10:111712153-111712175 AAAGAGAGGCAAGGTGAGGGAGG + Intergenic
1074293786 10:112162944-112162966 TGGGAGGAGCAAGGTGAGGGAGG + Intronic
1074402266 10:113151903-113151925 AGGGAGAAGCGGGGGGCGGGTGG + Intronic
1074419927 10:113299741-113299763 AATGAGGAGGAAGGTGAGGGAGG + Intergenic
1074422519 10:113322026-113322048 AAGCAGAACCTGGGGGAGGGGGG + Intergenic
1074453860 10:113580771-113580793 GAGGAAGAACAGGGTGAGGGAGG - Intronic
1074728944 10:116347846-116347868 AAGGAGATGTAGTGGGAGGGAGG - Intronic
1075155729 10:119974542-119974564 AAGGAGCAGCAGGGAGTTGGAGG + Intergenic
1075494530 10:122908519-122908541 AAGCAGCAGCAGGCTTAGGGAGG + Intergenic
1075652387 10:124136874-124136896 AAAGAGATGCAGGGTCATGGTGG - Intergenic
1075714381 10:124547687-124547709 CAGGAGAAGCAGTCTGAGGGAGG + Intronic
1075980742 10:126737030-126737052 AAGGAGCAGCAGAGAGAAGGAGG - Intergenic
1076066903 10:127456013-127456035 AAGGAGAAAGGGGGAGAGGGAGG - Intergenic
1076121392 10:127939748-127939770 AAGGAGAGGCAGGAGGAGGCAGG + Intronic
1076246566 10:128951366-128951388 AAGCAGGTGCAGGGTGACGGTGG + Intergenic
1076402466 10:130193051-130193073 TTGGAGAAGCAGGGACAGGGTGG - Intergenic
1076522139 10:131087913-131087935 AAGGAGGAGCGAGGGGAGGGTGG + Intergenic
1076538297 10:131197039-131197061 GAGGAAGGGCAGGGTGAGGGGGG - Intronic
1076623914 10:131810167-131810189 GAGGAAAAGCAGGATGATGGAGG + Intergenic
1077334618 11:1997830-1997852 ACCGAGGAGCAGGGTGAGGGAGG - Intergenic
1077392548 11:2306838-2306860 AGGGAGAGGGAGGGGGAGGGGGG + Intronic
1077523294 11:3049052-3049074 GAGGAGAAGGAGGGTGAGCAGGG - Intronic
1077606214 11:3614637-3614659 AGGGAGAAGCTGGGTGAGGTGGG - Intergenic
1078227018 11:9401400-9401422 AATGAGAAGCAGGCTAAGTGTGG + Intronic
1078414579 11:11155013-11155035 AAGGAGAAGCAGAGAGTGGTGGG + Intergenic
1078567672 11:12430996-12431018 AAGGAAAATAAGGCTGAGGGTGG - Intronic
1079239573 11:18713059-18713081 AAAGTGAAACAGGGTGAGGTGGG - Intronic
1079360321 11:19765464-19765486 AAGGAGAAGGAGACAGAGGGAGG - Intronic
1079826421 11:25201034-25201056 AAGGAGAAAGAGAGGGAGGGAGG + Intergenic
1080436597 11:32250366-32250388 ATGGAGAAGCAGGTTCAGGGAGG - Intergenic
1080627418 11:34043075-34043097 CAGGAGAGACAGAGTGAGGGTGG + Intergenic
1080908041 11:36566511-36566533 AAGGAGCAGGAGGATGGGGGGGG + Intronic
1081071430 11:38615055-38615077 AAGCAGAGGCAGGGTTAGAGAGG - Intergenic
1081344947 11:41973872-41973894 AACCAAAGGCAGGGTGAGGGAGG - Intergenic
1081403454 11:42668864-42668886 AAGGAGGAAGAGAGTGAGGGAGG + Intergenic
1081529366 11:43947459-43947481 AAGGAGAGGCAGGCTGGGGCCGG + Intergenic
1081620090 11:44614330-44614352 AGGGAGAAGGAGGGACAGGGAGG - Intronic
1081696796 11:45117455-45117477 GAGGAGAAGCAGGTTGAGTGTGG + Intronic
1081852814 11:46285463-46285485 CAGGAGAAGCTGGGAGAGGCAGG + Intronic
1082029803 11:47595751-47595773 GACAAGAAGCAGGGTAAGGGTGG + Intergenic
1082219838 11:49621370-49621392 AAGAGAGAGCAGGGTGAGGGGGG - Intergenic
1082282826 11:50288494-50288516 AAGGAGAAGCAGGATGATAATGG - Intergenic
1082677940 11:56131591-56131613 GAGTAGAAGAAGGGTGAGGAGGG + Intergenic
1082833832 11:57638403-57638425 AAGGAGAAAGGGGGCGAGGGGGG + Intergenic
1082921979 11:58505409-58505431 AAGGAGGAGCAGGATGAGGAGGG + Intergenic
1083176286 11:60952032-60952054 AAGGGGCAGCAGGGTGACTGGGG - Intronic
1083372669 11:62194193-62194215 AAGGGAGAGCAGGTTGAGGGCGG - Intergenic
1083491588 11:63018197-63018219 AGGGAGAGGTAGGGTGACGGAGG - Intergenic
1083727508 11:64636260-64636282 AAGGAGAAGGGGAGAGAGGGTGG - Intronic
1083831849 11:65238574-65238596 AGGGAGAGGGAGGGAGAGGGAGG - Intergenic
1083902870 11:65652186-65652208 AAGGAGAGGCAGGCTGGGGATGG + Intergenic
1084104872 11:66974972-66974994 AAGGAGGAGAAGGAGGAGGGGGG + Intergenic
1084120401 11:67065871-67065893 GAGGAGAAGCAGGGCGGGGGAGG - Intronic
1084448164 11:69216365-69216387 AGGCAGAAGCATGGTGAAGGGGG + Intergenic
1084563667 11:69918020-69918042 AAGAAGAAGCGGGGGGGGGGGGG - Intergenic
1084571659 11:69963411-69963433 AAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1084683081 11:70678470-70678492 AGGGAGAGGCAGGGAGAGGCAGG - Intronic
1084742780 11:71150130-71150152 AAGGGGAAGGAGGGAGAGGGAGG + Intronic
1084935512 11:72584541-72584563 AACGAGAACCAGGGTGCGCGTGG - Exonic
1084950399 11:72662138-72662160 GAGGAGAAGCTGGGGCAGGGAGG + Intronic
1085217253 11:74843692-74843714 AAGGAGAGCCAGCGTGAGGCAGG - Intronic
1085312923 11:75526445-75526467 AGGGAGAAGCAAGGTGTCGGTGG - Intergenic
1085449241 11:76622134-76622156 ATGGTGAGGCAGGGTGAGTGTGG + Intergenic
1085469136 11:76745711-76745733 GCGGAGAAGCAGAGAGAGGGTGG - Intergenic
1085703429 11:78764925-78764947 AAGGAGAATGGGGGTGTGGGCGG + Intronic
1085730647 11:78995746-78995768 GATGAGATGCAGAGTGAGGGTGG + Intronic
1085807658 11:79651052-79651074 AAGGAGAAGAAGGAAGATGGAGG - Intergenic
1086316665 11:85602103-85602125 GAGGAGAAGCAGACTGAGGGTGG - Intronic
1086629792 11:89003407-89003429 AAGAGAGAGCAGGGTGAGGGGGG + Intronic
1088013732 11:105034972-105034994 AAGGAAAAGGGGGGAGAGGGAGG - Intronic
1088079550 11:105894644-105894666 AAGGAGGAGGAGGAGGAGGGAGG + Intronic
1088984627 11:114894669-114894691 AAAAAGGAACAGGGTGAGGGAGG + Intergenic
1089067279 11:115671368-115671390 AGGGAGGAGAAGGGTGAAGGAGG - Intergenic
1089307360 11:117535141-117535163 AAGGTGATGCAGGCTGAGGCTGG - Intronic
1089315887 11:117591192-117591214 AGGAAGTGGCAGGGTGAGGGGGG + Intronic
1089317325 11:117600870-117600892 GAGGAGAAGGAGGGGTAGGGAGG + Intronic
1089462396 11:118660841-118660863 GAGCAGCAGGAGGGTGAGGGAGG - Intronic
1089538111 11:119173045-119173067 AAGGAGAAGCAGGGTGAGGGAGG + Intronic
1089567216 11:119378158-119378180 AAGGACAAGGTGGGTGAGAGGGG + Intronic
1089689687 11:120179529-120179551 AATAAGAAGGAGTGTGAGGGTGG - Intronic
1090207061 11:124891289-124891311 AAAAAGAAGCAGGGTAAGGAGGG - Exonic
1090297194 11:125599125-125599147 TAGGAGAGGCAGAGTGAGAGAGG - Intronic
1090502966 11:127279720-127279742 AAGGAGGAGGAGGGGGAGGAGGG - Intergenic
1090502971 11:127279729-127279751 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
1090591382 11:128273841-128273863 AAAGATAAGCAGAGTGAGGGTGG - Intergenic
1090926145 11:131252012-131252034 CAAGAGAAACAGGGTGAGGCAGG - Intergenic
1090933328 11:131319403-131319425 AAGGAGAAGGAGGGGAGGGGAGG - Intergenic
1091169196 11:133505483-133505505 AAGAGGAAGCAGATTGAGGGAGG - Intronic
1202817601 11_KI270721v1_random:53012-53034 ACCGAGGAGCAGGGTGAGGGAGG - Intergenic
1091591408 12:1845070-1845092 AGGGAGAAGCAGGGTGGGGGTGG + Intronic
1091702765 12:2674689-2674711 GAGGAGAGGCAGGCAGAGGGGGG - Intronic
1091884179 12:4003906-4003928 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1092100990 12:5883614-5883636 ATGGAGAAGCAGGGTGTGGAGGG + Intronic
1092244046 12:6853051-6853073 AACGTGAAGCATGGTGTGGGAGG - Intronic
1092760284 12:11804414-11804436 AAGGTGATGGAGGATGAGGGTGG - Intronic
1093013561 12:14133526-14133548 ATGCAGGAGTAGGGTGAGGGGGG + Intergenic
1093944975 12:25098279-25098301 AAAGAGAAGGAGGGTGATTGAGG - Intronic
1093957407 12:25236637-25236659 AGAGAGAAGAAGGGGGAGGGAGG + Intronic
1094696833 12:32827990-32828012 TAGGAGAAGTAGAGTGAGGAAGG + Intronic
1095236653 12:39804834-39804856 AAAGAGAAGCAGGGTAAGTAGGG + Intronic
1095307281 12:40653010-40653032 TAGGAGAAGCAGGTTGGGGCAGG - Intergenic
1095454819 12:42372028-42372050 AAGGGGGAGTAGGGTGAGAGGGG - Intronic
1095936872 12:47693245-47693267 AAGGAGAAGGAGAGAGATGGGGG + Intronic
1095946478 12:47756621-47756643 AGGGGGAAGGAGGGAGAGGGTGG + Intronic
1096470081 12:51870064-51870086 AACAAGATTCAGGGTGAGGGTGG - Intergenic
1096719497 12:53510453-53510475 GAGGAGCAGCGGTGTGAGGGTGG + Intronic
1096846191 12:54408336-54408358 AAAGGGAAGCATGGGGAGGGTGG + Intronic
1097030136 12:56083920-56083942 AAAGAGGAGCAGGTTGAGGAAGG - Intronic
1097177799 12:57153314-57153336 AAAGAGAGGCAGGGCAAGGGTGG - Intronic
1097391840 12:59024725-59024747 AAAGAGAAGCAGAGTCAGTGAGG - Intergenic
1097678971 12:62631869-62631891 AAGGAGTAGCACTGCGAGGGTGG + Intergenic
1098221994 12:68280008-68280030 AGGGAGAATCAGGGTGAATGGGG + Intronic
1098285540 12:68903789-68903811 AAGGAGAGACAGAGGGAGGGAGG - Intronic
1098316383 12:69197848-69197870 AAGGAGAACCAGTGTGATGTGGG - Intergenic
1098495425 12:71129550-71129572 AAGGTGAAGCAGGGAGTGGAAGG - Intronic
1098971464 12:76861476-76861498 AGGGAGATGCAGGTTGAGTGAGG + Intronic
1099201364 12:79681116-79681138 AAGGAGAAGAAGGGAGGGGAGGG + Intronic
1099224163 12:79949282-79949304 AAAGAGATGCAGGGAGAAGGAGG - Intergenic
1099293586 12:80802744-80802766 CAGGAGGAGGAGGGTGAGGCAGG - Intronic
1099403216 12:82225799-82225821 AAGGAGAAGTAGGTTGAGGATGG - Intronic
1099873444 12:88375998-88376020 ATGCAGAAGCTGGGTGAGCGTGG - Intergenic
1099989584 12:89708630-89708652 AAGGAAAGGCAGGCTGCGGGAGG + Exonic
1100446563 12:94666001-94666023 ATGGAGAAGCAGGGAAAGGCTGG - Intergenic
1100643251 12:96503016-96503038 AAGGAAAGGAAGGGAGAGGGAGG - Intronic
1101209720 12:102523844-102523866 AGGGGGAAGGAGGGGGAGGGAGG + Intergenic
1101363505 12:104049983-104050005 CAGCCGAAGCAGCGTGAGGGCGG - Exonic
1101552205 12:105773498-105773520 CAAGAGAAGCAGGATGAGAGAGG + Intergenic
1101693011 12:107098350-107098372 AAGAAAAAGAAGGGGGAGGGAGG + Intergenic
1101726477 12:107392443-107392465 AATGAGAAGCAGAGGCAGGGAGG - Intronic
1101738251 12:107479872-107479894 AAGGAAAAGAAGGCTTAGGGAGG + Intronic
1101816091 12:108147281-108147303 CAAGAGAAGCAGGGTCAGGCGGG + Intronic
1101828154 12:108236854-108236876 GGGGAGAGGCAGGGAGAGGGGGG - Intronic
1101843144 12:108342079-108342101 AAGGAGGAGGAGGGAAAGGGAGG + Intergenic
1101843186 12:108342209-108342231 AAGGAGGAGGAGGGAAAGGGAGG + Intergenic
1102268110 12:111506633-111506655 AAGGAGGGGGAGGGGGAGGGGGG - Intronic
1102514143 12:113435288-113435310 AGGGAGAAGCAGAGTGAGGGAGG - Intronic
1102603861 12:114053716-114053738 GAGGCAAAGCAGGGTGAGAGAGG + Intergenic
1102734110 12:115142757-115142779 CAGGAGAAGCAGGGGAAGAGAGG - Intergenic
1102749149 12:115277182-115277204 AAGGAGGAGGAGGAGGAGGGAGG + Intergenic
1102892020 12:116567046-116567068 AAGGAAGAGAAGGGAGAGGGAGG + Intergenic
1102913663 12:116737526-116737548 AAGGAGGAGGAAGGTGAGGAAGG + Intronic
1103219475 12:119231884-119231906 AAGGAGAAGGAGGGGGAGGAGGG - Intergenic
1103270607 12:119669869-119669891 AAAAAAAAGCAGGGTGAGGCCGG - Intronic
1103341094 12:120221562-120221584 AGGGAGGAGAAGGATGAGGGAGG + Intronic
1103438117 12:120942622-120942644 TAAGAGAGGTAGGGTGAGGGTGG - Intergenic
1103705348 12:122868277-122868299 AGGGAGCAGCGGGGTGAGTGAGG - Intronic
1103834475 12:123807935-123807957 AAGGAGAAGGAGGGAGGGAGAGG + Intronic
1104371606 12:128228528-128228550 AGGAAGAAGGGGGGTGAGGGAGG + Intergenic
1104715352 12:131012702-131012724 AAGGAAAAACAAGTTGAGGGAGG + Intronic
1105578822 13:21675233-21675255 GTGGGGAAGCAGGGTGAGGCAGG + Intronic
1106591967 13:31105685-31105707 AAGGGGTAGCGGGGTGGGGGAGG - Intergenic
1107683695 13:42875823-42875845 AAGGTGAAGCAGGGAAAGGAAGG + Intergenic
1108021436 13:46131846-46131868 AAATACAAGCAGGGGGAGGGTGG + Intronic
1108711354 13:53035602-53035624 AAAGAGATGGAGGGTGAGGATGG - Intronic
1109121969 13:58469158-58469180 AAGGAGGAAGAGGGTGAAGGGGG + Intergenic
1109217450 13:59605725-59605747 AACGAGAAGAAGAGGGAGGGAGG + Intergenic
1109306319 13:60645861-60645883 AAGGAGACTCAGAGTGAGGGAGG - Intergenic
1109476909 13:62891404-62891426 AAGGAGAGGCAGAGAGAGGGAGG - Intergenic
1109617193 13:64851002-64851024 AAGGAAAAAGAGGGAGAGGGAGG - Intergenic
1110092430 13:71470418-71470440 CAGGAGAATCAGGCTGAGGCAGG - Intronic
1110111367 13:71750133-71750155 GAGGAGAAGCAGGGGAAAGGAGG - Intronic
1110955610 13:81549251-81549273 CAGGAGAAACAGTGAGAGGGGGG + Intergenic
1111057063 13:82964849-82964871 AGGCAGAAGGAGGTTGAGGGAGG + Intergenic
1111104556 13:83628849-83628871 CAGGAGAAGGAGAGTGAGGGGGG - Intergenic
1111351493 13:87036878-87036900 AAGGTGAAGCAGGGACAGGAAGG - Intergenic
1111664057 13:91245177-91245199 AAGCAGACACAGGGAGAGGGAGG - Intergenic
1112010940 13:95293380-95293402 ATGGAAAAGCTGTGTGAGGGTGG - Intronic
1112185645 13:97125531-97125553 AGGGAGAAGCAGGCTCATGGGGG - Intergenic
1112215412 13:97425876-97425898 AAGGTGAAGCAGGGACAGGAAGG - Intergenic
1113142908 13:107174754-107174776 AGGGAGAAGCAGGATGTGGCTGG + Intronic
1113235499 13:108268511-108268533 AAGGAGAGCGAGGGTGAGGCAGG + Intronic
1113496457 13:110733777-110733799 AAGGAGAAAGAGAGTGAAGGGGG + Intergenic
1113595585 13:111529711-111529733 AGGGAGGAGGAGGGGGAGGGGGG - Intergenic
1113659346 13:112094962-112094984 AAGGAGAAGGAAGGAGAGAGAGG - Intergenic
1113680678 13:112242191-112242213 AAGAAGAAAAAGGGAGAGGGAGG + Intergenic
1113710685 13:112462529-112462551 AGGGACAAACAGAGTGAGGGAGG + Intergenic
1113758691 13:112832760-112832782 AACAAGAAGCGGGGTGGGGGGGG - Intronic
1113849098 13:113407891-113407913 AAGGACAAGCAGGGGCCGGGTGG - Intergenic
1113933452 13:113980860-113980882 AGGGAGAAGAAGGGTGGAGGAGG + Intronic
1113991936 14:16034818-16034840 AAGGAGGAGGAGGGTAAGAGGGG - Intergenic
1114201220 14:20522572-20522594 AAGGAGAAGGAGGAGGAGGGAGG + Intergenic
1114266479 14:21075249-21075271 GAGGAGGAGCAGGGTTAGGCTGG + Intronic
1114458490 14:22872314-22872336 AAGGAGGAGGAGGAGGAGGGTGG - Exonic
1114614842 14:24062852-24062874 AAGGAGGAGCAGGGAGCGGGGGG - Intronic
1114630400 14:24155846-24155868 AAAGGGAAGCAGAGGGAGGGAGG + Intronic
1114654866 14:24310073-24310095 GGGAAGGAGCAGGGTGAGGGAGG + Intronic
1115642361 14:35342684-35342706 GAGGAGAAACAGGATGATGGTGG - Intergenic
1115650746 14:35401417-35401439 GAGGTGGAGCAGTGTGAGGGAGG - Intergenic
1116828787 14:49697280-49697302 AAGGAGAGGGAGAGAGAGGGGGG + Intronic
1116838709 14:49797290-49797312 AAGTAGAAGCAAGGGAAGGGCGG - Intronic
1116967375 14:51028918-51028940 AAGGGGAGCCAGGGTCAGGGTGG - Intronic
1117473035 14:56065861-56065883 AAGCAGTAACAAGGTGAGGGCGG + Intergenic
1117611336 14:57486049-57486071 AAGGAGAAGAAGGGGAGGGGAGG + Intronic
1117654389 14:57939539-57939561 AGGGATATGCAGGGAGAGGGTGG - Intronic
1117810103 14:59536561-59536583 TAGAAGAAACGGGGTGAGGGGGG - Intronic
1118766759 14:68915240-68915262 AAGAAGGAGCAGGGGGAGGAGGG - Intronic
1119067409 14:71542662-71542684 AAGGAGGAGGAGGAGGAGGGAGG - Intronic
1119182502 14:72614317-72614339 AAGGGGAAGGATGGTGATGGTGG - Intergenic
1119320386 14:73726820-73726842 AAGCAGAGGCAAGGTGAGGAGGG - Exonic
1119528388 14:75341368-75341390 AATGACAAGCAGGGTGATTGGGG + Intergenic
1120072520 14:80120057-80120079 AAAGAGAAGCAGAGTCAGGTGGG - Intergenic
1120346239 14:83294059-83294081 GAGGAGAGGCAGGGAGAGGAGGG - Intergenic
1120388515 14:83876293-83876315 AAGCAGAAGCAAGGTGGTGGGGG - Intergenic
1120930739 14:89845761-89845783 AGGGAGAAGCAGGCTGAAGATGG + Intronic
1120943229 14:89969274-89969296 AAGGGGATGCAGGGAGAAGGAGG - Intronic
1121115902 14:91342556-91342578 AAGGAGAAGCCCGGGGTGGGTGG - Intronic
1121210810 14:92206969-92206991 AATGAGAGGGAGGGTGTGGGTGG + Intergenic
1121219472 14:92274922-92274944 CAGGAGAAGGAAGGTGAGGCGGG - Intergenic
1121280744 14:92695851-92695873 AAAGAGAAACAGGGAGAGAGAGG - Intergenic
1121456404 14:94041542-94041564 AAGAAGATGCAGGCTGAGGAGGG - Intronic
1121685966 14:95835433-95835455 AAGGGGAAGTTGGGTGTGGGAGG - Intergenic
1121949297 14:98156457-98156479 AGGGAGAGGCAGGGGGAGAGTGG - Intergenic
1121962066 14:98270098-98270120 AAGGAGAGGTAGGGAGAGAGAGG - Intergenic
1122288908 14:100668955-100668977 AAGGACAAGTAGGCTGAGGCTGG - Intergenic
1122355361 14:101119941-101119963 AAGGGAAAGCACGGTGTGGGAGG - Intergenic
1122357384 14:101131889-101131911 AAGCAGAAGTAGGAGGAGGGAGG - Intergenic
1122600465 14:102918986-102919008 AAGGAGAACGAGGGAAAGGGCGG - Intergenic
1122678704 14:103439245-103439267 AAGGGGAATCAGGTTGAGGAGGG - Intronic
1122826695 14:104374145-104374167 AGGGAGCAGGAAGGTGAGGGTGG - Intergenic
1122874494 14:104657414-104657436 AGGGAGAGGCAGGGTTAGGAGGG - Intergenic
1123019909 14:105392833-105392855 AAGAACAAGAAGGGTGAGGTGGG + Exonic
1202936975 14_KI270725v1_random:97962-97984 AAAGAGGAGGAGGGAGAGGGAGG + Intergenic
1123392896 15:19895234-19895256 AAGGAGGAGGAGGGGGAGGAAGG - Intergenic
1123539257 15:21271709-21271731 GAGGAGAAGGAGGAGGAGGGTGG - Intergenic
1123662429 15:22575979-22576001 AAGGAGAGGAAGGGAGAAGGAGG - Intergenic
1124057477 15:26255354-26255376 AAGAAGAGGCAGGCTGAGGCAGG - Intergenic
1124146722 15:27134584-27134606 AAGGAGAAGCCGGGCATGGGTGG - Intronic
1124316229 15:28670263-28670285 AAGGAGAGGAAGGGAGAAGGAGG - Intergenic
1124463364 15:29913735-29913757 AGGGAGAGGAAGGGAGAGGGAGG + Intronic
1124585685 15:31004388-31004410 CAGAAGCAGCAGGGTGGGGGTGG - Intronic
1124816731 15:33001538-33001560 GAGGAGGAGGAGGATGAGGGGGG - Intronic
1124866682 15:33499193-33499215 GAGGAGAGGCAGGGAGAGGAAGG - Intronic
1124901586 15:33828236-33828258 GAGGAGAAGGAGGGAGATGGAGG - Intronic
1124902277 15:33835485-33835507 AAGGAGAGGCAGAGACAGGGAGG - Intronic
1124953652 15:34345815-34345837 AGGGAAAAGTGGGGTGAGGGTGG - Intronic
1124999534 15:34755384-34755406 ATGGAGATGCTGGCTGAGGGAGG + Intergenic
1125236583 15:37521780-37521802 AAGTCGAGGCAGGGTTAGGGAGG - Intergenic
1125268832 15:37915578-37915600 AGGGAAAAGGAGGGAGAGGGAGG + Intergenic
1125311670 15:38385897-38385919 GAGGAGATGGAAGGTGAGGGAGG - Intergenic
1125537255 15:40448807-40448829 AAGGAGATGCTGGGTGGGCGTGG - Intronic
1125691475 15:41599527-41599549 CAGCAGAAGGAGAGTGAGGGTGG + Intergenic
1125882153 15:43204292-43204314 GAGGAAAAGCAGAGTAAGGGAGG - Intronic
1126151424 15:45526604-45526626 AAGGAGAGGGAGAGTGAAGGGGG + Intergenic
1126277415 15:46900429-46900451 AAAGAGAAGCGAGGGGAGGGCGG + Intergenic
1126779738 15:52129244-52129266 AAGGAGAAACAGCGTGGGTGCGG - Intronic
1127071860 15:55295201-55295223 AAGGAGAAGGAAAGGGAGGGAGG + Intronic
1127129177 15:55844177-55844199 AAGGAGAAGAAGGGAGAGGAAGG + Intronic
1127176358 15:56362674-56362696 AAGGAGTTGCAGGGTTTGGGGGG - Intronic
1127226913 15:56940734-56940756 AAGGAGAAGGAGGAGAAGGGGGG - Intronic
1127457533 15:59168628-59168650 AAGTGGAAGCAGGGAGAGTGAGG - Intronic
1127919472 15:63481991-63482013 ACGGAGAGGCAGGGGGATGGAGG - Intergenic
1128073583 15:64812420-64812442 AAGGAGAGGCAGAGAGAAGGAGG + Intergenic
1128081024 15:64856990-64857012 CTGGAGAAGCAGGGGGAGAGGGG - Intronic
1128124945 15:65185359-65185381 AAGGAGAAGGAGGGGAAGGGAGG - Intergenic
1128236940 15:66074103-66074125 AAGGAGAAGATGGGCTAGGGAGG - Intronic
1128304201 15:66587181-66587203 AAGGAGAAGCAGGAGGAGGAGGG - Intronic
1128308386 15:66614978-66615000 GAGGAGAGGAAGGGTGAGAGGGG - Intronic
1128448575 15:67786681-67786703 TAGGAGAGGAAGGGAGAGGGAGG - Intronic
1128674559 15:69599192-69599214 AATGAGAAGCAGGGCAAGCGAGG - Intergenic
1128676857 15:69615978-69616000 TAGGAGGAGCTGGGTGAGGCGGG + Intergenic
1128726168 15:69990112-69990134 AAGGAGGAGGAGGGAGAGTGGGG - Intergenic
1128818857 15:70634328-70634350 AAGGAGAAGCAGCTGGAGGGGGG + Intergenic
1128907211 15:71477792-71477814 AAGGAGAAGCAGGTTCAGCATGG - Intronic
1129020505 15:72513708-72513730 AAGGAGGGACAGGGGGAGGGAGG - Intronic
1129077836 15:73012639-73012661 GAGGAGAAGGGAGGTGAGGGAGG - Intergenic
1129254388 15:74325869-74325891 AAGGAGGAGCTGGGTTAGGGAGG - Intronic
1129272851 15:74428591-74428613 AAGGAGGAGGAGGGTGAGTGGGG + Intronic
1129552385 15:76467057-76467079 AAGGAGGAGGAGAGTGAAGGAGG - Intronic
1129665294 15:77576226-77576248 AGGGAGGAGCAGGGGGAGGCTGG + Intergenic
1129685355 15:77683146-77683168 GGGGAGAAGCAGAGTGAGTGTGG + Intronic
1129772753 15:78213272-78213294 AAAGAGAAGCAGGGGGCGTGGGG - Intronic
1129785983 15:78310405-78310427 AGGGAGAGACAGGGTGATGGGGG + Intergenic
1130064639 15:80593771-80593793 CAGGGCAAGCAGGGCGAGGGTGG - Exonic
1130272401 15:82458862-82458884 AGGGAGAAGCAGGGATAGGTGGG + Intergenic
1130464752 15:84186215-84186237 AGGGAGAAGCAGGGATAGGTGGG + Intergenic
1130487933 15:84408589-84408611 AGGGAGAAGCAGGGATAGGTGGG - Intergenic
1130499514 15:84487322-84487344 AGGGAGAAGCAGGGATAGGTGGG - Intergenic
1130587044 15:85190829-85190851 AGGGAGAAGCAGGGATAGGTGGG + Intergenic
1131284757 15:91047965-91047987 GAGGAGGAGGAGGGTAAGGGGGG - Intergenic
1131390450 15:92043881-92043903 AGGGAGAAACAGGAGGAGGGAGG - Intronic
1131635001 15:94223325-94223347 TAGAAAAAGCAGGGTGAGGTGGG + Intergenic
1131656950 15:94470898-94470920 ATCCAGAAGCAGGGAGAGGGAGG + Intronic
1131827652 15:96333482-96333504 AAAGAGACGGAGGGAGAGGGCGG - Intronic
1132053775 15:98633958-98633980 AAGGAGGAGGAGGAGGAGGGAGG - Intergenic
1132247222 15:100306955-100306977 AAGGAGAACGAGGCTGAGAGAGG + Intronic
1132391688 15:101443780-101443802 TATGAGGAGCAGGGTGATGGAGG - Intronic
1133024489 16:2982043-2982065 ATGGAGCAGCAGTGTGGGGGAGG + Intergenic
1133026860 16:2992376-2992398 GAGGAGAAGCAGTGTGTGAGGGG - Intergenic
1133064795 16:3198126-3198148 AGGGAGAAGGAGGGAGAGAGAGG + Intergenic
1133162380 16:3920584-3920606 ATGGAGAAGCAGGCAGAGGACGG - Intergenic
1133366613 16:5215374-5215396 TAGAAGACGCAGGGTGAGGAAGG - Intergenic
1133392602 16:5422237-5422259 GAGGAGGAGCAGGGAGAGGGAGG + Intergenic
1133392808 16:5422956-5422978 GAGGAGGAGGAGGGAGAGGGAGG + Intergenic
1133392824 16:5423003-5423025 AAGGAGGAGAAAGGAGAGGGAGG + Intergenic
1133588304 16:7217048-7217070 AAGGAGAGGGAGAGAGAGGGAGG - Intronic
1134031877 16:10998652-10998674 AAGGAGAAGAAGGAGAAGGGAGG - Intronic
1134074827 16:11283289-11283311 AGGGAGAAGAAGGGAGAGAGAGG + Intronic
1134242453 16:12515986-12516008 AAGGGGAAGCAGGGGAGGGGAGG + Intronic
1134510757 16:14845131-14845153 AAGGAGCGGGAGGGTGAGGCAGG - Intronic
1134698397 16:16243618-16243640 AAGGAGCGGGAGGGTGAGGCAGG - Intronic
1134892584 16:17854062-17854084 AAGGAGATGGAAGATGAGGGAGG + Intergenic
1134973438 16:18551060-18551082 AAGGAGCGGGAGGGTGAGGCAGG + Intronic
1135066537 16:19314898-19314920 AGGGAGAAGAAGGGAGAGGAAGG + Intronic
1135295730 16:21278009-21278031 AAGGAGGAGCAGGAAGAGGAGGG - Intronic
1135594328 16:23730106-23730128 AAAGGGAAACAGGGTGAGGCAGG - Intergenic
1135694729 16:24575842-24575864 AGGGAGAGGGAGGGGGAGGGAGG + Intergenic
1135937521 16:26793668-26793690 AAGGAGCAGAAGAGGGAGGGAGG - Intergenic
1135979372 16:27135403-27135425 AAGGAAAAGCAGGGGGTGGTGGG - Intergenic
1135996828 16:27256396-27256418 GAGGAGAAGCAGAGTGGGAGTGG - Intronic
1136345572 16:29673442-29673464 AAGGGGAAGCCGGGGAAGGGAGG + Intronic
1136357988 16:29759088-29759110 AAGGAGAAAGAGAGTGAGAGAGG + Intergenic
1136617520 16:31407693-31407715 AAGGAGATGCAGGCTGAGCCTGG - Intronic
1136799199 16:33055245-33055267 AAGGAGGAGGAGGGGGAAGGAGG - Intergenic
1136858740 16:33681838-33681860 AGGTAGAGGCAGGGAGAGGGAGG + Intergenic
1136901684 16:34046470-34046492 AAGGAAGAGGAGGGGGAGGGAGG - Intergenic
1137247049 16:46714442-46714464 AAAGAGCAGCAAGGTGACGGGGG + Intronic
1137313646 16:47292653-47292675 GAAGGGAAGGAGGGTGAGGGGGG - Intronic
1137509857 16:49089695-49089717 AAGGAAAACCAGGGTCAGTGTGG + Intergenic
1137617495 16:49856221-49856243 AAGGAGGAGGAGGGTGAGGGTGG - Intronic
1137822161 16:51456487-51456509 AAGGAGGGACAGAGTGAGGGAGG - Intergenic
1137925818 16:52540716-52540738 AATAAGAAGCAAGGTGATGGTGG - Intronic
1138070077 16:53984237-53984259 TAAGAAAAGCAAGGTGAGGGTGG - Intronic
1138130597 16:54476343-54476365 CAGGAGAAGGAGGTAGAGGGTGG + Intergenic
1138186390 16:54981052-54981074 AAGGCCAAGCAGGGTCAGGCCGG + Intergenic
1138318600 16:56091478-56091500 GAGGTGAAACAGGGTGAGGAGGG + Intergenic
1138474319 16:57261815-57261837 AAGAAGTGGCAGGGTGTGGGGGG - Intronic
1138541630 16:57691158-57691180 AGGGAGAAGGAGGGAGAAGGAGG + Intergenic
1138656114 16:58492414-58492436 CAGGAGATGAAGGGTGTGGGAGG - Intronic
1139055099 16:63173843-63173865 AGTGAGAAGCAGGAGGAGGGAGG - Intergenic
1139189014 16:64840115-64840137 AAAGAGAAGGAGGCTGAAGGTGG - Intergenic
1139356284 16:66368740-66368762 AGGTAGAAGCAGGGTGAGTGCGG + Intronic
1139415477 16:66804998-66805020 AGGGGGAAGTAGAGTGAGGGAGG + Intronic
1139766905 16:69238179-69238201 AAGAAGGAGGAGGGTGAGGTTGG + Intronic
1140123387 16:72101808-72101830 CAGAGGAAGCAGTGTGAGGGAGG - Intronic
1140151940 16:72376302-72376324 AAGGAGAAGCAGGGTGCTAAGGG + Intergenic
1140965727 16:79964259-79964281 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1141249982 16:82346917-82346939 GAGGAGGAGCAGGGTGAAGCAGG + Intergenic
1141346195 16:83248276-83248298 AAGGAGAAACAGAGGCAGGGGGG + Intronic
1141372467 16:83500534-83500556 AGGGAGGAGGAGGGAGAGGGAGG - Intronic
1141372473 16:83500550-83500572 AGGGAGGAGGAGGGAGAGGGAGG - Intronic
1141514594 16:84535193-84535215 AAGGAGAAGGAGGAAGAGGAGGG - Intronic
1141609713 16:85174522-85174544 AATGGGAAGGAGGGGGAGGGAGG - Intronic
1141631637 16:85291277-85291299 AGGGAGGAGGAGGGTGAGGAGGG - Intergenic
1141635655 16:85312676-85312698 CAGAAGAAGCAGGGAGGGGGAGG + Intergenic
1141635674 16:85312745-85312767 GAGGAGAAGGAGGGGGAGGAAGG + Intergenic
1141703583 16:85653208-85653230 GAGGAGGAGGAGGGGGAGGGGGG - Intronic
1141728910 16:85809003-85809025 AGGGAGAGGGAGGGGGAGGGAGG + Intergenic
1141766612 16:86063520-86063542 AAGGAGAGGGAAGGAGAGGGAGG + Intergenic
1141766638 16:86063610-86063632 AAGGAGAGGGAAGGAGAGGGAGG + Intergenic
1141766655 16:86063660-86063682 AAGGAGAGGGAGGGAGAGGGAGG + Intergenic
1141766665 16:86063690-86063712 AAGGAGAGGGAGGAAGAGGGAGG + Intergenic
1141775723 16:86121615-86121637 AAGAAGAAGGAGGAGGAGGGAGG - Intergenic
1142273693 16:89104601-89104623 CAGGAGAAGCAGAGGGAAGGTGG - Intronic
1142567017 17:846853-846875 AAGGAGAAAAATGGTGGGGGTGG + Intronic
1142981466 17:3674664-3674686 ACGGAGAACCTGGGTGAAGGCGG - Intronic
1143097929 17:4488363-4488385 ATGGAGAAGCTGGGTCAGAGTGG - Intergenic
1143193778 17:5059801-5059823 AAGGAGGAGGAGGAGGAGGGGGG - Intergenic
1143391364 17:6561092-6561114 AAGGAGAAGGAGGAAGAGGAAGG - Intergenic
1143478913 17:7217629-7217651 GAGAGGAAGCAGGGGGAGGGAGG + Intronic
1143557073 17:7668476-7668498 AGGGAGAAGGAGGGGAAGGGTGG + Exonic
1143658705 17:8312099-8312121 AACGAGAAGGAGGGCGGGGGCGG - Exonic
1143711177 17:8736325-8736347 AGGGAGAAGCAGGGATAGAGAGG + Intronic
1143730822 17:8881778-8881800 CAGGAGGAGCTGGGTGAGTGGGG - Exonic
1143770138 17:9163244-9163266 AAGGAGAAGAAAGGAGAAGGTGG + Intronic
1144047864 17:11469688-11469710 AGGGAGAGGCAGGGAGAAGGGGG - Intronic
1144419869 17:15086719-15086741 AAGGAGGAGGGGGTTGAGGGAGG + Intergenic
1144704850 17:17361646-17361668 GAAGAGAGGCAGGGAGAGGGAGG + Intergenic
1144763048 17:17718127-17718149 CAGGGGAAGCAGGGGGAGAGGGG - Intronic
1144853654 17:18256729-18256751 AAGAAGAGGCCGGGTGAGTGAGG - Intronic
1144855885 17:18267601-18267623 AAGGACCAGCAGGGTGCGAGTGG - Intergenic
1144960251 17:19040589-19040611 AAGGAGGTGCAGGGCCAGGGTGG - Intronic
1144974909 17:19133935-19133957 AAGGAGGTGCAGGGCCAGGGTGG + Intronic
1145246510 17:21273232-21273254 CAGTAGAAGGAGGCTGAGGGAGG - Intergenic
1145302418 17:21649896-21649918 AGGAAGAAGCAGAGGGAGGGAGG - Intergenic
1145347902 17:22053416-22053438 AGGAAGAAGCAGAGGGAGGGAGG + Intergenic
1145347928 17:22053558-22053580 AAGGAGTGGCAGGGAGAGTGAGG - Intergenic
1145375444 17:22343421-22343443 CTGAAGAAACAGGGTGAGGGGGG - Intergenic
1145415691 17:22711966-22711988 AGGAAGAAGCAGAGGGAGGGAGG - Intergenic
1145775377 17:27524256-27524278 GAGGTCAAGCAGGATGAGGGTGG + Intronic
1145814302 17:27784394-27784416 AAGGAGCTGCTGGGTGAGGTGGG + Intronic
1146466628 17:33091312-33091334 ATGGGGAAGAAGGGTGAGTGTGG + Intronic
1146792606 17:35760942-35760964 ATGGATAAGCATGGTGAGTGGGG + Exonic
1146892599 17:36515696-36515718 AAGGAGTACCAGGGAGAGGTTGG + Intronic
1147034553 17:37670579-37670601 CGGGAGAAGCAGGAGGAGGGAGG + Intergenic
1147266249 17:39236686-39236708 ATGGGGGAGCAGGGTGATGGAGG - Intergenic
1147392942 17:40121721-40121743 AGGGGGAAGAAGGGCGAGGGCGG - Intergenic
1147490296 17:40859766-40859788 AAGAAGCAGAAGGGAGAGGGAGG - Intergenic
1147641248 17:42001824-42001846 ATGGAGAAGAATGGAGAGGGAGG - Intronic
1147792074 17:43020211-43020233 AAGGAGGAGGAGGGAGAGAGAGG + Intronic
1148128509 17:45248712-45248734 AAGGTGAAGGAGGGTGAGGAGGG + Intergenic
1148177503 17:45580018-45580040 AAGGACAGGCAGATTGAGGGAGG - Intergenic
1148191426 17:45681328-45681350 AGGGTGGAGCAGGATGAGGGTGG - Intergenic
1148197923 17:45728113-45728135 AAGGTGATGCCTGGTGAGGGTGG - Intergenic
1148493509 17:48037926-48037948 AAGGAGAGGTGGGGTGAGGGCGG - Intronic
1149273161 17:55004716-55004738 AAGGAGGAGGAGGGGGAAGGAGG + Intronic
1149490496 17:57081637-57081659 AATGAGAAGAGAGGTGAGGGTGG - Intergenic
1149568629 17:57656643-57656665 AAGGTTAAGTAGGGTGAGAGTGG + Intronic
1149612464 17:57967632-57967654 AGGGAGAAGAATGGGGAGGGGGG - Intergenic
1150139581 17:62716889-62716911 AAGGACAAGCAGCAGGAGGGTGG + Intronic
1150294372 17:63999993-64000015 CAGGAGAAGCAGGGACTGGGTGG + Intronic
1150373556 17:64662065-64662087 AAGGAGAAGTGGGAGGAGGGGGG - Exonic
1150578608 17:66452418-66452440 GGGAAGAAGCAGGGTGAGGAGGG + Intronic
1150747827 17:67830606-67830628 AAGGAAAGGCAGATTGAGGGAGG + Intronic
1150855421 17:68747621-68747643 AAGGAGGAGCAGGGCTAGAGTGG + Intergenic
1151352039 17:73537514-73537536 ATGGAGAGGCAGGCAGAGGGTGG + Intronic
1151393292 17:73802223-73802245 GAGGAGAAGCAGGTTTAGTGGGG - Intergenic
1152036600 17:77877144-77877166 AGGGAGGAGGAGGTTGAGGGAGG + Intergenic
1152161286 17:78670059-78670081 AAGGAGGAGCAGGGAGCGAGGGG - Intergenic
1152339406 17:79716019-79716041 CAGCAGAAGCCGGGAGAGGGTGG + Intergenic
1152356845 17:79811649-79811671 AAGGAGGACGAGGGTAAGGGAGG - Intergenic
1152580446 17:81163411-81163433 CAGGAAAAGCAGGGTGATGGGGG - Intronic
1152661966 17:81546659-81546681 CAGGAGCAGCTGGGAGAGGGAGG + Intronic
1152672523 17:81617663-81617685 AAAGAGACGGAGGGGGAGGGGGG - Intronic
1152850286 17:82629933-82629955 AAGGAGAGGCTCAGTGAGGGAGG - Intronic
1153360074 18:4184648-4184670 AAGGAAAGGCAGGGTGATGTTGG - Intronic
1153383611 18:4467361-4467383 AACTACAAGCAGGGAGAGGGAGG - Intergenic
1153557725 18:6333617-6333639 ATGGAGAAGCAGGATGCAGGTGG + Intronic
1153566418 18:6422729-6422751 AAGGAGAAGGAGAGAGATGGGGG + Intergenic
1153569895 18:6459700-6459722 AAGGAGAAGAAGAGAGATGGAGG - Intergenic
1154285722 18:13054605-13054627 ATGAAGAAACAGGTTGAGGGAGG - Intronic
1155185573 18:23383877-23383899 AAGGAGCGGCAGGATGATGGGGG + Intronic
1155345331 18:24851958-24851980 CAGTAGAAGGAAGGTGAGGGAGG - Intergenic
1155355089 18:24944180-24944202 AATGAGAAGGGGGTTGAGGGAGG + Intergenic
1155907503 18:31469308-31469330 AAGGAGCAGCAGGCCGATGGCGG - Exonic
1156958782 18:42997457-42997479 AGAGAGAAGAAGGGGGAGGGAGG + Intronic
1156987093 18:43361395-43361417 AAGGAGAAGGGGTGGGAGGGAGG - Intergenic
1157175364 18:45446927-45446949 GATGAGAAGCAGGGTGGGGAGGG - Intronic
1157214701 18:45773176-45773198 AAGGAGAAGGAGAGGGAAGGAGG - Intergenic
1157408077 18:47440526-47440548 GAGAAGAAGGAGAGTGAGGGAGG + Intergenic
1157501310 18:48192848-48192870 TAGGAGAAACAAGGCGAGGGAGG + Intronic
1157584642 18:48793247-48793269 AGGGAGAAGCAGGGAGGGGCAGG + Intronic
1157687868 18:49657361-49657383 AGGCAGCAGCAGGGTGAGGATGG - Intergenic
1157768664 18:50325135-50325157 AAGGAGAAGGAGGAGGAAGGAGG - Intergenic
1157991769 18:52504800-52504822 CTGGAGAAGCAGGCTGAGGTTGG - Intronic
1158191770 18:54837441-54837463 AAGGAAAGGCAGGTTGGGGGAGG + Intronic
1158423114 18:57313455-57313477 AAGGAGAAGGAAGGGGAGTGGGG + Intergenic
1158494654 18:57943471-57943493 GAGGAGAAGGAGGGAGAGGTTGG - Intergenic
1158499059 18:57983547-57983569 AAGAAAAAGAAGGGAGAGGGAGG + Intergenic
1158525487 18:58209312-58209334 GAGGAGGAGGAGGGGGAGGGGGG - Intronic
1158564008 18:58538893-58538915 GAGAGGAAGCAGGGTGGGGGTGG - Intronic
1158621743 18:59038617-59038639 GAGGAGAAGCAGGGTCTGGAGGG + Intergenic
1158835881 18:61331726-61331748 AAGGAGAAGGAGGAAGAGGGAGG - Intergenic
1158907117 18:62024496-62024518 GAGGAGAACCAGGGTTAAGGGGG - Intergenic
1159122084 18:64182879-64182901 AGGGAGAGGCAGAGGGAGGGAGG - Intergenic
1159396691 18:67866921-67866943 GAGGAAGAGCAGGGTGAGAGAGG + Intergenic
1159915400 18:74183191-74183213 GAGGAGAAGTAGGGGGAGGTGGG - Intergenic
1160254867 18:77239699-77239721 AATGAGGAGCAGAGTGAGGAAGG - Intergenic
1160308216 18:77761095-77761117 AAGGAGAAGCAGGCTGCAGCAGG - Intergenic
1160432318 18:78820115-78820137 ATGGAGAAACAGGGGGAGAGAGG + Intergenic
1160448664 18:78947083-78947105 AAGGAGGAGGAGGGAGAAGGAGG + Intergenic
1160611204 18:80086793-80086815 TAGGAGAAGCAGGATGGGGAGGG - Intronic
1160711163 19:551631-551653 AAAGAGAAGAAGGGGAAGGGAGG - Intergenic
1160829088 19:1094611-1094633 AAGAAGAATCAGGCTGCGGGGGG + Intronic
1160845623 19:1164806-1164828 GAGGAGGAGCAGGAGGAGGGAGG + Intronic
1160950836 19:1666515-1666537 AAGGAGAAGAAGGAAGAAGGAGG - Intergenic
1161208177 19:3053209-3053231 TGGGAGGAGCAGGGTGAGGGTGG - Exonic
1161238762 19:3210471-3210493 GAGAAGAAGCAGGGAGAGGTGGG + Intergenic
1161352826 19:3803415-3803437 AGGCAGATGCAGGGTGGGGGCGG - Intergenic
1161352834 19:3803438-3803460 AGGCAGATGCAGGGTGGGGGAGG - Intergenic
1161390640 19:4018685-4018707 AAGGAGCAGCAGAGTGATGTAGG + Intronic
1161404010 19:4081826-4081848 AAGGAGGAGCAGGGGGGAGGAGG - Intergenic
1161415624 19:4145138-4145160 AAGGAGGAGGAGGAGGAGGGAGG + Intergenic
1161517148 19:4702845-4702867 AGGGAGAGGGAGGGAGAGGGAGG + Intronic
1161606409 19:5217119-5217141 AAGGAGAAGCTGGGGGAGCAGGG + Intronic
1161684938 19:5697989-5698011 AAGGAGCAGCTGGGTGAAGGTGG - Intronic
1162038174 19:7953554-7953576 AAGGAGGAGGAGGGGGAAGGAGG - Intergenic
1162458590 19:10800803-10800825 AAAGACAAGAAGGATGAGGGAGG + Intronic
1162864908 19:13538351-13538373 AAGCAGAAGCTGGGAGGGGGAGG + Intronic
1162916477 19:13877062-13877084 AGGGAGGAGCAGGCTGTGGGAGG - Intronic
1163387247 19:17007405-17007427 AAGAAGAAGCAGGAGGAGAGGGG + Intronic
1163453993 19:17395241-17395263 AAGGAGAAACAGGAAGAGGAGGG - Intergenic
1163501031 19:17676363-17676385 CAGGGGATGCAGGGAGAGGGAGG - Intronic
1163531482 19:17851966-17851988 AAGAAAAAGCAGGCTGAGGCAGG + Intergenic
1163564893 19:18045233-18045255 GAGGAGAAGGAGGGTGGAGGAGG + Intergenic
1163717382 19:18880021-18880043 AAGGATAAGCCAGGTGAGGTGGG - Intronic
1163779166 19:19237197-19237219 AAGGAAAAGTAGGCTGAGGATGG - Intronic
1164434333 19:28216338-28216360 AAAGAGAGGCTGGGAGAGGGTGG - Intergenic
1164591879 19:29511931-29511953 AAGGAGAGGGAGGATGAGGAAGG + Intergenic
1164798401 19:31055071-31055093 CAGGGCAAGCAGGGAGAGGGAGG + Intergenic
1164858637 19:31544966-31544988 AAAGAGAAGGAGGAGGAGGGAGG - Intergenic
1164858645 19:31545018-31545040 AAAGAGAAGAAGGAGGAGGGAGG - Intergenic
1164859418 19:31551154-31551176 GAGAAGGAGAAGGGTGAGGGAGG - Intergenic
1165112036 19:33508087-33508109 AAGGAGAAACAGCTTCAGGGAGG - Intronic
1165426802 19:35750357-35750379 GAGGAGAGACAGAGTGAGGGTGG - Intronic
1165598402 19:37031463-37031485 AAAGAGAAGCAAGGAGAGGATGG - Intronic
1165873513 19:38989648-38989670 AAGGAGAAAGAGAGAGAGGGAGG - Intergenic
1165998731 19:39864514-39864536 AACTAGAACCAGGCTGAGGGAGG - Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166139863 19:40799906-40799928 AGGGAGAGTCAGGGTGGGGGCGG - Exonic
1166159212 19:40939139-40939161 AGGGAGAAGGAGAGGGAGGGTGG + Intergenic
1166536766 19:43579564-43579586 GAGGAGAAGCAGAGACAGGGAGG + Intronic
1166631354 19:44410457-44410479 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1166636816 19:44458137-44458159 GAGAAGAAGCTGGGTGAGGCAGG + Intergenic
1166643558 19:44514355-44514377 AAGGATCAGGAGGGTGAGGAAGG + Intronic
1166783012 19:45352106-45352128 GAGGACAGGCAGGCTGAGGGTGG + Intronic
1166866605 19:45842240-45842262 AAGATGAAGCTGGGTGAGAGGGG - Exonic
1166873329 19:45883638-45883660 AAGGAGCAGAAGGGAGCGGGGGG + Exonic
1166875180 19:45892592-45892614 AGGAAGGAGCAGGGTGGGGGAGG - Intronic
1166960287 19:46492914-46492936 GAGGAGGAGGAGGGGGAGGGGGG - Exonic
1166976978 19:46610481-46610503 GAGGGGAAGCAGGGGGTGGGGGG - Exonic
1167097081 19:47380267-47380289 AAGGACAGGCAGGGTGTGAGAGG + Intronic
1167149249 19:47699393-47699415 AAGGAGAAGCCGGGTGAGAGGGG + Exonic
1167333118 19:48868585-48868607 AAAGAGAAACTGGGAGAGGGAGG - Exonic
1167474959 19:49694787-49694809 AAGGAGTCCCAGGGTAAGGGCGG - Intronic
1167479261 19:49719526-49719548 AAGAAGGGCCAGGGTGAGGGTGG - Intergenic
1167643023 19:50692530-50692552 AAGCAGAAGCAGGAACAGGGTGG - Intronic
1167662847 19:50806164-50806186 AAAGAGATGCAGGCTGAGAGGGG - Intergenic
1167794056 19:51697660-51697682 AGGGAGCAGCAGGGAGATGGAGG + Intergenic
1168075649 19:53979827-53979849 AAGGAAAAGGAGGGAGAGCGAGG - Intronic
1168239918 19:55083807-55083829 AGGGAGGAGCAGGGTGGGAGGGG + Intronic
1168290262 19:55354124-55354146 TAGGAGGAGCAGTGTGAGGGAGG - Exonic
1168639262 19:58019964-58019986 AAGGAAAACCAGGATGATGGTGG + Intergenic
1202648894 1_KI270706v1_random:163157-163179 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1202649372 1_KI270706v1_random:166431-166453 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
925047804 2:787883-787905 GAAGAGAAGCAGGTTGAGGCAGG + Intergenic
925306185 2:2849439-2849461 AAAAAGAAGGAGGGGGAGGGGGG - Intergenic
925542439 2:4980123-4980145 AAGGAGGAGCATGGAGAGAGTGG + Intergenic
925596021 2:5556148-5556170 AAGCGGAAGGAGTGTGAGGGAGG + Intergenic
925957477 2:8981630-8981652 AAAGAAAAGCAGGATGAGAGAGG + Intronic
926394848 2:12430406-12430428 AAGGAGAAGAAGGAGGAAGGAGG + Intergenic
926699146 2:15790982-15791004 CAGGACAAGCAGGGTGTTGGAGG + Intergenic
926803526 2:16683695-16683717 TAGGAGAATCAGGGAGAAGGGGG - Intergenic
927085522 2:19671310-19671332 AAGGTGAGGCTGGGGGAGGGTGG + Intergenic
927142366 2:20139262-20139284 AGGGAGAAGAAGGGGAAGGGAGG - Intergenic
927250037 2:20989143-20989165 GAGGAAAGGCAGGGTGAGGCGGG - Intergenic
927659517 2:24981048-24981070 GAGAAGAAGGAGGGGGAGGGGGG + Intergenic
927713311 2:25339047-25339069 AAGGAGAGGCAGTGTGAGGAGGG - Intronic
928432567 2:31233243-31233265 AAGGTGAAAGAGAGTGAGGGAGG - Intronic
929051672 2:37842279-37842301 AAGGAGAGGCAGACTGAGTGTGG + Intergenic
929351835 2:40965644-40965666 AAAGAGAATCAGGATTAGGGAGG - Intergenic
929456998 2:42073077-42073099 AAAGAGAGGCAGGGAGAAGGAGG - Intergenic
929863799 2:45700837-45700859 AGGCAGATGCAGGGAGAGGGCGG + Intronic
929939982 2:46326222-46326244 TGGGAGAAGCAGGGGGAGTGGGG + Intronic
929978462 2:46656988-46657010 GAGGACAAGCATGGTGAGTGGGG - Intergenic
930895273 2:56439164-56439186 AAGGAGGAAGAGGGTGAAGGGGG + Intergenic
931133410 2:59366292-59366314 AAAGAGAAGAAGAGAGAGGGAGG + Intergenic
931163888 2:59724493-59724515 CAGGAGAAGCAGAGGGAGTGAGG + Intergenic
931205340 2:60140843-60140865 GAGGAGAAGGAGGGGGAGGGGGG - Intergenic
932877038 2:75463613-75463635 AAGGAGATGCAGGTTGGGAGTGG - Intergenic
932894174 2:75622636-75622658 AAGAAGAGACAGAGTGAGGGAGG + Intergenic
932985000 2:76715295-76715317 AAGAAGAAGAAGGGTAAGGAAGG + Intergenic
933272699 2:80250431-80250453 GAAGAGAAGCAGGCTGAGGATGG + Intronic
933293275 2:80461374-80461396 AAGGAGTAGGGAGGTGAGGGAGG - Intronic
934056827 2:88258330-88258352 AAGGAGAAGAGAGGAGAGGGAGG - Intergenic
934189315 2:89771667-89771689 AAGGAGGAGGAGGGAGAGGGAGG + Intergenic
934303940 2:91805360-91805382 AAGGAGGAGGAGGGAGAGGGAGG - Intergenic
934329314 2:92047390-92047412 AAGGAGGAGGAGGGAGAGGGAGG + Intergenic
934467533 2:94277311-94277333 AAGGAGGAGGAGGGAGAGGGAGG + Intergenic
934491590 2:94764873-94764895 AAGGAAAAGGAGGGGTAGGGTGG - Intergenic
934692873 2:96375266-96375288 TAGGAGAAGCAGGGTTGTGGGGG - Intergenic
934995370 2:98953090-98953112 GAGGAGAAGGAGGGCGGGGGAGG - Intergenic
935165762 2:100567463-100567485 GAGGAGAAGCAGGCTCAGAGAGG + Intronic
935539802 2:104336101-104336123 GAGGTGAAGTGGGGTGAGGGTGG - Intergenic
935618389 2:105108587-105108609 GAGGAGACGCAGGGTGGAGGTGG - Intergenic
935720548 2:105975298-105975320 AAGGAAAGGCAGAGTGAGAGAGG - Intergenic
935791953 2:106601024-106601046 AAGGTGAAGCAGGGGCAGGTAGG + Intergenic
936255084 2:110904369-110904391 AAGGAGAAGCAGGGAAGGGTGGG + Intronic
936291306 2:111225975-111225997 AAGGGGAACCAGTGGGAGGGAGG + Intergenic
936379438 2:111970825-111970847 AAGGAGGAGAAGGAGGAGGGAGG - Intronic
936495577 2:113017794-113017816 AGGGAGAAGGAGGGAGAAGGAGG + Intergenic
937209849 2:120261373-120261395 AAGGAGAAGAAGGGCGTGGAAGG + Intronic
937217309 2:120321102-120321124 AAGGAGGAGGAGGGAGAAGGAGG - Intergenic
937217318 2:120321131-120321153 AAGGAGGAGGAGGGAGAAGGAGG - Intergenic
937217377 2:120321294-120321316 AGGGAGAAGGAGGAGGAGGGAGG - Intergenic
937217381 2:120321304-120321326 AAGGAGGAGGAGGGAGAAGGAGG - Intergenic
937217386 2:120321320-120321342 AAGGAGGAGGAGGGAGAAGGAGG - Intergenic
937289238 2:120772059-120772081 AGGGGGATGCAGGGTGATGGAGG + Intronic
937369340 2:121286650-121286672 CAGGAACAGCAGAGTGAGGGAGG - Intergenic
938020821 2:127904598-127904620 AAGGAGAAGCAGGGTGCTCTGGG + Intergenic
938063023 2:128266961-128266983 AAGGAGAGCCAGGGTGGGGAGGG + Exonic
938064519 2:128273803-128273825 AAACAGAAGCAGGAAGAGGGCGG + Intronic
938105353 2:128526312-128526334 CAGGAGAACCAGAGGGAGGGTGG - Intergenic
938371070 2:130768612-130768634 AGGGAAAAACAGGCTGAGGGTGG - Intergenic
938466870 2:131530386-131530408 ATGGAGAAGGGGGTTGAGGGAGG + Intronic
938518675 2:132042419-132042441 AAGGAGGAGGAGGGGGAGGGAGG + Intergenic
938526270 2:132135665-132135687 AAGAACAAACAGGGTGGGGGTGG + Intergenic
938540798 2:132282138-132282160 AGGGAGAAGCTGGGTGAGACAGG + Intergenic
938541628 2:132288041-132288063 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
938980548 2:136522233-136522255 AAGGAGAAGCACAGTGAGAAGGG - Intergenic
939250150 2:139672267-139672289 AAGGATAAGCAGAGTTAGGGTGG + Intergenic
939568200 2:143809843-143809865 AAAAATAAGCAGGGTGGGGGGGG + Intergenic
940274564 2:151925680-151925702 AAAGAGGAGCAGGGAGGGGGTGG + Intronic
941228812 2:162883163-162883185 AAGGAGAAGGAAAGTGATGGTGG + Intergenic
941740538 2:169030344-169030366 AGGGGGAACCAAGGTGAGGGGGG + Intronic
941893300 2:170604961-170604983 TAAGAGAAGAAGGGTGAGGGAGG - Intronic
941911737 2:170770933-170770955 ACGGAGAGGCAGGGTGGAGGCGG - Intergenic
942135983 2:172925947-172925969 AAGGAGGGGGAGGGGGAGGGGGG + Intronic
942202711 2:173587979-173588001 AAATAGAAGCAGAGTGAGAGAGG + Intergenic
942211773 2:173678299-173678321 AAGGAGGAGGAGAGGGAGGGAGG + Intergenic
942683658 2:178508435-178508457 AAGCAGAAACATGGTGGGGGAGG - Exonic
942947529 2:181685598-181685620 AAGGAGGAGGAAGGGGAGGGAGG - Intergenic
942985413 2:182134781-182134803 GAGGAGCAGCAGGATGAGGGTGG + Intergenic
943291314 2:186075562-186075584 AAGGAGAAGGAGGAAGAGGAGGG - Intergenic
943359665 2:186902107-186902129 AAGCTGAAGCAGGGGGTGGGAGG - Intergenic
943847031 2:192663450-192663472 AAGGTTAAGCAGGTTAAGGGAGG + Intergenic
944006948 2:194921111-194921133 AAGGTGAAGCAGGGACAGGAAGG - Intergenic
944142767 2:196475322-196475344 AAGGAGATGGGGGGAGAGGGAGG + Intronic
944414270 2:199467534-199467556 AAGGGGAAGAGGGCTGAGGGCGG + Intronic
944455973 2:199894579-199894601 AAGGAGCAGCAGAGTCAAGGTGG - Intergenic
944912799 2:204326928-204326950 AAGGACAAGCAGGATGAATGAGG + Intergenic
945911373 2:215653630-215653652 AGAGAGAAGCAGGGAGAAGGAGG + Intergenic
946060900 2:216940743-216940765 AAGGAAAAGCAAGGACAGGGTGG - Intergenic
946322368 2:218961340-218961362 ATGGAAAGGCAGGGAGAGGGAGG - Exonic
946431688 2:219629810-219629832 AAAGAGGAGCAGGGTGTGGGAGG + Intronic
946501835 2:220257332-220257354 GAGGAGACGGAGGGGGAGGGAGG + Intergenic
946538589 2:220658629-220658651 AAGGAGGAGAAGGGAGAGAGAGG + Intergenic
946964944 2:225027608-225027630 CAGGAGAAGGAGAGAGAGGGAGG - Intronic
947197918 2:227587154-227587176 AAAGAGAACCAGGGCGAGGTTGG + Intergenic
947231194 2:227888389-227888411 AAGCAGAAGCAGGATCAGGCGGG + Intronic
947452875 2:230224452-230224474 AGGGAGAGGGAGGGAGAGGGAGG + Intronic
947554015 2:231073094-231073116 AAGGAGAAGGAGAGAGATGGGGG + Intronic
947594082 2:231399932-231399954 CTGGAGAAGCAGGGTGCGGTGGG - Exonic
947756251 2:232567572-232567594 ATGCAGAAGTGGGGTGAGGGTGG - Intronic
947948594 2:234127901-234127923 AAGGAAAAGCAGGGTAGGGCAGG - Intergenic
948011748 2:234654256-234654278 GAGGAGAAAAAGGCTGAGGGAGG + Intergenic
948057899 2:235022862-235022884 TGGGAGGAGCAGGGTCAGGGTGG + Intronic
948091793 2:235301744-235301766 AGGGAGAAGGAGGGAGGGGGAGG - Intergenic
948295454 2:236857088-236857110 AGGGAGAAGGAGGGAGAGAGAGG - Intergenic
948506425 2:238430251-238430273 AAGCAGCAGCAGGGTTAGAGAGG - Intronic
948681686 2:239639479-239639501 AAGGTGAAGCAGGGACAGGAAGG - Intergenic
948694317 2:239725544-239725566 AGGGAGAAGGTGAGTGAGGGAGG + Intergenic
948721868 2:239905783-239905805 AAGAAGAAGCGGGGAGAGGAGGG + Intronic
949060342 2:241953224-241953246 AGGGAGAAGGGGGGAGAGGGAGG + Intergenic
1169016924 20:2299612-2299634 AAGGAAAATCAGGCTGAGGGAGG - Intronic
1169247896 20:4038252-4038274 GCAGAGAGGCAGGGTGAGGGTGG + Intergenic
1169266894 20:4172435-4172457 AAGGAGAACCTGGGGTAGGGTGG + Intronic
1169825629 20:9765654-9765676 AGGGAGAAGCAGGGAGAGGGCGG - Intronic
1169898969 20:10534071-10534093 CAGCCGAGGCAGGGTGAGGGTGG + Intronic
1170178706 20:13503115-13503137 TAGGAGAAGGAAGGGGAGGGAGG + Intronic
1170207550 20:13814869-13814891 TTGCAGAAGCAGTGTGAGGGTGG - Intronic
1170707952 20:18762500-18762522 AAGGAAATGCAGGGACAGGGAGG - Intronic
1170786377 20:19471143-19471165 AAGAAGAAGCAGAGTAAGAGGGG + Intronic
1171138460 20:22719555-22719577 AGGGAAAAGCAGGGTGGGGTGGG + Intergenic
1171157991 20:22894160-22894182 AAGAAGAAGGATGGTGTGGGAGG - Intergenic
1171518972 20:25761181-25761203 AAGGAGTGGCAGGGAGAGTGAGG + Intergenic
1171519001 20:25761323-25761345 CAGAAGAAGCAGAGGGAGGGAGG - Intergenic
1171778352 20:29393083-29393105 GAAGATAAGCAGGGTGAGAGTGG - Intergenic
1171869706 20:30515139-30515161 AGGGAGAAGCTGGGTGAGACAGG + Intergenic
1171870493 20:30520917-30520939 AGGGAGAAGCTGGGTGAGACAGG + Intergenic
1171897711 20:30824798-30824820 GAAGATAAGCAGGGTGAGAGTGG + Intergenic
1172014210 20:31863347-31863369 AAGGGGAAGGAGGGAGAGGGTGG + Intronic
1172107869 20:32527529-32527551 AAGGAAAAGCAGGTTGAAGGGGG - Intronic
1172247846 20:33458175-33458197 AAAGAGAACCAGTGTGAGGGTGG + Intergenic
1172477800 20:35252059-35252081 CAGGAAAAACAGAGTGAGGGTGG - Intronic
1172479611 20:35263391-35263413 CAGGAGAGGAAGGGTGGGGGTGG - Intronic
1172572427 20:35981091-35981113 AAGGAGAATCAGGGTGTGATTGG + Intronic
1172577304 20:36019132-36019154 AATGAAAAGCAGGGTGGGTGGGG + Intronic
1172644582 20:36461692-36461714 GAGGAGGAGGAGGGCGAGGGCGG - Intronic
1172696461 20:36826364-36826386 AGGGAGAAGGAGAGGGAGGGGGG - Intronic
1172766876 20:37355755-37355777 AAAAAAAAGAAGGGTGAGGGTGG + Intronic
1173040567 20:39458570-39458592 AAGGAGGAGCAGCATGAGAGGGG + Intergenic
1173114802 20:40230932-40230954 AAGGAGAAGCAAGGAAAGGAAGG + Intergenic
1173733193 20:45342480-45342502 AAGGGGAGGCAGGGAGAGGCTGG - Intronic
1173909202 20:46651528-46651550 CAGGAGGAGCAGGGAGAGGGCGG - Intronic
1174150376 20:48482161-48482183 GAGGAGGAGCAGGGGGAAGGAGG + Intergenic
1174197928 20:48786380-48786402 AAGGAGACTCAGGGAGAGGAGGG + Intronic
1174246619 20:49187196-49187218 AAGAAGAAGCTGGATGATGGCGG + Intronic
1174293004 20:49522136-49522158 CAGCTGAAGCAGAGTGAGGGAGG - Intronic
1174639341 20:52029783-52029805 AAGGAGGAGGAGGGGGAGGAGGG - Intergenic
1174837113 20:53866985-53867007 AAAGAGAACCAGGCTAAGGGTGG + Intergenic
1174842697 20:53915261-53915283 AAGGAGAATAAGAGAGAGGGAGG + Intergenic
1175030242 20:55946226-55946248 AAGTGGAAGCATTGTGAGGGAGG - Intergenic
1175031338 20:55957556-55957578 AAAGAGGAGAAGGGTGGGGGTGG - Intergenic
1175141644 20:56865060-56865082 ATGGAAAAGCAGGGGGAGGCTGG + Intergenic
1175293720 20:57894807-57894829 AAGAAGAAGGAGGGGGAAGGAGG + Intergenic
1175298830 20:57928581-57928603 GAGGAGGAGAAGGGTGGGGGGGG - Intergenic
1175460067 20:59145868-59145890 GAGGAGGAGGAGGGTGAGGGTGG - Intergenic
1175499083 20:59436781-59436803 AGGGAGAGGCAGGGTCAGGAAGG + Intergenic
1175756429 20:61533244-61533266 AAGGAGTGGCAGGGCGATGGGGG + Intronic
1175765866 20:61592624-61592646 TAGGAAAAGCAGGGTGGAGGGGG - Intronic
1175935598 20:62512546-62512568 AAGGAGCAGCAGGGGGTGGGTGG - Intergenic
1176031684 20:63015971-63015993 AGGGAGAGGCAGGGAGAGGCAGG - Intergenic
1176031687 20:63015981-63016003 AGGGAGAGGCAGGGAGAGGCAGG - Intergenic
1176031690 20:63015991-63016013 AGGGAGAGGCAGGGAGAGGCAGG - Intergenic
1176031693 20:63016001-63016023 AGGGAGAGGCAGGGAGAGGCAGG - Intergenic
1176031696 20:63016011-63016033 AGGGAGAGGCAGGGAGAGGCAGG - Intergenic
1176063503 20:63182480-63182502 AAGGAGGGGCGGGGGGAGGGGGG - Intergenic
1176199388 20:63853735-63853757 GGGGAGCAGGAGGGTGAGGGTGG - Intergenic
1176199400 20:63853775-63853797 AGGGACCAGGAGGGTGAGGGTGG - Intergenic
1176199423 20:63853855-63853877 AGGGACCAGGAGGGTGAGGGTGG - Intergenic
1176199434 20:63853895-63853917 AGGGACCAGGAGGGTGAGGGTGG - Intergenic
1176199445 20:63853935-63853957 AGGGACCAGGAGGGTGAGGGTGG - Intergenic
1176345460 21:5740875-5740897 AAGTAGTAGAAGGTTGAGGGCGG - Intergenic
1176352274 21:5861459-5861481 AAGTAGTAGAAGGTTGAGGGCGG - Intergenic
1176499367 21:7583580-7583602 AAGTAGTAGAAGGTTGAGGGCGG + Intergenic
1176539781 21:8138945-8138967 AAGTAGTAGAAGGTTGAGGGCGG - Intergenic
1176558732 21:8321990-8322012 AAGTAGTAGAAGGTTGAGGGCGG - Intergenic
1176586340 21:8591015-8591037 AAAGAGGAGGAGGGAGAGGGAGG - Intergenic
1176602449 21:8806115-8806137 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1176602928 21:8809384-8809406 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1176611894 21:8991218-8991240 AGGGAGAAGCTGGCTGAGGCAGG - Intergenic
1176653122 21:9567589-9567611 AAGGAGTGGCAGGGAGAGTGAGG + Intergenic
1176735845 21:10546346-10546368 AAGGAGAAGGAGAGAGATGGGGG - Intronic
1176743042 21:10623731-10623753 AAGGAGGAGGAGGGAGAGGGAGG - Intergenic
1177684347 21:24417366-24417388 ACAGAGAGGCAGGGTGAGGAAGG - Intergenic
1178181187 21:30163368-30163390 AAGGAGAAGAAGGGTTACAGAGG + Intergenic
1178431505 21:32522211-32522233 AAGGAGCAGCAGGCTGAGTGTGG - Intergenic
1178474017 21:32920577-32920599 GAGCAGACGCAGGGAGAGGGCGG + Intergenic
1178824667 21:36005031-36005053 AGGGAGAGGCAGGGGGAGGGGGG + Intergenic
1179488606 21:41726580-41726602 AAGAAGAAGAAGGGGGGGGGAGG - Intergenic
1179680855 21:43020373-43020395 AGGGAGACGCTGTGTGAGGGAGG + Intronic
1180004802 21:45015416-45015438 AAGGAAAAGCAGGGGAGGGGAGG + Intergenic
1180087870 21:45516145-45516167 AAAGAGAGGCCGGGTGAGGCGGG + Intronic
1180269146 22:10567918-10567940 AAAGAGGAGGAGGGAGAGGGAGG - Intergenic
1180280974 22:10695164-10695186 AAGGTGGAGGAGGGGGAGGGAGG - Intergenic
1180280984 22:10695199-10695221 AAGGTGGAGGAGGGGGAGGGAGG - Intergenic
1180344734 22:11697668-11697690 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1180345214 22:11700941-11700963 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1180352557 22:11816662-11816684 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1180352994 22:11819182-11819204 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1180385698 22:12175695-12175717 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1181368325 22:22397154-22397176 AGAGAGACACAGGGTGAGGGAGG - Intergenic
1181376860 22:22465615-22465637 AGAGAGACACAGGGTGAGGGAGG - Intergenic
1181422333 22:22810645-22810667 AAGGAGAGGCAGAGGGAGGAGGG - Intronic
1181456662 22:23063799-23063821 AAGGGGAAGCAGGCCCAGGGTGG + Intronic
1181520328 22:23444838-23444860 AAGGAGAAGGAGAGAGATGGGGG + Intergenic
1181773688 22:25144804-25144826 CAGGAGAAGGAGGTTCAGGGTGG - Intronic
1181846878 22:25717370-25717392 AAGGAGAGGGAGGGCCAGGGAGG - Intronic
1181911677 22:26243326-26243348 AAAGTGAAGCAGGGTTAAGGAGG + Intronic
1182003613 22:26941027-26941049 AAGGAGAAGCAGGTTGAAAGAGG + Intergenic
1182051831 22:27318157-27318179 GAGGAGAAGCAGGAGGCGGGTGG + Intergenic
1182078496 22:27511733-27511755 ATGGAGAAACAGGTTCAGGGAGG - Intergenic
1182119331 22:27776596-27776618 GAGGAGAAAGAGGGAGAGGGTGG - Intronic
1182738288 22:32546835-32546857 AGGGAGAAGAGGGGCGAGGGAGG - Intronic
1182755881 22:32678546-32678568 AAGGAGGAGGAGGATGAAGGAGG - Intronic
1182773259 22:32811212-32811234 AAAGATAAGCAGACTGAGGGGGG + Intronic
1182931479 22:34178311-34178333 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1183252094 22:36737420-36737442 GAGGAGAAGCAGAGAGAAGGAGG + Intergenic
1183336194 22:37248174-37248196 AGGGAGAAACAGGGAGAGGTGGG - Intergenic
1183356370 22:37361978-37362000 AAGGAGTAGCTGCGTGTGGGAGG - Intergenic
1183385433 22:37511460-37511482 AAGGAGAAGGAGGAGGCGGGAGG + Intronic
1183493705 22:38129922-38129944 CAGGAGTAGCAAGGAGAGGGTGG + Intronic
1183533306 22:38376524-38376546 AAGGAGAAGGAGAGAGATGGGGG + Intronic
1183868831 22:40725226-40725248 AAGGAGAAGGAAGATGAGGGTGG - Intergenic
1183978933 22:41528452-41528474 AAGGAGAAGGTGGGTGTGGGTGG - Exonic
1184067052 22:42126998-42127020 CAGGAGATGCAGGGTGAGAGTGG + Intronic
1184069777 22:42140702-42140724 CAGGAGATGCAGGGTGAGAGTGG + Intergenic
1184071521 22:42150310-42150332 CAGGAGATGCAGGGTGAGAGTGG + Intergenic
1184274306 22:43401415-43401437 CAGGAGTAGGAGGGTGAGGTGGG + Intergenic
1184320612 22:43739777-43739799 GGGGAGAAGCGGGGTGGGGGTGG - Intronic
1184608613 22:45588479-45588501 AAGGACAAACAGGGTGACAGAGG - Intronic
1184767305 22:46578373-46578395 ACAGAGCAGGAGGGTGAGGGAGG - Intronic
1184862036 22:47177667-47177689 AAGGAGCTGCAGGGTGGGTGTGG - Intergenic
1185014052 22:48333257-48333279 AAGGGGAAGCAGAGTGAGGCTGG - Intergenic
1185036953 22:48484480-48484502 AAGGAGAAGGAGGGAGGGGAGGG - Intergenic
1185036959 22:48484490-48484512 AAGGAGAAGGAAGGAGAAGGAGG - Intergenic
1185097086 22:48815597-48815619 AAGCAGCAGCAGGGTTTGGGTGG + Intronic
1185156229 22:49195100-49195122 TAGAACAAGCAAGGTGAGGGAGG - Intergenic
1185238118 22:49726334-49726356 AAAGAGAAGCAGGTTCATGGGGG - Intergenic
1185272494 22:49935608-49935630 GGGGAGGAGCAGGGTGGGGGCGG + Intergenic
1185345184 22:50307765-50307787 AAGGAGGGGGAGGGGGAGGGGGG + Intergenic
1185394485 22:50579698-50579720 AAGGAGGGGCAGGGTGGGGTAGG - Intronic
1203244734 22_KI270733v1_random:55300-55322 AAGTAGTAGAAGGTTGAGGGTGG - Intergenic
949465387 3:4338161-4338183 AAGGTGAAGCAGGCGGAGGATGG + Intronic
949493527 3:4610964-4610986 AAGGAGAAGGAGGGGGAAGGGGG - Intronic
949495562 3:4628453-4628475 AAGGTGAAACAGGATGAGAGAGG - Intronic
949562380 3:5214516-5214538 AAGGGGAAGGAGGGTGAGAGGGG + Intronic
949597725 3:5565507-5565529 AAGAGGAATCAGGGGGAGGGTGG - Intergenic
949611417 3:5707581-5707603 AAGGAGAAGCAGAGAGAGAGAGG - Intergenic
949732225 3:7126725-7126747 AAGGAGAAGCAGAGAGGAGGGGG - Intronic
950008805 3:9707813-9707835 AAGGAGAAGCAAGTTGGAGGAGG + Intronic
950014710 3:9747467-9747489 CAGGGGAAGCTGGGTGGGGGAGG + Exonic
950235927 3:11320164-11320186 AAGGGGAGGTAGGGGGAGGGAGG - Intronic
950548401 3:13652585-13652607 AGGGAGGAGCAGGCTGGGGGTGG + Intergenic
950612481 3:14135126-14135148 GAAGAGAAGCAGGGAGAGTGAGG - Intronic
950769945 3:15303314-15303336 AAGCCGAAGCAGGCTGAGGAAGG + Intronic
950891214 3:16406237-16406259 AAAGAGGAGCAGGGAGAAGGGGG + Intronic
951080336 3:18444872-18444894 GAAGAGAAGGAGGGGGAGGGAGG + Intronic
951187877 3:19735345-19735367 AGGGAGAAAGAGGGGGAGGGAGG - Intergenic
951844782 3:27073506-27073528 AAGGAGAAGGCAGGTGGGGGAGG + Intergenic
952107584 3:30087733-30087755 GAGGAGAAGGAGGAGGAGGGAGG - Intergenic
952253288 3:31674645-31674667 GAGCAGAAGCAAGGTGGGGGAGG - Intronic
952882100 3:37991514-37991536 AAGAAGAACCAGGGGGAGGCAGG + Intronic
952949922 3:38514764-38514786 AAAAAAAAGCAGGGGGAGGGGGG - Intronic
953121169 3:40044057-40044079 AAGCAGAAGCTGGATGAGGAAGG + Exonic
953179861 3:40585003-40585025 GAAGAGAAGGAGGGAGAGGGAGG - Intergenic
953365403 3:42340420-42340442 AAGGAGGAGAAGGAGGAGGGGGG + Intergenic
953501209 3:43436464-43436486 AAGGAGAAGAACAGTGAAGGTGG + Intronic
953557440 3:43957879-43957901 AAGGTGAAGGAGGGAGAGTGGGG + Intergenic
953773686 3:45797817-45797839 AAGGGTGAGTAGGGTGAGGGAGG + Intergenic
953797035 3:45993902-45993924 AAAGGGAAGCAGGGTGGGTGGGG + Intronic
954384447 3:50236905-50236927 AAGGAGAAGGAGGGAGTGGGTGG - Intronic
954385675 3:50242612-50242634 AAGTAACATCAGGGTGAGGGTGG - Intronic
954411738 3:50374059-50374081 AAGGGGAGGAAGGGAGAGGGAGG + Intronic
954415905 3:50393246-50393268 AGGGAGGAGCAGGGTGGGGGTGG - Intronic
954761246 3:52875923-52875945 CTGGAGAAGCAGTGTGAGGGTGG + Intronic
955528311 3:59844005-59844027 AAAGAGAAGGAGGGTGTGGGAGG - Intronic
955602699 3:60664430-60664452 AAGAGGAAGAAGGGGGAGGGAGG - Intronic
955611407 3:60761069-60761091 AACCAGAAGAAGGGGGAGGGGGG + Intronic
956106425 3:65823531-65823553 CAGGAGAAGCAGGCTGTGGAAGG - Intronic
956586295 3:70868598-70868620 AGTGGGGAGCAGGGTGAGGGGGG - Intergenic
956590477 3:70908933-70908955 AGGGGGATGGAGGGTGAGGGTGG + Intergenic
956665412 3:71637534-71637556 AAGGAGAAAGAGGGGGAGGAGGG + Intergenic
956762444 3:72455905-72455927 AAGATAAAGCAGGGTGAGGGTGG - Intergenic
956769472 3:72512451-72512473 AAAAAAAAGCAGGGTGTGGGGGG + Intergenic
957386704 3:79505302-79505324 AAGAGGAAGCAGGTTGAGGAAGG + Intronic
957757029 3:84503484-84503506 AAGAAGAAGCAGAGTGAAGGTGG - Intergenic
958085753 3:88804206-88804228 AATGAGAATCAGGCAGAGGGAGG + Intergenic
959112635 3:102140275-102140297 AAGGAGAAAGAGAGGGAGGGAGG - Intronic
960044873 3:113186902-113186924 GAGGAGCAGGAGGCTGAGGGCGG + Intergenic
960190401 3:114697734-114697756 AAGGAGCAGGAGAGGGAGGGAGG + Intronic
960674355 3:120180319-120180341 AAGGAGGAGTGGGATGAGGGAGG + Intronic
960709613 3:120514579-120514601 AAGAAGAAGGAGAGGGAGGGGGG - Intergenic
960999926 3:123367357-123367379 CAGGAGAAGCAGTTTGTGGGTGG - Intronic
961158747 3:124703991-124704013 AAGGAAACTCAGGGTCAGGGAGG + Intronic
961452161 3:127007127-127007149 CAGGAGAAGCAGGGTGGTGGGGG + Intronic
961454798 3:127018610-127018632 GAGCTGAAGCAGGGTGGGGGCGG - Intronic
961703696 3:128767094-128767116 AACGCGCAGCAGGGTGAGGCAGG - Intronic
962029043 3:131579920-131579942 AAGCAGAGGCAGGGTGTGAGAGG + Intronic
962054410 3:131854793-131854815 AAGGAGGAGGAGGAGGAGGGTGG - Intronic
962072159 3:132044595-132044617 AGGGAGAAGGAGGGGCAGGGAGG + Intronic
962072193 3:132044659-132044681 AAGGGGAGGGAGGGGGAGGGAGG + Intronic
962476132 3:135757006-135757028 AAGGAGAGGCACGGTGACAGAGG - Intergenic
962486097 3:135843953-135843975 AACAAGATGCAGGGTCAGGGAGG + Intergenic
962621665 3:137186310-137186332 AAGGAGAAGGAGAGGGAGGTAGG + Intergenic
963229834 3:142898469-142898491 AGGGAGGAGCAGAGAGAGGGAGG - Intergenic
963604915 3:147405723-147405745 AGGCAGGACCAGGGTGAGGGAGG + Intronic
963774878 3:149428611-149428633 CAGGAGAAAGAGAGTGAGGGAGG + Intergenic
964185723 3:153940347-153940369 AAAGAGAAGCAGGGAGTGGGTGG - Intergenic
964564320 3:158033118-158033140 AAGAAAAAGAAGGGTGGGGGAGG + Intergenic
965059841 3:163771801-163771823 AAGAGGAAGAAGGGAGAGGGGGG - Intergenic
965619988 3:170633697-170633719 AGAGAGCAGCAGGTTGAGGGTGG - Intronic
965631871 3:170741238-170741260 AAGGAGGAGGAGAGAGAGGGAGG + Intronic
965659522 3:171026785-171026807 GAGGAGGAGCAAGGAGAGGGAGG + Intergenic
965711632 3:171561527-171561549 GAGGAGAGGCTGGATGAGGGAGG + Intergenic
965840827 3:172903738-172903760 AAAGGGAAGGATGGTGAGGGAGG + Intronic
966025964 3:175282474-175282496 AAGGAGAAAGAGGAAGAGGGAGG + Intronic
966099188 3:176245399-176245421 AAGGAGGAGAAGGGAGATGGTGG + Intergenic
966559164 3:181299961-181299983 AAGGAGAAGGAGGAGGAGGAGGG + Intergenic
966863552 3:184243814-184243836 CAGCAGGAGCAGGGTGAGGTGGG + Exonic
966917073 3:184590916-184590938 AAGTAGCATCAGGGTGCGGGTGG + Intronic
967054192 3:185813888-185813910 AAGGAGAAGGAGAATGAGAGAGG + Intronic
967259065 3:187624043-187624065 AACAAGGAGCATGGTGAGGGTGG - Intergenic
967350671 3:188511032-188511054 AGGGAGAAGGAAGGGGAGGGAGG - Intronic
967693635 3:192506073-192506095 AAGGTGAAGCAGGGATAGGAAGG + Intronic
967818589 3:193819296-193819318 AAAGAGAAGCCGAGTGAGGCTGG - Intergenic
967948179 3:194820558-194820580 AAGGAGAACCATGGAGAGGAGGG + Intergenic
968029893 3:195474794-195474816 AAAGAGAAGGTGGGGGAGGGAGG + Intergenic
968041421 3:195592263-195592285 AAGGAGAAGGAGGGAGGGAGAGG + Intergenic
968077078 3:195821865-195821887 CTGGAGGAGCAGGGTGAGAGAGG + Intergenic
968288170 3:197520160-197520182 GAGGGGAAGCAGGGAGAGGGAGG + Intronic
968487885 4:872681-872703 AAGGGGCAGCTGGGGGAGGGAGG - Intronic
968603858 4:1522371-1522393 AAGGGGCATGAGGGTGAGGGGGG - Intergenic
968615053 4:1573949-1573971 AGGGAGGAGCTGGATGAGGGAGG - Intergenic
968628590 4:1638803-1638825 AAGGACAGGCAGGAGGAGGGGGG - Intronic
968697851 4:2041542-2041564 AGGGAAAAGCCGGGCGAGGGCGG + Intronic
968775308 4:2536600-2536622 AAGGAGCAGCGGGGAGGGGGAGG - Intronic
968938367 4:3625131-3625153 AAGGAGAAGCAGTGTGGGATGGG + Intergenic
969479533 4:7440695-7440717 GAGGAGAGGCAGCATGAGGGTGG - Intronic
969601939 4:8181943-8181965 AAGGAGGAGGAAGGTCAGGGAGG + Intergenic
969966699 4:11003864-11003886 ATGGAGAAACAGGCTCAGGGAGG + Intergenic
970195577 4:13547597-13547619 GAGGAGAAGCAGGAGGAGGGAGG - Intergenic
970866937 4:20770092-20770114 CAGAAGAAGCAGGCTGTGGGAGG - Intronic
970904544 4:21200634-21200656 GAAGAGAGGGAGGGTGAGGGTGG + Intronic
972156782 4:36172886-36172908 AAGGAGCAGCAGGATGGAGGTGG - Intronic
972163423 4:36253326-36253348 AAGGAGAAACAGGGTGAGGAGGG - Intergenic
973019860 4:45189104-45189126 AATGAGAAGCAGAGTGTGGTTGG - Intergenic
973375099 4:49280976-49280998 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
973375998 4:49286998-49287020 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
973376923 4:49293161-49293183 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
973377843 4:49299316-49299338 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
973378787 4:49305596-49305618 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
973379431 4:49310058-49310080 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
973380304 4:49316054-49316076 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
973381227 4:49322220-49322242 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
973382312 4:49329265-49329287 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
973385851 4:49513877-49513899 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
973758173 4:54095058-54095080 AAGAAGCAGCGGGGAGAGGGGGG - Intronic
973885600 4:55317976-55317998 AAAGAGAAGCAGGGGGAAAGAGG + Intergenic
974099576 4:57402021-57402043 AAGGAGAGAAAGAGTGAGGGAGG + Intergenic
974389622 4:61249420-61249442 GAGGAGGAGGAGGGTGAGGCAGG - Intronic
974471730 4:62327640-62327662 AAGGAGCAGCAGGGTTTGAGAGG + Intergenic
974877734 4:67718205-67718227 GTGGGGAGGCAGGGTGAGGGTGG + Intergenic
975185523 4:71397792-71397814 AAGGAGAAGCAGTGTGTGAAGGG + Intronic
975684535 4:76906530-76906552 AGAGAGAGGGAGGGTGAGGGGGG + Intergenic
975921965 4:79401915-79401937 AAAGAGAAACAAGGTGAGGAAGG - Intergenic
976127848 4:81853255-81853277 AAGGAGAAGGAGAGTGACAGTGG - Intronic
976220546 4:82753722-82753744 AAGGGGAAGATGGCTGAGGGGGG - Intronic
976527211 4:86107571-86107593 AAGGAGAAACAGGAGAAGGGGGG + Intronic
976688588 4:87843769-87843791 AGGGAGAAGGAGGGGGAGTGAGG - Intronic
976718765 4:88150416-88150438 AGGCTGAAGCAGAGTGAGGGAGG + Intronic
977795903 4:101164212-101164234 AGGGAGTGGCAGGGTGAGGGTGG - Intronic
977984289 4:103363568-103363590 AAGAAGTAGCAGGGGGAAGGGGG - Intergenic
978263929 4:106799436-106799458 AAAGAGAAATAGGGTGAGGGAGG - Intergenic
978404477 4:108364724-108364746 ATGGGGAAGCAGGAGGAGGGTGG - Intergenic
978532531 4:109729768-109729790 GAGGAGCAGGAGGGTGAGCGCGG + Exonic
978776894 4:112514568-112514590 AAGGAGGGGCAGGGGAAGGGAGG + Exonic
979126993 4:116985819-116985841 AAGGATAACCAGGTAGAGGGAGG + Intergenic
979131209 4:117047539-117047561 AAGGAGAAGCAGGAAGAGAGGGG - Intergenic
979472539 4:121117655-121117677 AAGGAGCAGAAGGCTGAGGCAGG - Intergenic
979547294 4:121952061-121952083 AGGGAGAAGGAGAGGGAGGGCGG + Intergenic
979605081 4:122629912-122629934 AGGGAGACGAAGGGAGAGGGAGG - Intergenic
979704231 4:123702025-123702047 GAGGAGGAGCAGGGTCAGGGTGG + Intergenic
980841060 4:138261913-138261935 AAGAAGAAACAGGAGGAGGGAGG - Intergenic
980988501 4:139718376-139718398 AAGGAGAAGCAAGGGGAGGCTGG + Exonic
981800441 4:148649021-148649043 AAGGAGCTGAAGGGGGAGGGAGG + Intergenic
981853301 4:149257119-149257141 AAGGAAGAGCAGGGGGAGAGAGG + Intergenic
981913382 4:150008185-150008207 CTGGAGAAGCAGGGAGGGGGGGG - Intergenic
982055555 4:151545665-151545687 AAGGATAAGGAGGCTGGGGGAGG - Intronic
982065585 4:151651632-151651654 CAGGAGAAGCCTGGTGAGGAGGG + Intronic
982065788 4:151653381-151653403 AAGGAGAGAGAGGGAGAGGGAGG - Intronic
982225860 4:153165771-153165793 AAGGAAAAGGAGAGTGAGGATGG - Intronic
983759211 4:171384744-171384766 AAGGTGAAGGAGGAGGAGGGGGG - Intergenic
984197151 4:176671942-176671964 AAGGGGAAGGAGGGTCAGCGCGG + Intergenic
984261868 4:177452323-177452345 AAGGAGAGGCGGGGAGAGGAGGG - Intergenic
984325609 4:178246765-178246787 AGAGAGAGGCAGGGTGGGGGGGG + Intergenic
984501857 4:180566939-180566961 AAGGTGAACGAGGGTGAGTGTGG + Intergenic
984522976 4:180823555-180823577 AGGGAGAGGGAGGGAGAGGGAGG - Intergenic
984522980 4:180823565-180823587 AGGGAGAGGGAGGGAGAGGGAGG - Intergenic
984522990 4:180823589-180823611 AGGGAGAGGGAGGGAGAGGGAGG - Intergenic
984522994 4:180823599-180823621 AGGGAGAGGGAGGGAGAGGGAGG - Intergenic
984522998 4:180823609-180823631 AGGGAGAGGGAGGGAGAGGGAGG - Intergenic
984523002 4:180823619-180823641 AGGGAGAGGGAGGGAGAGGGAGG - Intergenic
984523006 4:180823629-180823651 AGGGAGAGGGAGGGAGAGGGAGG - Intergenic
984523018 4:180823659-180823681 AGGGAGAGGGAGGGAGAGGGAGG - Intergenic
984523034 4:180823697-180823719 AGGGAGAGGGAGGGAGAGGGAGG - Intergenic
984523044 4:180823721-180823743 AGGGAGAGGGAGGGAGAGGGAGG - Intergenic
984786655 4:183573485-183573507 AAGGAGGAAGAGGGAGAGGGAGG + Intergenic
984797461 4:183676635-183676657 AAGGAGAAGCATGGTGAGAAAGG - Intronic
985011637 4:185588603-185588625 AAGGAGGAGGAGGAGGAGGGAGG - Intronic
985031392 4:185794260-185794282 ATGGAGAAGGAGGAGGAGGGAGG + Intronic
985046534 4:185946636-185946658 GAGGAGAAGCAGGGTGGATGAGG - Intronic
985140939 4:186840376-186840398 GAGGAGAAGGAGGGGGAGGGAGG - Intergenic
985140987 4:186840555-186840577 GAGGAGAAGGAGGGGAAGGGGGG - Intergenic
985275257 4:188232236-188232258 AAGAAGAGGCAGGGTGTGGGTGG - Intergenic
985369501 4:189270572-189270594 AAGCAGCAGCAGGGTTAGAGAGG + Intergenic
985766002 5:1779920-1779942 AAGGACAGGCTGGGTGGGGGAGG - Intergenic
985926929 5:3026275-3026297 GAGGAGAAGCAGGGAGAGGCAGG - Intergenic
985945742 5:3181579-3181601 AGAGAGAACCAGGGAGAGGGAGG - Intergenic
986070632 5:4279058-4279080 AAGGAGAAAAAGTGAGAGGGGGG - Intergenic
986748119 5:10761453-10761475 AGGGAGAAGGAAGGAGAGGGAGG + Intergenic
987032852 5:13991503-13991525 AAGGAGAAGGAGGAAGAGGAGGG + Intergenic
987149095 5:15020849-15020871 AAGGAGAAGCAGAGAGAGGAGGG + Intergenic
987246859 5:16057886-16057908 GAGGAGAAGAAGGGTCGGGGAGG + Intergenic
988424850 5:31052018-31052040 AAGGAGAAAAAGTGTGAGGTGGG - Intergenic
988578121 5:32445516-32445538 AAGGAAAATAAGGGTAAGGGAGG + Intergenic
988979656 5:36553941-36553963 AAGGAGAGGCAGACTCAGGGTGG + Intergenic
989174984 5:38515591-38515613 GGGGAGAAGGAGGGAGAGGGAGG + Intronic
989483726 5:41963725-41963747 AAGGAGGAGCAGGAAGAGGAAGG + Intergenic
989654444 5:43731112-43731134 AAGAAGAAGAAGAGAGAGGGAGG - Intergenic
990526483 5:56633170-56633192 AAGGAGGAGCAGGAGGAGGGAGG + Intergenic
990885930 5:60593486-60593508 AAGGAGAGGGAGAGTGATGGGGG - Intergenic
990994491 5:61717906-61717928 AAGGAGAAGCAGGTGGAAGGTGG - Intronic
991655634 5:68901580-68901602 AGGCAGAAGCATGGGGAGGGAGG - Intergenic
991956320 5:71998806-71998828 GAGGAGAAGGAGGCTGAGGTAGG + Intergenic
992106638 5:73453465-73453487 CTGAAGAAGCAGGGTGGGGGAGG - Intergenic
992321224 5:75614907-75614929 GAGGAAAAGAATGGTGAGGGAGG + Intronic
993129479 5:83877064-83877086 AAAGAGAAGCAGGGACAGGTAGG + Intergenic
993532858 5:89045098-89045120 AAGAAGAAGCAGGGAGAATGGGG + Intergenic
994021926 5:95037113-95037135 AAGAAGAGGCAGGTTGAAGGAGG - Intronic
994850268 5:105046308-105046330 GAGGAGGAGGAGGGGGAGGGAGG - Intergenic
995069670 5:107904934-107904956 CAGGAGGAGGAGGGTGAAGGTGG + Intronic
995651998 5:114380269-114380291 AGAAAGAAGCAGGGGGAGGGAGG - Intronic
995766438 5:115624864-115624886 TAAGAAAAGCAGGGTGAGAGGGG + Intronic
996291948 5:121861663-121861685 AAGGAGAAAGAGGGTAAGGATGG + Intergenic
996590895 5:125146931-125146953 AGGGAGAAGCAGGGAGAAGCAGG - Intergenic
997091161 5:130860269-130860291 AAGCAGCAGTAGGATGAGGGAGG - Intergenic
997205653 5:132047663-132047685 AAGTGGAAGCAGGCTGAGAGTGG + Intergenic
997297225 5:132776152-132776174 AAGGAGGAGGAGGAGGAGGGAGG - Intronic
997358467 5:133279517-133279539 AAGGAGATGCAGGCTGAGTCTGG + Intronic
997444124 5:133928902-133928924 AGGGAGCAGCTGGCTGAGGGAGG - Intergenic
997506534 5:134421993-134422015 AAGGAGAAGGAGGAAGAGGAAGG - Intergenic
997672835 5:135690571-135690593 AAGGAAAAGCAGGGACAGGTGGG - Intergenic
997739904 5:136244184-136244206 AAGGAGGAGGAGGGAGAGGAAGG - Intronic
998053239 5:139053736-139053758 GAGGAGATGGAGGCTGAGGGTGG - Intronic
998520803 5:142798755-142798777 AAGGAGAAGCATGGGGAAGAGGG - Intronic
998604388 5:143618697-143618719 AAGGAGAAGGGGGCTGATGGTGG + Intergenic
998847772 5:146327548-146327570 AAAGGGAAGGAGGCTGAGGGTGG - Intronic
999273221 5:150310381-150310403 GATGAGAAGCAGGTTGAGAGAGG - Intronic
999287877 5:150405005-150405027 TAGGAGAGGTGGGGTGAGGGTGG - Intronic
999432729 5:151538105-151538127 AAAGAGAAGCAGAGAGAGGGAGG + Intronic
1000251188 5:159497331-159497353 AAGGGGAAGCAGAGGGAGGAGGG + Intergenic
1000507177 5:162135785-162135807 AAGAGGAAGCAGGGTGAGGAAGG + Intronic
1000563127 5:162814880-162814902 AAGGAGAGGAAGGGAGAGGGAGG - Intergenic
1000816328 5:165927134-165927156 GAGCTGGAGCAGGGTGAGGGGGG - Intergenic
1000856451 5:166404035-166404057 AAGAAGAAGAGGGGGGAGGGAGG - Intergenic
1000963660 5:167629877-167629899 AAGGAGAAGGAGGAGGAGGAGGG + Intronic
1001237808 5:170044821-170044843 ATGGAGAAGCTGGGGGAGGTAGG - Intronic
1001274232 5:170338772-170338794 ATGGGGGAGCAGGTTGAGGGTGG + Intergenic
1001303147 5:170552595-170552617 AGGGAGAAGGGGAGTGAGGGTGG + Intronic
1001437577 5:171712203-171712225 AATGAGAGGCAGGCTGAGGGTGG - Intergenic
1001543710 5:172557110-172557132 GAGCAGAAGCAGGAGGAGGGAGG - Intergenic
1001579935 5:172791576-172791598 ATGAAGAAGCTGGGTGTGGGTGG - Intergenic
1001744959 5:174085393-174085415 AAAGAGAACCAGTGTGAGGTGGG - Intronic
1001992883 5:176132831-176132853 AGGTAGAAGCAGGGTGCTGGCGG + Intergenic
1002163367 5:177330358-177330380 AAGGTGAAGCCTGGTGAGCGTGG + Intergenic
1002414131 5:179109955-179109977 AGGGAGAAGCAGGGGTAGGAAGG - Intergenic
1002461325 5:179375421-179375443 AAGGGGGAGCAGAGTGAGTGGGG - Intergenic
1002521557 5:179795574-179795596 AGGGAGAAGTAGGCTGGGGGAGG - Exonic
1002867184 6:1131798-1131820 AACTAGGAGCAGGGTGGGGGAGG - Intergenic
1002899554 6:1399473-1399495 AGAGGGAAGCAGGGGGAGGGAGG + Intergenic
1003340714 6:5217868-5217890 AAGGAGAAGCAGACTGAGCCAGG + Intronic
1004028615 6:11843815-11843837 GAGGGGAATCAGGGTGAGTGGGG + Intergenic
1004690140 6:17986872-17986894 GAGGAGAAGGGGGGCGAGGGAGG + Intronic
1004735895 6:18406211-18406233 ATGGAAAAATAGGGTGAGGGGGG + Intronic
1005139177 6:22607965-22607987 AAGGAGTAGGAGGGAGAGAGTGG - Intergenic
1005488300 6:26322306-26322328 AAGGAGAAGCGGGGTAAGTAAGG - Intergenic
1005591011 6:27327328-27327350 AAGGTGAAGCAGGGACACGGAGG - Intergenic
1005956970 6:30671010-30671032 AGTCAGAAGCAGGGTGAGAGAGG - Intronic
1006304158 6:33208755-33208777 AAGGCGAAGAAGGCTGGGGGTGG - Exonic
1006629168 6:35418922-35418944 AAGGGGAAGCTGGGGGAGTGGGG + Intronic
1006677560 6:35775408-35775430 AAGCAGAAGCAGGCTGGGAGTGG + Intergenic
1006725622 6:36197131-36197153 AAGGAGAAGGCGGGTGAGCGGGG + Intronic
1006924240 6:37645762-37645784 AAGGAGAAGCAGGGTTGGGCTGG - Intronic
1006986446 6:38178730-38178752 TGGGAGCAGCAGGGTGTGGGGGG + Intronic
1007034440 6:38660394-38660416 AATGAGCAGCAAGGTCAGGGTGG + Intergenic
1007227182 6:40323169-40323191 AGGAAGAAGCAGGATCAGGGTGG + Intergenic
1007278602 6:40693592-40693614 CAGGTGAGGAAGGGTGAGGGTGG - Intergenic
1007310356 6:40940520-40940542 AAAGGCAAGCAGGGTGGGGGAGG + Intergenic
1007358101 6:41335421-41335443 AGGGAAAGGCAGGCTGAGGGTGG - Intergenic
1007431298 6:41779035-41779057 AGGAAGAAGCAGGCTCAGGGAGG + Intronic
1007547942 6:42708453-42708475 AAGCTGGAGCAGTGTGAGGGGGG + Intronic
1007585435 6:42986256-42986278 GAGGAGAAGCTGGGGGAGGCTGG - Intronic
1007651331 6:43424612-43424634 AGGGAGAGGGAGGGGGAGGGGGG - Intergenic
1007714518 6:43848032-43848054 AAGGAGGAGGAAGGTGGGGGCGG + Intergenic
1007786754 6:44284666-44284688 AAGGAGAAGGAAGGAGAAGGAGG - Intronic
1007926039 6:45650594-45650616 AGGGAGAGTCAGGGAGAGGGAGG + Intronic
1008016432 6:46525633-46525655 GAAGAGAAGAAGGGGGAGGGGGG + Intergenic
1008085151 6:47236597-47236619 AAGCAGCAGCAGGGTGTGGGTGG - Intronic
1008475520 6:51931843-51931865 AAGGAGAATAAAGGAGAGGGAGG + Intronic
1008553389 6:52654793-52654815 AAGCAGGAGCAAGGTGGGGGAGG - Intergenic
1009398727 6:63230213-63230235 CAGGAGCAGCAGGGTGAGCCCGG + Intergenic
1009575865 6:65458392-65458414 AAGTATAAGATGGGTGAGGGAGG - Intronic
1009810911 6:68665039-68665061 AAGGTGAAGCCTGGTGAAGGTGG - Intronic
1010474240 6:76266260-76266282 AAGGAGAAGTAAGGTGGAGGTGG - Intergenic
1010766513 6:79781809-79781831 TGGGAGAAGAAGGGTGAAGGAGG + Intergenic
1011129577 6:84039769-84039791 AAGGCAGAGCAGGCTGAGGGAGG + Intronic
1011484746 6:87829964-87829986 AAGGAGAAGGAGGAAGAAGGAGG - Intergenic
1011484791 6:87830136-87830158 AAGGAGGAGGAGGAGGAGGGAGG - Intergenic
1011544971 6:88473177-88473199 AAGGAGAAGGAGAGAGAGAGAGG - Intergenic
1011866448 6:91834658-91834680 AAGGAGAAGCAGGCAGAGATAGG + Intergenic
1012183856 6:96189254-96189276 AGGGACAAGCATGGTGATGGAGG + Intronic
1012270044 6:97197905-97197927 ATAGAGATGCAGGGTGGGGGAGG - Intronic
1012648159 6:101716023-101716045 AAGGGGAAGCAGGTAGAAGGTGG - Intronic
1012883059 6:104814786-104814808 AGGGAGAAAGAGCGTGAGGGGGG - Intronic
1012956837 6:105580057-105580079 ATGGAGAAACATGGGGAGGGGGG - Intergenic
1013222677 6:108093156-108093178 AATGAGAAGCATGTTTAGGGTGG + Intronic
1013226191 6:108120756-108120778 AAGGAGGAGCAAGGCGAGGGAGG - Intronic
1013270552 6:108542000-108542022 AGAGAGAAGGAGGGAGAGGGAGG - Intergenic
1013374010 6:109496598-109496620 AAGGAGAGCCAGGATGAGGAGGG - Intronic
1013993421 6:116279673-116279695 ATGGCGGAGCCGGGTGAGGGAGG - Exonic
1014044330 6:116866997-116867019 AAGGAGGAGCAGGTTGAAGAAGG - Intergenic
1014620837 6:123665160-123665182 AAGCAGAAGCAGGGTTGGGGTGG - Intergenic
1014684370 6:124477719-124477741 AAGGAGAGGGAGGGGGAAGGGGG - Intronic
1015128120 6:129777142-129777164 AAGGAGGAGGAGAGTGAAGGGGG + Intergenic
1015398204 6:132758945-132758967 AAGGAGAAGTAGGGGGAGGATGG - Intronic
1015398752 6:132764620-132764642 AAGGATAAGCAGGGTAAAGGAGG - Intergenic
1015411211 6:132895760-132895782 AAGGAGAAACAGGCTGGGTGCGG + Intergenic
1015493630 6:133856256-133856278 AAGGTGGAGGAGGGGGAGGGTGG - Intergenic
1015524266 6:134160543-134160565 AAGGAAAGGTATGGTGAGGGAGG - Intergenic
1015842244 6:137488429-137488451 AAGGAGAGGCCCGGTTAGGGTGG - Intergenic
1015901071 6:138067624-138067646 AAGTAGCAGCAGGGTGTGAGAGG + Intergenic
1016058442 6:139603104-139603126 AAGGGGAAGCAGGGAGAAAGAGG + Intergenic
1016324555 6:142885311-142885333 AGGGAGAAGGAGGGGAAGGGAGG - Intronic
1016922859 6:149313457-149313479 AAGGAGAGGAAGGGTGACGAGGG - Intronic
1018077495 6:160230120-160230142 AAGGAGCAGCCTGGTGAGGAGGG - Intronic
1018297503 6:162364746-162364768 AAGGGGAATCAGGAAGAGGGAGG + Intronic
1018579145 6:165292694-165292716 AAGGAGAAGCAGAGTCAGCCTGG + Intronic
1018612709 6:165660945-165660967 GAGGGGGAGCAGGGTGAGGACGG - Intronic
1018623882 6:165758684-165758706 AAGGAGAAGGAAGGAGAAGGAGG + Intronic
1018732623 6:166663731-166663753 GAGGAGGAGGAGGGTCAGGGTGG + Intronic
1018897472 6:168030421-168030443 AGGGAGGAGGAGGGGGAGGGAGG - Intronic
1019049934 6:169175055-169175077 AAGGAGCAGCGGGGCGGGGGCGG - Intergenic
1019164016 6:170087340-170087362 AAGGAAAAGCATGGTGTGGGGGG + Intergenic
1019332331 7:466591-466613 AGGGTGAAGGAGAGTGAGGGAGG - Intergenic
1019484895 7:1284935-1284957 AGGGTGACCCAGGGTGAGGGCGG + Intergenic
1019535293 7:1526170-1526192 AAGGAGGAGAAAGGAGAGGGAGG + Intergenic
1019590914 7:1831390-1831412 AAGGAGAAGGAGAGAGATGGGGG - Intronic
1019668791 7:2267094-2267116 ATGGAGAAACAGGCTCAGGGAGG - Intronic
1019729545 7:2622670-2622692 CAGGAGGAGCAGGGGGAGGTGGG - Intergenic
1019729556 7:2622695-2622717 CAGGAGGAGCAGGGGGAGGTGGG - Intergenic
1019775766 7:2911344-2911366 AAGGAGACCCTGGGCGAGGGGGG - Intronic
1019943980 7:4312209-4312231 GAGCAGAAGCAGAGGGAGGGAGG - Intergenic
1020080026 7:5282203-5282225 AAGGGGAAGGAGAGGGAGGGAGG + Intronic
1020204219 7:6103093-6103115 AGGGAGAAGCAGGCTCATGGTGG + Intergenic
1020872911 7:13656051-13656073 AAAGAAAAGCAGAGTTAGGGTGG - Intergenic
1021055380 7:16041087-16041109 CAGGAGAAAGAGGGTGAAGGGGG - Intergenic
1021800726 7:24304050-24304072 AAGGAGAAGCTTGGTGTTGGGGG + Intergenic
1021972697 7:25981179-25981201 AAGAAGGAGAAGGGAGAGGGTGG + Intergenic
1022099651 7:27161562-27161584 AAGGGGAACCAGGGCGCGGGTGG - Intergenic
1022144327 7:27521966-27521988 AAGGAGAAGCAGGGCTTTGGGGG + Intergenic
1022209120 7:28191222-28191244 AAGGGGAAGGAGTGTGTGGGGGG + Intergenic
1022665902 7:32410346-32410368 GAGGAAAAGGAGGGTGAGGGCGG + Intergenic
1023006730 7:35878272-35878294 AAGGAGAAGGAGGATGAGAATGG + Intronic
1023064859 7:36367076-36367098 CAGGATAAGGAGGGTAAGGGCGG + Intronic
1023412171 7:39899040-39899062 GAGGAGAAGTAGGAGGAGGGTGG - Intergenic
1023769084 7:43538248-43538270 AGGGAGAAACTGGATGAGGGAGG + Intronic
1023879912 7:44312462-44312484 AAGGAGAGGGAGGAAGAGGGAGG + Intronic
1024067431 7:45752368-45752390 AAGGAGAAGGAGGATGAGAATGG - Intergenic
1024270160 7:47635850-47635872 AAGGAGAAGAGGAGTGAAGGAGG + Intergenic
1024458238 7:49632789-49632811 AGGGAGCAGGTGGGTGAGGGAGG - Intergenic
1024653726 7:51431423-51431445 AGGGAGAAGCTGGGGGATGGGGG + Intergenic
1024721003 7:52137363-52137385 AAGAAGAAGGAGGAGGAGGGGGG + Intergenic
1024849648 7:53696463-53696485 AGGGAGAAGCTGGGAGAGGAGGG + Intergenic
1025198890 7:56950013-56950035 AAGGGGAAGGAGAGGGAGGGAGG - Intergenic
1025279464 7:57616310-57616332 AAGGAGTGGCAGGGAGAGTGAGG + Intergenic
1025305267 7:57849190-57849212 AAGGAGTGGCAGGGAGAGTGAGG - Intergenic
1025307295 7:57873038-57873060 AAGGAGGAGGAGGGGGAGGGAGG + Intergenic
1025673056 7:63626920-63626942 AAGGGGAAGGAGAGGGAGGGAGG + Intergenic
1026191906 7:68136493-68136515 GAGGAGAAGGAGGAGGAGGGAGG + Intergenic
1026487613 7:70834990-70835012 CAGGAGCAGGAGAGTGAGGGGGG + Intergenic
1026488838 7:70845646-70845668 AGGGAGAGGGAGGGGGAGGGAGG + Intergenic
1026638634 7:72105769-72105791 AAGGAGGAGGAGGAGGAGGGGGG + Intronic
1026735558 7:72946421-72946443 AAGGGGAAGCAGGATGCGGAGGG + Intronic
1026785896 7:73301351-73301373 AAGGGGAAGCAGGATGCGGAGGG + Intergenic
1026955050 7:74371738-74371760 AAGGACAAAGAGGGAGAGGGAGG + Intronic
1026978931 7:74515482-74515504 AAGGTGCAGCGGGGCGAGGGTGG + Exonic
1027108168 7:75418587-75418609 AAGGGGAAGCAGGATGCGGAGGG - Exonic
1027190626 7:75993968-75993990 AAGGAGAACCAGGGGAGGGGTGG - Intronic
1027736315 7:81937069-81937091 AAGGAGGAGTAGGGTGAGCCTGG - Intergenic
1027748310 7:82107427-82107449 AGGGAGAAGCAGAGAGAGGAAGG - Intronic
1027906971 7:84197623-84197645 AAGTAGAAGCAAGGTATGGGTGG + Intronic
1027921285 7:84399124-84399146 GAGGAAAAGCACGGTGAGTGTGG + Intronic
1028248258 7:88508995-88509017 AAGGCCAAGCAGGATGAGGAAGG - Intergenic
1028728132 7:94112675-94112697 AAGGAGAAAGAGAGGGAGGGAGG + Intergenic
1029151921 7:98486322-98486344 GAGGTGAAGCTGGGTGAGGGGGG - Intergenic
1029187284 7:98748279-98748301 AAGGAGAAAGAGGGAGAGGCAGG + Intergenic
1029361226 7:100089734-100089756 AAGGAGGAGCAGTGTGAGAGTGG + Exonic
1029637468 7:101794516-101794538 AAGCAGAAGCAGGTTGGGAGCGG + Intergenic
1029969603 7:104776447-104776469 AAGGAGAAGCTGGCTGTGGGGGG - Intronic
1030324282 7:108203543-108203565 AAGGAGAAGCTGGTTCAGGGAGG - Intronic
1031687008 7:124743045-124743067 AAGGAGTACCAGGGTAAGGTGGG - Intergenic
1031838615 7:126709479-126709501 AAGAAGAAGAAGGAGGAGGGAGG + Intronic
1032422479 7:131793768-131793790 AAAGAGAAGCAGGGGAAGGAAGG - Intergenic
1032863673 7:135904929-135904951 GAGGAGAAGGAGGGTTTGGGGGG + Intergenic
1033349714 7:140552356-140552378 AAGGAGAGGGAGAGGGAGGGAGG - Intronic
1033595227 7:142854552-142854574 AAGGAAAAGCAGGGGGTGGAGGG - Intergenic
1033623791 7:143088442-143088464 GAGCTGAAGCAGGGTGAGGCAGG + Intergenic
1033658047 7:143386552-143386574 AAGCAGAAACAGGAAGAGGGTGG + Intronic
1033828317 7:145219699-145219721 AAGGAGCAGCAGAGAGAAGGGGG - Intergenic
1034250477 7:149686594-149686616 AAGGTGAAACAGAGAGAGGGAGG + Intergenic
1034331527 7:150287319-150287341 AAGGAAAAGCAGAGTCAGGTGGG + Intronic
1034666516 7:152822542-152822564 AAGGAAAAGCAGAGTCAGGTGGG - Intronic
1034679203 7:152915798-152915820 AAGGAGAAGGAGGGTGAGAAGGG - Intergenic
1034847802 7:154463495-154463517 AAGGAGAAGTAGGCTGGGCGCGG - Intronic
1034950047 7:155290880-155290902 CAGGAGAAGCCGTGTGAGGACGG - Intergenic
1034956192 7:155336826-155336848 TAGGACAGGCAGGGAGAGGGTGG - Intergenic
1034978910 7:155463435-155463457 AAGGAGGAGCAGGAGGAAGGAGG - Exonic
1035117816 7:156539676-156539698 AGAGAGAAGCAGGGGGAGGGAGG - Intergenic
1035117966 7:156540757-156540779 CATGAGAAGCAGGGAGAGGGTGG + Intergenic
1035426121 7:158775436-158775458 AAGGAGTAGCAGGGTTTGAGAGG - Intronic
1035479067 7:159167560-159167582 CAGGGGAAGGAGGGAGAGGGTGG - Intergenic
1035674337 8:1444596-1444618 ATGGAGAAGGAGGTGGAGGGAGG - Intergenic
1035971872 8:4258294-4258316 AGGGAGAAAGAGAGTGAGGGAGG + Intronic
1036472570 8:9064227-9064249 AAGGAGAAGGGGGGTTGGGGGGG + Intronic
1036588258 8:10144999-10145021 AAGGAAAAGCAGGGAGAGGCGGG - Intronic
1036671137 8:10788975-10788997 CAGGAAAAGCAGGATGAGGGTGG + Intronic
1037121914 8:15298731-15298753 TAGGAGAAACAGGGAGTGGGAGG + Intergenic
1037891903 8:22628062-22628084 AAGGAGAGGGAAGGTGAGCGAGG + Intronic
1038284960 8:26198484-26198506 AAGGAGGAGGAGGGGGAGGAGGG - Intergenic
1038438957 8:27558525-27558547 AAGGAGACTCAGGGAGAAGGTGG - Intergenic
1038942382 8:32319444-32319466 GAGGAGAAGAAGGCTGAGAGAGG + Intronic
1039382636 8:37100298-37100320 CAGGAGGAGGAGGGTGAGAGAGG - Intergenic
1039454685 8:37698710-37698732 AGGGAGGAGGAGGGAGAGGGAGG - Exonic
1039468839 8:37801419-37801441 AGGGAGAACCTGGGTGTGGGAGG + Intronic
1039801724 8:40963509-40963531 AAGGGCTGGCAGGGTGAGGGTGG + Intergenic
1039825883 8:41173804-41173826 AAGCAGAAGCAGGCTGGGTGCGG + Intergenic
1040072033 8:43196380-43196402 AACCAGAGGCAGGGTGGGGGAGG - Intronic
1040510021 8:48085070-48085092 AAGGAGAAGCTGGGTGAGGCTGG + Intergenic
1040941362 8:52836633-52836655 AAGGAGAGGCAGGATCAGAGTGG + Intergenic
1041059420 8:54021979-54022001 AGGGAGAAGGAGGGAGGGGGCGG + Intronic
1041134817 8:54746890-54746912 AAGGAGAAGCAGGTTGGATGAGG - Intergenic
1041280767 8:56210062-56210084 CAAGAGAAGCAGGGGGAGCGAGG - Intronic
1041423330 8:57693498-57693520 AAGGAGGTGGAGTGTGAGGGGGG + Intergenic
1041625873 8:60025942-60025964 AGGAAGAAGCAGGGTGTGTGTGG - Intergenic
1041633569 8:60116607-60116629 AAGGAGAATGAGGGTGGGGTGGG - Intergenic
1042226880 8:66521144-66521166 GGGCAGCAGCAGGGTGAGGGTGG + Intergenic
1042635701 8:70871639-70871661 AAGGAGAAGCAAGGAGATGGAGG - Intergenic
1042746507 8:72113664-72113686 AAGGAGAAGCCAGGAGAGAGAGG + Intronic
1042822743 8:72949103-72949125 GAGGAGATGAAGGGAGAGGGAGG + Intergenic
1043079690 8:75750719-75750741 AAGGAGAAGCAGGCGAAGGATGG - Intergenic
1044585966 8:93869511-93869533 AAAGAGAAGTAGGGGGTGGGGGG - Intronic
1044616681 8:94149615-94149637 AAGGAACAGCATGGTGAGTGTGG + Intronic
1044644228 8:94421066-94421088 AAGCAGAGGCAGTGTGGGGGTGG - Intronic
1044726170 8:95196012-95196034 AAGTAGAAGCAGAGTCCGGGCGG - Intergenic
1044748515 8:95394442-95394464 AAGGAGAAGCAAAGTGACAGCGG - Intergenic
1045025228 8:98080702-98080724 AAGGAGAGGGAGGGGGAGGGGGG - Intronic
1045130034 8:99140678-99140700 GAGGAGGAGGAGGGTGAGGAAGG - Intronic
1045447865 8:102286070-102286092 GAGGGGAAGAAGGGTGAGAGGGG + Intronic
1045490206 8:102662463-102662485 AGGAAGAAGCAGGCTGAAGGGGG + Intergenic
1045685117 8:104703643-104703665 GAAGGGAAGCAGGGAGAGGGAGG - Intronic
1045688191 8:104733598-104733620 AAGAAGACACAGGGTGTGGGTGG + Intronic
1046530468 8:115438722-115438744 CAGGAGGGGCAGGGAGAGGGAGG - Intronic
1046547905 8:115674597-115674619 AGGGAGAAGGAGGGAGAGGAAGG - Intronic
1046625463 8:116572308-116572330 GAAGAGAAGAAGGGGGAGGGAGG - Intergenic
1047157162 8:122332282-122332304 AAAGAGAAGGAGAGTGGGGGTGG - Intergenic
1047192987 8:122695467-122695489 AGGGAGCAGGAGGATGAGGGGGG + Intergenic
1047278361 8:123423378-123423400 AAGGAAAAGGAGGGAAAGGGAGG - Intronic
1047599568 8:126412709-126412731 GAGTGGAAGCAGTGTGAGGGAGG + Intergenic
1047605885 8:126473941-126473963 CAGGAGAGGCAGGGAGTGGGCGG - Intergenic
1047615787 8:126561548-126561570 AAGGAGAAGAAAGGTTAGAGAGG + Intergenic
1047767783 8:128003338-128003360 AAGGAGAAGGAGGAGAAGGGAGG - Intergenic
1048155109 8:131939972-131939994 AAGGTAGAGCAGGGTAAGGGTGG + Intronic
1048182891 8:132212749-132212771 GAGGTGAAGCAGAGTGAGGCGGG - Intronic
1048229092 8:132619684-132619706 AAGGAAAACCAGGGGAAGGGAGG + Intronic
1048312759 8:133338416-133338438 AAGGAGAGGTAAGGAGAGGGAGG + Intergenic
1048451235 8:134535498-134535520 AGGGAGAGGGAGGGAGAGGGAGG - Intronic
1048643163 8:136387345-136387367 AAGGAGAAGCAGAGGGAGTATGG - Intergenic
1048878166 8:138852752-138852774 GAGGAGAACCAGGGAGAGGGAGG + Intronic
1048937041 8:139366027-139366049 AAGGAGCAGCACCGTGAGGGAGG + Intergenic
1049108813 8:140630019-140630041 TGGGAGAAGCAGGGTGTGGGAGG - Intronic
1049325266 8:142018249-142018271 GAGGACAAGCAGCGGGAGGGGGG - Intergenic
1049336424 8:142089089-142089111 AAGGAGAAGCAGCCTGAGGGTGG + Intergenic
1049356706 8:142192735-142192757 AGGGAGGAGCAGGGAGGGGGAGG + Intergenic
1049361149 8:142213075-142213097 AAAGAGAGGGAGAGTGAGGGAGG - Intronic
1049475258 8:142794313-142794335 AGGGAGAGGCAGAGGGAGGGTGG - Intergenic
1049586583 8:143435262-143435284 CAGCAGGAGCAGGGTGGGGGTGG - Intergenic
1049599774 8:143502053-143502075 AGGGAGAGGCAGGGAGAGCGTGG - Intronic
1049616388 8:143577497-143577519 AAGGAGGGGCTGGGTGAGGGTGG - Intronic
1049742777 8:144249021-144249043 CAGGAGAAGGTGGGAGAGGGCGG + Exonic
1050068756 9:1788554-1788576 ACAGGGGAGCAGGGTGAGGGAGG - Intergenic
1050242437 9:3651348-3651370 ACGGACGATCAGGGTGAGGGAGG + Intergenic
1050293221 9:4178432-4178454 TAGGAGAAGGAGGGGAAGGGAGG + Intronic
1050690400 9:8221172-8221194 AAGGAGAAGCAGGGTGGGGGAGG + Intergenic
1050767054 9:9147756-9147778 GAAGGGAAGCAGGGAGAGGGGGG - Intronic
1051412724 9:16807539-16807561 AATGAGAAGGAGGTGGAGGGAGG + Intronic
1052243303 9:26301969-26301991 AAGGAGAAAGAGGAAGAGGGTGG - Intergenic
1052323911 9:27196726-27196748 CAGGAGCAGAAGAGTGAGGGGGG + Intronic
1052612890 9:30799440-30799462 CAGGAGAAGCAGGGTGCATGAGG - Intergenic
1052918101 9:33939731-33939753 AAGGAGAGGGAGGGAGAAGGGGG + Intronic
1053054579 9:34986849-34986871 AAGGGGAGGGAGGGTGAGTGGGG + Intergenic
1053148353 9:35727239-35727261 GGGGAAAAGCAGGGTGAGAGGGG + Intronic
1053303018 9:36965053-36965075 AAGGAGAAGGGGTGTGGGGGTGG - Intronic
1053350723 9:37411772-37411794 AAGGAGGAGCAAGGGGATGGAGG - Intergenic
1053443640 9:38135596-38135618 CTGGAAAAGCAGGGTGAGGGGGG - Intergenic
1053943954 9:43285591-43285613 AAGGAGGAGGAGGGAGAGGGAGG + Intergenic
1054452848 9:65412679-65412701 AAGGAGAAGCAGTGTGGGATGGG - Intergenic
1055352161 9:75400527-75400549 AATGAGAAGTGGGGTTAGGGGGG + Intergenic
1055716407 9:79122756-79122778 AAGGAGAAGAAGGAGGAGGAGGG + Intergenic
1056300255 9:85232864-85232886 AATGAGATGCCGGGGGAGGGGGG + Intergenic
1056558472 9:87709460-87709482 TAGTAGAAGAAAGGTGAGGGAGG + Intergenic
1056666746 9:88587476-88587498 AAGGAGCAGCAGAGGAAGGGTGG + Intergenic
1056789915 9:89618593-89618615 CAGGAGAAGCGGTGTGAGGAGGG - Intergenic
1056954573 9:91072053-91072075 GAAGAGAAGCAGAGGGAGGGAGG + Intergenic
1057079529 9:92162220-92162242 GAAGAGAAGAAGGGAGAGGGTGG + Intergenic
1057115258 9:92514840-92514862 GAGGAGGAGGAGGGTGAGGAGGG - Exonic
1057134499 9:92677919-92677941 AAAGAGAGGCAGGTGGAGGGTGG - Intergenic
1057169490 9:92952649-92952671 AAGGAGAAAGAGGGGGAAGGAGG - Intronic
1057185543 9:93055642-93055664 ATGGAGAAGGAGGGTGAGGAAGG + Intergenic
1057272326 9:93658117-93658139 AAGGAGACACTGGGTGAGGTGGG - Intronic
1057302504 9:93894958-93894980 AGGGAGAAGCAGGGAGATGCAGG - Intergenic
1057901795 9:98954914-98954936 AAGGAGAAGAGTGGAGAGGGAGG - Intronic
1058111094 9:101030946-101030968 AAAAAGAAGCAGGGGGTGGGGGG + Intronic
1059150254 9:111943062-111943084 GAGCAGAAGAAGGGTGAGGCTGG - Intergenic
1059740133 9:117141977-117141999 AAGCAGGATCAGGGTGAGGTTGG + Intronic
1060297890 9:122355508-122355530 GAGGAGAAGCTGGGAGTGGGTGG - Intergenic
1060581632 9:124752905-124752927 GAGGAGAGGCAGGGACAGGGAGG + Intronic
1060602149 9:124885554-124885576 AAGAGGCAGCATGGTGAGGGAGG + Intronic
1060628975 9:125139004-125139026 AAGGTGGAGCAGAGGGAGGGTGG + Intronic
1060679789 9:125552034-125552056 GAGGAGAAGTAGGGAGTGGGAGG - Intronic
1060906850 9:127314535-127314557 AGGGTGAAGGAGGGGGAGGGAGG - Intronic
1060917960 9:127402605-127402627 CATGAGAAGCAGCATGAGGGAGG - Exonic
1061337855 9:129953808-129953830 AAGGAGAAGGAGGGGAATGGGGG + Intronic
1061510434 9:131057656-131057678 AAGAGGAAGCAGGCTCAGGGAGG - Intronic
1061865656 9:133490746-133490768 AAGGAGAAGCAGGGAGAAGAAGG + Intergenic
1061899678 9:133666500-133666522 GAGGAGGAGGAGGGAGAGGGAGG - Intronic
1061900025 9:133668284-133668306 AGGGAGAGGGAGGGAGAGGGAGG - Intronic
1061900401 9:133669310-133669332 AGGGAGAGGGAGGGTGAGGGAGG - Intronic
1062099936 9:134722821-134722843 AAGGAGAAAGAGGGAGAGGGAGG + Intronic
1062113760 9:134796684-134796706 AGGGTGAGGCAGGGTGAGGGAGG + Intronic
1062130698 9:134891583-134891605 AAGGTGTAGCAGGGGCAGGGTGG - Intergenic
1062189636 9:135241311-135241333 AAGGACCAGCAGGCTGGGGGAGG + Intergenic
1062572804 9:137193390-137193412 GAGGGGCAGCAGGGTGAGGAAGG - Intronic
1062638386 9:137503502-137503524 AAGGAGAAGGAGGAGGAGGAAGG + Intronic
1062638411 9:137503594-137503616 AAGGAGAAGGAGGAAGAAGGAGG + Intronic
1203781862 EBV:105332-105354 TAGGAGAACCCGGGTGACGGCGG + Intergenic
1203698817 Un_GL000214v1:119225-119247 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203699773 Un_GL000214v1:125523-125545 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203461064 Un_GL000220v1:38383-38405 AAGTAGTAGAAGGTTGAGGGCGG - Intergenic
1203479507 Un_GL000224v1:113-135 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203480473 Un_GL000224v1:6409-6431 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203481440 Un_GL000224v1:12737-12759 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203482404 Un_GL000224v1:19046-19068 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203548993 Un_KI270743v1:152910-152932 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203549457 Un_KI270743v1:155639-155661 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1203550415 Un_KI270743v1:161951-161973 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1203569112 Un_KI270744v1:115471-115493 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203570061 Un_KI270744v1:121760-121782 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203582210 Un_KI270746v1:19445-19467 AAGGTGGAGGAGGGGGAGGGAGG - Intergenic
1203587089 Un_KI270747v1:14168-14190 AAGGAGGAGGAGGGAGAGGGAGG + Intergenic
1203616239 Un_KI270749v1:68525-68547 AAAGAGGAGGAGGGAGAGGGAGG - Intergenic
1203630853 Un_KI270750v1:71129-71151 AAGGAGTGGCAGGGAGAGTGAGG + Intergenic
1185499165 X:584408-584430 AAGTAGAAGCAGGAAGAGTGGGG + Intergenic
1185545366 X:939389-939411 AAGGAGAAAGAGAGAGAGGGAGG - Intergenic
1185630707 X:1514451-1514473 AAGGAAAAGGAGGGGAAGGGAGG - Intronic
1185662050 X:1735647-1735669 GAGGAGGAGGAGGGGGAGGGGGG - Intergenic
1185717788 X:2356667-2356689 GAGGAGAAGGAGGAAGAGGGAGG - Intronic
1185814985 X:3146310-3146332 AAGAAGAAGAAGGAAGAGGGAGG - Intergenic
1186313163 X:8342079-8342101 GAGGAGAAGCAGGAGGAGGGAGG - Intergenic
1186490724 X:9970256-9970278 AAGGAGGAACAGAGGGAGGGGGG - Intergenic
1186706890 X:12149697-12149719 AAGAAGCAGCAGGGTGTGAGAGG + Intronic
1186839522 X:13471211-13471233 AAGGAAAAGCAGAGTAAGGAGGG + Intergenic
1187309063 X:18123127-18123149 AAGGAGAAGGGGAGTGGGGGAGG - Intergenic
1187564562 X:20435586-20435608 CTGGAGAGGCACGGTGAGGGTGG + Intergenic
1188291531 X:28394975-28394997 AAGGAGAAGCAAAGTCAGTGAGG + Intergenic
1188314824 X:28660065-28660087 AAGCAGAAGCAGAGTGAGGATGG + Intronic
1188702095 X:33277663-33277685 AAGGAGTAGGAGGCTGAGGGTGG - Intronic
1188819311 X:34754125-34754147 AAGGAGAAAGAGAGTGATGGAGG + Intergenic
1189230795 X:39451036-39451058 AAGGGGAAGCAGAGGGAGGAAGG - Intergenic
1189729880 X:44008573-44008595 AAGGAGGAGAAGAGGGAGGGAGG + Intergenic
1189891797 X:45610565-45610587 CAGGGGAAGGAGGGTGTGGGTGG + Intergenic
1189994726 X:46627535-46627557 AAGGTGATAAAGGGTGAGGGTGG - Intronic
1190057415 X:47189793-47189815 AAGGAGAGGGAGAGGGAGGGTGG - Intergenic
1190123411 X:47682741-47682763 AAGGAGGAGAAGGGAGAAGGTGG - Intergenic
1190463141 X:50698826-50698848 AATGAGAGGAAGGGTGAAGGGGG + Intronic
1190882293 X:54500412-54500434 TGGGAGAAGGAGGGGGAGGGGGG + Intergenic
1191097504 X:56688889-56688911 AAACAGAAGCAGGGTGTGTGGGG - Intergenic
1191976238 X:66874708-66874730 AGGGAGAAGCAAGGTGAGATTGG + Intergenic
1192034134 X:67545408-67545430 CAGCAGCAGCAGGGTGAGGATGG + Exonic
1192175346 X:68881492-68881514 AAGGGTAAGCAGGGAGAGGTGGG - Intergenic
1192361576 X:70444421-70444443 ACGTTGGAGCAGGGTGAGGGAGG - Intergenic
1192430949 X:71111259-71111281 AAGAAGAAGTAGCGTGAGGCAGG + Intronic
1192922799 X:75724828-75724850 GAGTGGAAGCAGGGTGGGGGGGG - Intergenic
1193047800 X:77070734-77070756 AAGGAGGTGCAGGGAAAGGGTGG + Intergenic
1193236484 X:79113624-79113646 AAGCAGAAGCAGGCTGAAGGTGG + Intergenic
1194267367 X:91771462-91771484 GAGGAGAAGGAGGAGGAGGGTGG - Intergenic
1194737214 X:97526803-97526825 AAGCAGAAGCAGAGTGGGTGTGG - Intronic
1194744099 X:97609583-97609605 TAGGAGAAAAAGGGTGAGGCTGG - Intergenic
1194973834 X:100373289-100373311 TAGGAGAAGGAGGCTGGGGGAGG - Intronic
1194988728 X:100521349-100521371 AAGAAGAGGGAGAGTGAGGGAGG + Intergenic
1195235815 X:102897227-102897249 AAGGAGAAGAAGGATAAGGGAGG + Intergenic
1195294592 X:103463501-103463523 AAGAAGGAGGAGGGAGAGGGAGG + Intergenic
1195487725 X:105428498-105428520 CAGGAGATGCAGGGTGAAGGTGG - Intronic
1195675101 X:107502016-107502038 AAGGTTAAGGAGGGTGTGGGTGG + Intergenic
1195819317 X:108926157-108926179 AAAGATAAGCAGAGTTAGGGCGG + Intergenic
1195880993 X:109592451-109592473 AAGGAGAAGAATGGAGAAGGAGG - Intergenic
1196398684 X:115291478-115291500 AAGGAGAAGCAGGAACAAGGAGG + Intronic
1196481602 X:116156676-116156698 AGGGAAAAGGAGGGGGAGGGAGG + Intergenic
1196564160 X:117185364-117185386 AAGCAGAAGCAGGGTTTGAGAGG + Intergenic
1196624493 X:117862908-117862930 AAGGTGAAGCAAGTTGAGTGAGG + Intergenic
1196749307 X:119100487-119100509 AAGGAGAAGTAGGGTTGGAGGGG - Intronic
1197196738 X:123709952-123709974 AAGGAGAAGCAGTGTGTGCAAGG + Intronic
1197231358 X:124007171-124007193 AAGGAGAGGGAGGGAGAGGGAGG - Intronic
1197240394 X:124117027-124117049 GAGGAGAAGCTGGGCAAGGGTGG - Intronic
1197286958 X:124607022-124607044 AAGGAGGAGGAGGATAAGGGAGG + Intronic
1197358348 X:125466029-125466051 AAGCAGCAGCAGGGTTTGGGAGG - Intergenic
1197441984 X:126502737-126502759 AAGCAGTAGCAGGTTGAGGATGG + Intergenic
1197499625 X:127228221-127228243 AAGGAGCAGCATGGGGAGGAGGG - Intergenic
1197722762 X:129756155-129756177 AAGGAGAAGCAGGCCTATGGAGG - Intronic
1197764305 X:130049959-130049981 AGGGAGAAGCAGGCTGGGTGGGG + Intronic
1198099803 X:133414368-133414390 GAGGAGAGGCCGGGTGGGGGTGG - Intronic
1198299464 X:135320922-135320944 AAGGGGAAGCAAGGTTGGGGGGG + Intronic
1198471417 X:136950458-136950480 AATGAGAAGCAGCGAAAGGGGGG - Intergenic
1199581807 X:149368093-149368115 AAGGAGAAGAAGGGTAGGAGTGG + Intergenic
1200414211 Y:2890864-2890886 AAGGAGGAGAAGGAAGAGGGAGG + Intronic
1200415619 Y:2906909-2906931 AAGGAGAAGGAGGCTGGGTGTGG - Intronic
1200584572 Y:4992399-4992421 GAGGAGAAGGAGGAGGAGGGTGG - Intergenic
1200636941 Y:5666753-5666775 AAGAAGAAGAAGGGAGAGCGAGG - Intronic
1201066557 Y:10101488-10101510 GAAGATAAGCAGGGTGAGAGTGG + Intergenic
1201146286 Y:11067095-11067117 AGGGAGAAGAAGGGAGAGGAAGG + Intergenic
1201146356 Y:11067305-11067327 AAGGAGAGGAAGGGAGAGGGAGG + Intergenic
1201146381 Y:11067379-11067401 AGGGAGATGGAGGGAGAGGGAGG + Intergenic
1201146388 Y:11067409-11067431 AGGGAGAAGAAGGGAGAGGAAGG + Intergenic
1201146592 Y:11068049-11068071 AGGGAGAAGAAGGAAGAGGGAGG + Intergenic
1201146606 Y:11068098-11068120 AGGGAGAAGAAGGAAGAGGGAGG + Intergenic
1201195076 Y:11485305-11485327 AAGGAGGAGGAGGGGGAGGGAGG + Intergenic
1201258285 Y:12132144-12132166 AAGGAAAAGGAGGGAGAGGAAGG + Intergenic
1201296449 Y:12467219-12467241 AGAGAGAAGCAGGGTTGGGGTGG - Intergenic
1201549927 Y:15209215-15209237 AAGGGGGAGCAGGGAGAGGAGGG + Intergenic