ID: 1089538613

View in Genome Browser
Species Human (GRCh38)
Location 11:119175650-119175672
Sequence CAGAGCCTAATCACCTCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 112}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089538613_1089538617 16 Left 1089538613 11:119175650-119175672 CCTCCAGAGGTGATTAGGCTCTG 0: 1
1: 0
2: 0
3: 6
4: 112
Right 1089538617 11:119175689-119175711 CTAACTAAATCACCAGAGACGGG 0: 1
1: 0
2: 0
3: 10
4: 148
1089538613_1089538616 15 Left 1089538613 11:119175650-119175672 CCTCCAGAGGTGATTAGGCTCTG 0: 1
1: 0
2: 0
3: 6
4: 112
Right 1089538616 11:119175688-119175710 CCTAACTAAATCACCAGAGACGG 0: 1
1: 0
2: 0
3: 17
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089538613 Original CRISPR CAGAGCCTAATCACCTCTGG AGG (reversed) Intronic
902423766 1:16302970-16302992 CAGAGCCAAACCATATCTGGCGG + Intronic
913707533 1:121441750-121441772 CAGAGCCTACTCACCTCCCAAGG - Intergenic
914193581 1:145431707-145431729 CACAGCCTACTCTCCCCTGGCGG + Intergenic
916255331 1:162781442-162781464 AAGAGACTCCTCACCTCTGGTGG - Exonic
916650340 1:166829293-166829315 CAGAGCCAAACCACATCAGGTGG - Intergenic
921468238 1:215517692-215517714 GGGAGCAGAATCACCTCTGGTGG - Intergenic
1065827273 10:29583951-29583973 CGTATCCTAATCACCTGTGGTGG - Intronic
1070869915 10:79742637-79742659 CAGAGCCGAACCAGCTCAGGAGG - Intergenic
1071636840 10:87264857-87264879 CAGAGCCGAACCAGCTCAGGAGG - Intergenic
1071658408 10:87473097-87473119 CAGAGCCGAACCAGCTCAGGAGG + Intergenic
1071679761 10:87692918-87692940 CAGTGCCTAATCAACATTGGGGG - Intronic
1072984237 10:100125696-100125718 CAGAGCCAAACCACATCAGGTGG + Intergenic
1076648544 10:131971183-131971205 CAGGGACAGATCACCTCTGGGGG + Intronic
1081814875 11:45933365-45933387 CAGTATTTAATCACCTCTGGCGG - Intronic
1084827955 11:71745412-71745434 AAGAGCCTATTGAACTCTGGGGG + Intergenic
1087542808 11:99542663-99542685 GAGGGCAAAATCACCTCTGGTGG + Intronic
1089538613 11:119175650-119175672 CAGAGCCTAATCACCTCTGGAGG - Intronic
1090033599 11:123229014-123229036 CATGGCCTAATCACCTCTTACGG - Intergenic
1090052788 11:123394981-123395003 CATGGCCTAATCACCTCTTAAGG + Intergenic
1091088975 11:132751275-132751297 CAGAGTCTCACCACCGCTGGAGG - Intronic
1095320815 12:40823968-40823990 TAGTGCCTCATCACTTCTGGTGG + Intronic
1097511017 12:60540262-60540284 CAGAGTCTTATCTCATCTGGGGG + Intergenic
1097711213 12:62919755-62919777 CAGATACAAATCACATCTGGTGG + Intronic
1101560240 12:105850505-105850527 CAAAGCCTAATCACATCAGAGGG - Intergenic
1101634329 12:106525399-106525421 CATGGCCTAATCACCTCTCAAGG - Intronic
1103837561 12:123835299-123835321 CAGAACCAAATCAACTCAGGTGG - Intronic
1105840461 13:24249545-24249567 CAGAGCCCCATCTCCTCTTGGGG - Exonic
1108805679 13:54152849-54152871 CATAACCTAATCACCTCTAAAGG + Intergenic
1110665947 13:78117210-78117232 CAAAGCCTAACCACATCAGGTGG + Intergenic
1118782042 14:69014945-69014967 CAGAGCCTTCTCTCCTCTGAGGG + Intergenic
1119533646 14:75381847-75381869 CAGAGCCTTAGCCCCCCTGGGGG + Intergenic
1121640250 14:95480515-95480537 CAGACCTTATCCACCTCTGGGGG - Intergenic
1122279335 14:100611955-100611977 GAGGGCCTAGACACCTCTGGGGG - Intergenic
1122665515 14:103326909-103326931 CAGAGCCCAAGCACACCTGGAGG + Intergenic
1124365006 15:29064885-29064907 CTGAGCCTGAGCAGCTCTGGTGG + Intronic
1124507348 15:30289799-30289821 CAGAGCATGATCTCATCTGGAGG - Intergenic
1124736207 15:32248860-32248882 CAGAGCATGATCTCATCTGGAGG + Intergenic
1129817027 15:78564634-78564656 CAGACACTTAGCACCTCTGGTGG - Intergenic
1130410081 15:83639863-83639885 CAGGGCCAAATCACCCATGGAGG + Intergenic
1130921185 15:88346133-88346155 CAGATCTCTATCACCTCTGGAGG - Intergenic
1133731913 16:8585291-8585313 CACAGCCAAATCACATCAGGAGG + Intronic
1135796939 16:25454540-25454562 CAGGGCCTAATCTCTTCGGGTGG - Intergenic
1137057197 16:35751406-35751428 CAGAGCCCTATCTCCTCAGGCGG - Intergenic
1147400768 17:40178760-40178782 CAGGGCTAAAGCACCTCTGGCGG - Intronic
1148505935 17:48127214-48127236 CAGTGCCTAATATCCCCTGGGGG - Intergenic
1150455140 17:65301254-65301276 CAGATCCTGATGATCTCTGGGGG - Intergenic
1153423369 18:4934102-4934124 CAGTGCCAAATGTCCTCTGGGGG + Intergenic
1161148815 19:2695809-2695831 GAGAGCCTCATCATCCCTGGCGG - Intronic
1163639368 19:18452657-18452679 CAGATCCTCATCACTGCTGGTGG + Intronic
1164839384 19:31381007-31381029 CAGCCCCTCCTCACCTCTGGAGG - Intergenic
926492784 2:13544950-13544972 CAGAGCCAAATCATATCAGGTGG + Intergenic
927130306 2:20052926-20052948 CAGAGACTATTCACCACTGAAGG + Intergenic
929363878 2:41127666-41127688 CAGAGCCTAACCATATCAGGAGG + Intergenic
929658997 2:43764252-43764274 AAGAGTCTAATGACCTTTGGAGG + Exonic
933473311 2:82755869-82755891 CAGAGCCAAATCATATCAGGAGG + Intergenic
944904020 2:204244642-204244664 CAGGGCCTCATTACCTCTGAAGG + Intergenic
945377728 2:209098901-209098923 CAGAGCCTTATCCCAGCTGGAGG + Intergenic
946172301 2:217902676-217902698 CTTTGCCTTATCACCTCTGGAGG - Intronic
948448251 2:238050647-238050669 CACAGCCTAGACACCACTGGAGG + Intronic
1170883376 20:20317291-20317313 CAGATCTGAATCACCCCTGGAGG + Intronic
1176132901 20:63503757-63503779 CAGAGCCTCCCCACCCCTGGAGG + Intergenic
1179276476 21:39896355-39896377 CAGAGTTTAATCACCTGAGGTGG + Intronic
1181764629 22:25082376-25082398 CAGAGGCCAGGCACCTCTGGAGG + Intronic
1182108917 22:27708986-27709008 CATAACCTAATCACCTCTTAAGG - Intergenic
1183101010 22:35584063-35584085 CAGAGCCTATGGCCCTCTGGGGG - Intergenic
1184897141 22:47416524-47416546 CACAGCCTCATCACCTCTTAGGG - Intergenic
1185012707 22:48324228-48324250 CACAGCCCCAACACCTCTGGAGG - Intergenic
1185159484 22:49214591-49214613 CATTGCCTGATGACCTCTGGGGG - Intergenic
949268170 3:2184701-2184723 CACAACCTCATCCCCTCTGGAGG + Intronic
953411114 3:42690984-42691006 CAGAGCTCAATGACATCTGGAGG + Exonic
955692808 3:61606812-61606834 CAGGGCCTCATCACCTCTTAAGG + Intronic
961549823 3:127662841-127662863 AAGACTCTAATCACCTCAGGAGG - Intronic
961892843 3:130144903-130144925 AAGGGCCTAATGAACTCTGGGGG - Intergenic
971996513 4:33972460-33972482 CATGGCCTAATCACCTCTGAAGG - Intergenic
973023576 4:45236199-45236221 CAGAGCCTTATCCCAGCTGGGGG - Intergenic
973785634 4:54330220-54330242 CTGAGCCTGATCACCTTTGAGGG - Intergenic
973870759 4:55163804-55163826 CAGAGCCAAATGACCTCAGTTGG + Intergenic
974828178 4:67155697-67155719 CAGAGCATAATGAACACTGGAGG + Intergenic
975693268 4:76986370-76986392 CACAGCCCAATCTCCTCTGCTGG - Intronic
976226039 4:82796691-82796713 CAGAGCCTGGTGACCTCTAGGGG - Intronic
977482749 4:97599274-97599296 CAGTGCTTATACACCTCTGGTGG + Intronic
981434953 4:144709512-144709534 CGGAGCCTCCCCACCTCTGGTGG + Intronic
982822249 4:159955737-159955759 AAGGCCCTAATCACCTCTGAAGG - Intergenic
983929983 4:173442867-173442889 CACAACCTAATCACCTCTTAAGG + Intergenic
987917944 5:24240433-24240455 CAGAGCATAAAAACCTGTGGGGG + Intergenic
991198671 5:63963187-63963209 CAGAGCCTGCAAACCTCTGGGGG + Intergenic
991211980 5:64116453-64116475 CAGAGCCTTATCCCAGCTGGGGG + Intergenic
992529552 5:77641393-77641415 CAGAGCATAAGCATCTCGGGGGG + Intergenic
999428360 5:151505943-151505965 CAGAGCCTAATGGCCTCTATGGG - Exonic
1000578841 5:163010329-163010351 CATAGCCTAATCACCTCCTATGG + Intergenic
1000754357 5:165138392-165138414 CAGAGCCTACTGACGGCTGGAGG + Intergenic
1001936668 5:175710380-175710402 AAGAGACTAAGCACCTCTGGGGG - Intergenic
1004340921 6:14806738-14806760 CAGAGCCTCATCTCCTGTGCAGG + Intergenic
1005256713 6:24011138-24011160 CAGAGCCAAATCATATCAGGAGG - Intergenic
1006941764 6:37756358-37756380 CAGAGACTTATGACTTCTGGTGG - Intergenic
1010005376 6:70990396-70990418 CAGAGCCAAATCATCTCAGGAGG - Intergenic
1016415084 6:143823713-143823735 CAGAGACTGATCATCTTTGGGGG + Exonic
1017029475 6:150208104-150208126 CATGACCTAATCACCTCTGAAGG + Intronic
1023362171 7:39428423-39428445 CAGAGATGAATCACCACTGGTGG + Intronic
1023821236 7:43981747-43981769 CAGAGCCCAGTTCCCTCTGGTGG + Intergenic
1029749506 7:102535171-102535193 CAGAGCCCAGTTCCCTCTGGTGG + Intergenic
1029767453 7:102634274-102634296 CAGAGCCCAGTTCCCTCTGGTGG + Intronic
1029870036 7:103680868-103680890 CAGGGCCTATTGACCTCTGCAGG - Intronic
1034950410 7:155292917-155292939 CAGAGACCAATCATGTCTGGGGG - Intergenic
1036774342 8:11599765-11599787 CACAGCCTCATCACCTCCTGAGG + Intergenic
1039834080 8:41242324-41242346 CAGAGCCTAATGACCTGGGAGGG - Intergenic
1040028230 8:42801123-42801145 TAGAGCCTAATCATCTGGGGTGG + Intergenic
1043480300 8:80645931-80645953 CATAGCCTAATCACCTCTTAAGG - Intronic
1045543820 8:103110811-103110833 CAGAGCCCACTCTACTCTGGTGG + Intergenic
1051786237 9:20746940-20746962 CTGAGGTTAATCACATCTGGAGG + Intronic
1052659344 9:31408068-31408090 CAGAGCCAATTTACCTTTGGTGG - Intergenic
1060973290 9:127751158-127751180 CGGGGCCTACTCACCTCTCGGGG + Exonic
1186879229 X:13848218-13848240 CAGAGCCTTCCCACCTCTGAAGG + Intronic
1187061117 X:15788239-15788261 CAGCGCCTCATCCCCTCTTGAGG + Intergenic
1187399947 X:18950719-18950741 CAGGGCCTAATCGCCTCTTATGG - Intronic
1189139986 X:38593578-38593600 CATAGCCTAATCACCTCTTAAGG - Intronic
1195319750 X:103711943-103711965 AAGAGCATAATGACCTCTGGGGG - Intronic
1196143885 X:112296063-112296085 CAGAGCCTCAGCTTCTCTGGAGG - Intergenic
1198479642 X:137029905-137029927 TAGAGCCTAATAATCTTTGGGGG + Intergenic