ID: 1089539158

View in Genome Browser
Species Human (GRCh38)
Location 11:119179675-119179697
Sequence ACCACCTGAAAAAGAAGCAG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 298
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 272}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089539158_1089539172 30 Left 1089539158 11:119179675-119179697 CCCCTGCTTCTTTTTCAGGTGGT 0: 1
1: 0
2: 1
3: 24
4: 272
Right 1089539172 11:119179728-119179750 AAGCCGGGAGGCGGTGGCTCAGG 0: 1
1: 0
2: 1
3: 172
4: 3349
1089539158_1089539169 18 Left 1089539158 11:119179675-119179697 CCCCTGCTTCTTTTTCAGGTGGT 0: 1
1: 0
2: 1
3: 24
4: 272
Right 1089539169 11:119179716-119179738 CATGGTGGGTAAAAGCCGGGAGG 0: 1
1: 0
2: 0
3: 9
4: 90
1089539158_1089539165 3 Left 1089539158 11:119179675-119179697 CCCCTGCTTCTTTTTCAGGTGGT 0: 1
1: 0
2: 1
3: 24
4: 272
Right 1089539165 11:119179701-119179723 ACGAGTGTTTGGGCGCATGGTGG 0: 1
1: 0
2: 0
3: 2
4: 43
1089539158_1089539171 24 Left 1089539158 11:119179675-119179697 CCCCTGCTTCTTTTTCAGGTGGT 0: 1
1: 0
2: 1
3: 24
4: 272
Right 1089539171 11:119179722-119179744 GGGTAAAAGCCGGGAGGCGGTGG 0: 1
1: 0
2: 6
3: 81
4: 1750
1089539158_1089539168 15 Left 1089539158 11:119179675-119179697 CCCCTGCTTCTTTTTCAGGTGGT 0: 1
1: 0
2: 1
3: 24
4: 272
Right 1089539168 11:119179713-119179735 GCGCATGGTGGGTAAAAGCCGGG 0: 1
1: 0
2: 2
3: 11
4: 113
1089539158_1089539162 -7 Left 1089539158 11:119179675-119179697 CCCCTGCTTCTTTTTCAGGTGGT 0: 1
1: 0
2: 1
3: 24
4: 272
Right 1089539162 11:119179691-119179713 AGGTGGTTCCACGAGTGTTTGGG 0: 1
1: 0
2: 0
3: 1
4: 54
1089539158_1089539161 -8 Left 1089539158 11:119179675-119179697 CCCCTGCTTCTTTTTCAGGTGGT 0: 1
1: 0
2: 1
3: 24
4: 272
Right 1089539161 11:119179690-119179712 CAGGTGGTTCCACGAGTGTTTGG 0: 1
1: 0
2: 0
3: 8
4: 74
1089539158_1089539170 21 Left 1089539158 11:119179675-119179697 CCCCTGCTTCTTTTTCAGGTGGT 0: 1
1: 0
2: 1
3: 24
4: 272
Right 1089539170 11:119179719-119179741 GGTGGGTAAAAGCCGGGAGGCGG 0: 1
1: 0
2: 0
3: 30
4: 258
1089539158_1089539167 14 Left 1089539158 11:119179675-119179697 CCCCTGCTTCTTTTTCAGGTGGT 0: 1
1: 0
2: 1
3: 24
4: 272
Right 1089539167 11:119179712-119179734 GGCGCATGGTGGGTAAAAGCCGG 0: 1
1: 0
2: 1
3: 6
4: 76
1089539158_1089539166 4 Left 1089539158 11:119179675-119179697 CCCCTGCTTCTTTTTCAGGTGGT 0: 1
1: 0
2: 1
3: 24
4: 272
Right 1089539166 11:119179702-119179724 CGAGTGTTTGGGCGCATGGTGGG 0: 1
1: 0
2: 0
3: 3
4: 59
1089539158_1089539163 0 Left 1089539158 11:119179675-119179697 CCCCTGCTTCTTTTTCAGGTGGT 0: 1
1: 0
2: 1
3: 24
4: 272
Right 1089539163 11:119179698-119179720 TCCACGAGTGTTTGGGCGCATGG 0: 1
1: 0
2: 0
3: 4
4: 38

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089539158 Original CRISPR ACCACCTGAAAAAGAAGCAG GGG (reversed) Exonic