ID: 1089539163

View in Genome Browser
Species Human (GRCh38)
Location 11:119179698-119179720
Sequence TCCACGAGTGTTTGGGCGCA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 43
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 38}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089539158_1089539163 0 Left 1089539158 11:119179675-119179697 CCCCTGCTTCTTTTTCAGGTGGT 0: 1
1: 0
2: 1
3: 24
4: 272
Right 1089539163 11:119179698-119179720 TCCACGAGTGTTTGGGCGCATGG 0: 1
1: 0
2: 0
3: 4
4: 38
1089539160_1089539163 -2 Left 1089539160 11:119179677-119179699 CCTGCTTCTTTTTCAGGTGGTTC 0: 1
1: 0
2: 0
3: 23
4: 201
Right 1089539163 11:119179698-119179720 TCCACGAGTGTTTGGGCGCATGG 0: 1
1: 0
2: 0
3: 4
4: 38
1089539155_1089539163 13 Left 1089539155 11:119179662-119179684 CCACAGTGACTCTCCCCTGCTTC 0: 1
1: 0
2: 1
3: 39
4: 384
Right 1089539163 11:119179698-119179720 TCCACGAGTGTTTGGGCGCATGG 0: 1
1: 0
2: 0
3: 4
4: 38
1089539159_1089539163 -1 Left 1089539159 11:119179676-119179698 CCCTGCTTCTTTTTCAGGTGGTT 0: 1
1: 0
2: 0
3: 27
4: 276
Right 1089539163 11:119179698-119179720 TCCACGAGTGTTTGGGCGCATGG 0: 1
1: 0
2: 0
3: 4
4: 38

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089539163 Original CRISPR TCCACGAGTGTTTGGGCGCA TGG Exonic