ID: 1089539164

View in Genome Browser
Species Human (GRCh38)
Location 11:119179699-119179721
Sequence ACCATGCGCCCAAACACTCG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 35
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 34}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089539164_1089539168 -9 Left 1089539164 11:119179699-119179721 CCACGAGTGTTTGGGCGCATGGT 0: 1
1: 0
2: 0
3: 0
4: 34
Right 1089539168 11:119179713-119179735 GCGCATGGTGGGTAAAAGCCGGG 0: 1
1: 0
2: 2
3: 11
4: 113
1089539164_1089539171 0 Left 1089539164 11:119179699-119179721 CCACGAGTGTTTGGGCGCATGGT 0: 1
1: 0
2: 0
3: 0
4: 34
Right 1089539171 11:119179722-119179744 GGGTAAAAGCCGGGAGGCGGTGG 0: 1
1: 0
2: 6
3: 81
4: 1750
1089539164_1089539167 -10 Left 1089539164 11:119179699-119179721 CCACGAGTGTTTGGGCGCATGGT 0: 1
1: 0
2: 0
3: 0
4: 34
Right 1089539167 11:119179712-119179734 GGCGCATGGTGGGTAAAAGCCGG 0: 1
1: 0
2: 1
3: 6
4: 76
1089539164_1089539170 -3 Left 1089539164 11:119179699-119179721 CCACGAGTGTTTGGGCGCATGGT 0: 1
1: 0
2: 0
3: 0
4: 34
Right 1089539170 11:119179719-119179741 GGTGGGTAAAAGCCGGGAGGCGG 0: 1
1: 0
2: 0
3: 30
4: 258
1089539164_1089539174 12 Left 1089539164 11:119179699-119179721 CCACGAGTGTTTGGGCGCATGGT 0: 1
1: 0
2: 0
3: 0
4: 34
Right 1089539174 11:119179734-119179756 GGAGGCGGTGGCTCAGGCCATGG 0: 1
1: 0
2: 4
3: 61
4: 588
1089539164_1089539175 18 Left 1089539164 11:119179699-119179721 CCACGAGTGTTTGGGCGCATGGT 0: 1
1: 0
2: 0
3: 0
4: 34
Right 1089539175 11:119179740-119179762 GGTGGCTCAGGCCATGGTGCTGG 0: 1
1: 0
2: 4
3: 33
4: 326
1089539164_1089539172 6 Left 1089539164 11:119179699-119179721 CCACGAGTGTTTGGGCGCATGGT 0: 1
1: 0
2: 0
3: 0
4: 34
Right 1089539172 11:119179728-119179750 AAGCCGGGAGGCGGTGGCTCAGG 0: 1
1: 0
2: 1
3: 172
4: 3349
1089539164_1089539169 -6 Left 1089539164 11:119179699-119179721 CCACGAGTGTTTGGGCGCATGGT 0: 1
1: 0
2: 0
3: 0
4: 34
Right 1089539169 11:119179716-119179738 CATGGTGGGTAAAAGCCGGGAGG 0: 1
1: 0
2: 0
3: 9
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089539164 Original CRISPR ACCATGCGCCCAAACACTCG TGG (reversed) Exonic