ID: 1089539169

View in Genome Browser
Species Human (GRCh38)
Location 11:119179716-119179738
Sequence CATGGTGGGTAAAAGCCGGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 90}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089539159_1089539169 17 Left 1089539159 11:119179676-119179698 CCCTGCTTCTTTTTCAGGTGGTT 0: 1
1: 0
2: 0
3: 27
4: 276
Right 1089539169 11:119179716-119179738 CATGGTGGGTAAAAGCCGGGAGG 0: 1
1: 0
2: 0
3: 9
4: 90
1089539164_1089539169 -6 Left 1089539164 11:119179699-119179721 CCACGAGTGTTTGGGCGCATGGT 0: 1
1: 0
2: 0
3: 0
4: 34
Right 1089539169 11:119179716-119179738 CATGGTGGGTAAAAGCCGGGAGG 0: 1
1: 0
2: 0
3: 9
4: 90
1089539160_1089539169 16 Left 1089539160 11:119179677-119179699 CCTGCTTCTTTTTCAGGTGGTTC 0: 1
1: 0
2: 0
3: 23
4: 201
Right 1089539169 11:119179716-119179738 CATGGTGGGTAAAAGCCGGGAGG 0: 1
1: 0
2: 0
3: 9
4: 90
1089539158_1089539169 18 Left 1089539158 11:119179675-119179697 CCCCTGCTTCTTTTTCAGGTGGT 0: 1
1: 0
2: 1
3: 24
4: 272
Right 1089539169 11:119179716-119179738 CATGGTGGGTAAAAGCCGGGAGG 0: 1
1: 0
2: 0
3: 9
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089539169 Original CRISPR CATGGTGGGTAAAAGCCGGG AGG Exonic