ID: 1089539171

View in Genome Browser
Species Human (GRCh38)
Location 11:119179722-119179744
Sequence GGGTAAAAGCCGGGAGGCGG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1838
Summary {0: 1, 1: 0, 2: 6, 3: 81, 4: 1750}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089539158_1089539171 24 Left 1089539158 11:119179675-119179697 CCCCTGCTTCTTTTTCAGGTGGT 0: 1
1: 0
2: 1
3: 24
4: 272
Right 1089539171 11:119179722-119179744 GGGTAAAAGCCGGGAGGCGGTGG 0: 1
1: 0
2: 6
3: 81
4: 1750
1089539164_1089539171 0 Left 1089539164 11:119179699-119179721 CCACGAGTGTTTGGGCGCATGGT 0: 1
1: 0
2: 0
3: 0
4: 34
Right 1089539171 11:119179722-119179744 GGGTAAAAGCCGGGAGGCGGTGG 0: 1
1: 0
2: 6
3: 81
4: 1750
1089539159_1089539171 23 Left 1089539159 11:119179676-119179698 CCCTGCTTCTTTTTCAGGTGGTT 0: 1
1: 0
2: 0
3: 27
4: 276
Right 1089539171 11:119179722-119179744 GGGTAAAAGCCGGGAGGCGGTGG 0: 1
1: 0
2: 6
3: 81
4: 1750
1089539160_1089539171 22 Left 1089539160 11:119179677-119179699 CCTGCTTCTTTTTCAGGTGGTTC 0: 1
1: 0
2: 0
3: 23
4: 201
Right 1089539171 11:119179722-119179744 GGGTAAAAGCCGGGAGGCGGTGG 0: 1
1: 0
2: 6
3: 81
4: 1750

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089539171 Original CRISPR GGGTAAAAGCCGGGAGGCGG TGG Exonic